ID: 1104495381

View in Genome Browser
Species Human (GRCh38)
Location 12:129232125-129232147
Sequence GTTGCAGCCCGGATCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104495381 Original CRISPR GTTGCAGCCCGGATCTTGGG AGG Intronic
903688350 1:25149597-25149619 GTTGCAGTCCTCACCTTGGGTGG - Intergenic
908177174 1:61567068-61567090 GTTTCAGCCAGGATGTTGGCTGG - Intergenic
909282281 1:73770741-73770763 GAGGCAGACAGGATCTTGGGTGG + Intergenic
912358919 1:109078434-109078456 GTTGCAGTCGGGATGTTGGCTGG + Intergenic
913533481 1:119749609-119749631 GTTGCAGCCCAGATGTTGTTAGG - Intronic
916695311 1:167229793-167229815 GGTGCAGCCAGCATCTTAGGAGG + Intronic
921376574 1:214480528-214480550 GTTACAGACTGGATTTTGGGAGG - Intronic
1069662400 10:70132375-70132397 GGTGTAACCCGGATCTTGCGAGG - Intronic
1073423682 10:103443432-103443454 GTTGGGGCCCCGATGTTGGGTGG - Intronic
1075862459 10:125689020-125689042 GCTGCAGCCCTGATGTTGGGAGG + Intergenic
1079106416 11:17575027-17575049 GTTGCAGGCCAGACCTTGGTGGG + Intronic
1083671839 11:64304309-64304331 GTTGCAGGCCTGAACTAGGGCGG - Intronic
1089993456 11:122882983-122883005 GTGGCCTCCCGGATCTGGGGTGG + Intronic
1097809883 12:64007087-64007109 GTTGAAGCTAAGATCTTGGGAGG - Intronic
1104495381 12:129232125-129232147 GTTGCAGCCCGGATCTTGGGAGG + Intronic
1111554909 13:89867987-89868009 GTTGCAACACGGATTTTGGAGGG - Intergenic
1118186643 14:63543570-63543592 GATGCAGCCGCGATCTCGGGCGG + Intergenic
1118767908 14:68922410-68922432 GTTGCAGCCAGAGCCTTGGGAGG - Intronic
1124889699 15:33721227-33721249 GTTGCATACTGGATGTTGGGTGG - Intronic
1129750063 15:78056498-78056520 ATTGCAGCCTGGAGTTTGGGAGG + Intronic
1131686987 15:94778896-94778918 GTTGCAGGATGGAGCTTGGGAGG + Intergenic
1132492047 16:237385-237407 GTTGCAGCCAAGATGTTGGCTGG + Intronic
1133957982 16:10463622-10463644 GTTGCAGTCAGGATGTTGGCAGG - Intronic
1141928079 16:87182290-87182312 GTTGCAGCCACGAGCCTGGGTGG + Intronic
1143634445 17:8156374-8156396 GTGGCAGCCCGGCCCGTGGGCGG - Intronic
1143723393 17:8828946-8828968 GGCGCAGCTGGGATCTTGGGCGG + Exonic
1151553619 17:74835781-74835803 CATGCAGCCCTGTTCTTGGGTGG - Intronic
1156069554 18:33189889-33189911 GTGGTAGCCCTAATCTTGGGTGG + Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1161479488 19:4503463-4503485 TCTGCAGCCCGGCGCTTGGGTGG + Exonic
1165871661 19:38976974-38976996 TTTGCATTCCGGATTTTGGGGGG + Intergenic
1168113683 19:54209138-54209160 CTTGCAACCAGGATGTTGGGTGG + Intronic
926235636 2:11041324-11041346 GCAGCAGCCTGGATCTTTGGAGG + Intergenic
926324266 2:11770837-11770859 GGTGCAGGCAGGTTCTTGGGCGG + Intronic
938018808 2:127889175-127889197 GTTTCAGACAGGATCTTGGTGGG + Intergenic
938083324 2:128381692-128381714 GTTGCTGCCCGGTCCTAGGGAGG + Intergenic
1169415904 20:5416029-5416051 GTTGCAGCCCAGATCCTTGGAGG - Intergenic
1173841846 20:46162621-46162643 CTTGTTGCCTGGATCTTGGGTGG + Intergenic
1178425727 21:32477493-32477515 GTTGCAGCCCGGATGGTGGCTGG + Intronic
949362681 3:3248047-3248069 GTTTCAACACGGATTTTGGGGGG + Intergenic
952386183 3:32843224-32843246 CATGCAGGCCAGATCTTGGGGGG - Intronic
954177559 3:48856636-48856658 GTTGCAGGCTGGGCCTTGGGAGG + Intergenic
968578873 4:1380505-1380527 GTTGCAGCCCGGGTCTGTGCTGG + Intronic
973945384 4:55949279-55949301 GTTGCAAACCGGAGATTGGGTGG + Intronic
984450779 4:179898412-179898434 GTTTCTGCCTGGATCCTGGGAGG - Intergenic
985444680 4:190015431-190015453 GTTGGAGCCCGGCTCCTGGTGGG - Intergenic
992017140 5:72586944-72586966 GTTGCAGTCAAGATCTTGGCAGG - Intergenic
995389795 5:111627445-111627467 GGTGCAGCCCCAATCTTGGCTGG - Intergenic
1006523233 6:34584058-34584080 CTTGCAGCCTGGTTCCTGGGTGG + Intergenic
1007767618 6:44170182-44170204 GCTGCAGCCTGGGTCTTGCGGGG + Intronic
1034475130 7:151277155-151277177 GCTGCAGCCCGGAGCGGGGGAGG + Intronic
1035237320 7:157507111-157507133 GTGGCAGCCAGGAGCTGGGGTGG - Intergenic
1036140179 8:6200600-6200622 TTTGCAGCCCAAATCTTGGTTGG - Intergenic
1036437661 8:8749890-8749912 GATCCAGCCCGGAGCTTGAGGGG - Intergenic
1038029420 8:23624134-23624156 GTTGAAGCTTGGAACTTGGGAGG + Intergenic
1048206300 8:132417954-132417976 TTTGCACCACGGACCTTGGGTGG - Intronic
1048329001 8:133459670-133459692 GTTCCATCCCGGAGCTTGGAGGG - Exonic
1049264628 8:141660833-141660855 TTTGGTGCCCTGATCTTGGGTGG + Intergenic
1061758380 9:132832342-132832364 GCTGCAGCCCGGCGCTTGGCTGG - Intronic
1188524732 X:31076377-31076399 GCTGGAGCCTGAATCTTGGGTGG - Intergenic
1189350956 X:40275357-40275379 GTTGCAGCCAGGGTGTTGGCCGG + Intergenic
1194379286 X:93174860-93174882 TTTGCAGCCTGCATCTTTGGGGG + Intergenic