ID: 1104500025

View in Genome Browser
Species Human (GRCh38)
Location 12:129276131-129276153
Sequence TAGGGGTTAGGGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 928
Summary {0: 1, 1: 3, 2: 7, 3: 89, 4: 828}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104500025_1104500037 7 Left 1104500025 12:129276131-129276153 CCCTCCACCCTCCCTAACCCCTA 0: 1
1: 3
2: 7
3: 89
4: 828
Right 1104500037 12:129276161-129276183 TTGCCAAGGATTTGCCCACTCGG 0: 1
1: 0
2: 2
3: 13
4: 175
1104500025_1104500039 9 Left 1104500025 12:129276131-129276153 CCCTCCACCCTCCCTAACCCCTA 0: 1
1: 3
2: 7
3: 89
4: 828
Right 1104500039 12:129276163-129276185 GCCAAGGATTTGCCCACTCGGGG 0: 1
1: 0
2: 0
3: 4
4: 55
1104500025_1104500033 -7 Left 1104500025 12:129276131-129276153 CCCTCCACCCTCCCTAACCCCTA 0: 1
1: 3
2: 7
3: 89
4: 828
Right 1104500033 12:129276147-129276169 ACCCCTAAAGGAAATTGCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 141
1104500025_1104500038 8 Left 1104500025 12:129276131-129276153 CCCTCCACCCTCCCTAACCCCTA 0: 1
1: 3
2: 7
3: 89
4: 828
Right 1104500038 12:129276162-129276184 TGCCAAGGATTTGCCCACTCGGG 0: 1
1: 0
2: 1
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104500025 Original CRISPR TAGGGGTTAGGGAGGGTGGA GGG (reversed) Intronic
900141601 1:1141302-1141324 TGGGGGTGAGGGCGGGGGGATGG - Intergenic
900620157 1:3583076-3583098 TTGGGGAAAGGGAGGGTGCAAGG + Intronic
900829197 1:4952213-4952235 TGGGGGGTAGGGATGGGGGATGG + Intergenic
901001557 1:6151420-6151442 TAGGAGTTTGGCAGGATGGAGGG - Intronic
901445801 1:9307399-9307421 CAGGGGCTGGGGAGGGAGGATGG - Intronic
902240853 1:15088398-15088420 TATGTGTTGGGGTGGGTGGAAGG + Intronic
902290588 1:15432336-15432358 TGGGGGTTAGAGAGGGTTGTGGG - Intergenic
902562214 1:17284648-17284670 AAAGGGGTTGGGAGGGTGGAGGG - Intergenic
902734350 1:18390421-18390443 TAGGTCTTTTGGAGGGTGGAAGG + Intergenic
902798385 1:18814515-18814537 TTGGGGTTAGGGAGGGGAGTAGG - Intergenic
903142615 1:21348113-21348135 TAAGGGTTAGGTACGGAGGAGGG + Intergenic
903201549 1:21743911-21743933 AAGGGCTGAGCGAGGGTGGAAGG + Intronic
903207019 1:21790158-21790180 TAGAAGTGAGGGAGGGTGCAGGG - Intergenic
903687018 1:25139301-25139323 TAGAGGAGAGGGAGGCTGGAGGG - Intergenic
904024901 1:27496713-27496735 TGGGGGTCAGGGAGAGGGGAGGG - Intergenic
905850928 1:41274307-41274329 CAGGGGTTAGGGATGGTGAGAGG - Intergenic
905867829 1:41385846-41385868 TAGGGGTTAGTGAGTGTGCTGGG + Intergenic
906775983 1:48530015-48530037 TGGGGGATAGGGAGAGGGGAAGG - Intergenic
906911679 1:49958693-49958715 GTGGGGTTGGGGAGGGGGGAGGG + Intronic
907077989 1:51595333-51595355 TAGAGGGAAGGGAGGATGGAGGG - Intronic
907435443 1:54443096-54443118 TGGGGTGTAGGGAGGGGGGAGGG - Intergenic
907915591 1:58865901-58865923 TAGGAGTTAGGATGGATGGAAGG + Intergenic
908002026 1:59689873-59689895 GAGGGGTTGGGGAGGGAGGAGGG - Intronic
908123557 1:61008012-61008034 GAGGGGTTAAGGGGGGTGGGGGG + Intronic
908372647 1:63498833-63498855 AAGGAGGGAGGGAGGGTGGAAGG + Intronic
908565430 1:65351006-65351028 TAGGGATTAGGGGTGCTGGAGGG - Intronic
909029500 1:70523042-70523064 AAGGGGTCAGGGAGGGAGAAAGG - Intergenic
909183690 1:72457785-72457807 GAGGGGAGAGGGAGGGAGGAAGG - Intergenic
910030772 1:82719967-82719989 TAGGGGGTTGGGAGGGAGGTGGG - Intergenic
910362727 1:86430355-86430377 TAGGAGCTAGGGAAGGAGGAAGG - Intronic
911110418 1:94178233-94178255 TATGGAATAGAGAGGGTGGAGGG + Intronic
912269360 1:108193327-108193349 AAGGGGGGAGGGAGGGAGGAGGG - Intronic
912302621 1:108533856-108533878 TTGGGGTTTGGGTGGGTGGTGGG - Intergenic
912713402 1:111965402-111965424 AAGGGGTCGGGGAGGGAGGAGGG - Intronic
913212693 1:116594866-116594888 TAGGGGTGAGGGTGGGAGGTTGG - Intronic
913521206 1:119647589-119647611 TGGGGCTAAGGGAGGGTGGGGGG - Intronic
914276585 1:146130043-146130065 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914537630 1:148580998-148581020 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914586545 1:149067451-149067473 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914677815 1:149917595-149917617 TAGGGGTGAGGGGGGTTGGTGGG - Intronic
915564564 1:156706401-156706423 TAGGGGGAAGGGAGGGAGGCGGG + Intergenic
916861082 1:168806330-168806352 TTGGGGTGAGGGAGTGGGGAAGG - Intergenic
917089709 1:171340674-171340696 TTGGGGTTGGGGAGGGATGAAGG + Intronic
918206858 1:182317208-182317230 AAGGGGTTAGGGATGGAGAAGGG - Intergenic
918300940 1:183203474-183203496 TAGGGGTGAGGGGGGGCGGGGGG - Intronic
919058064 1:192595408-192595430 TAGGGGTTAGGGAGGAGGAGGGG + Intergenic
919814756 1:201430331-201430353 TAGGGGCTAGGGAAGCTGCAAGG - Intergenic
919930028 1:202215101-202215123 ATGGGGTTAGTGAGGGTGGTGGG + Intronic
920080509 1:203369482-203369504 GAGGGGAGTGGGAGGGTGGAAGG - Intergenic
920390388 1:205596658-205596680 TGAGAGTTACGGAGGGTGGAGGG + Intronic
920574899 1:207052330-207052352 TAGGGGGTAGGTAGGAGGGAAGG + Intronic
920584211 1:207141731-207141753 GAGGGGTCAGGGAGGGTGAAGGG + Intronic
920719050 1:208369914-208369936 TAGGGGTTGGGGATGGGGCAGGG + Intergenic
921072152 1:211669867-211669889 GAGGGGTGATGGAGGGCGGACGG - Intronic
921341218 1:214136299-214136321 TGGGGGTTGGGGAGGGTTGAGGG + Intergenic
921924863 1:220703184-220703206 TAGGGGTGGGGCAGGGTGGTGGG + Intergenic
922062488 1:222105683-222105705 TGTGGGTTTGGGAGAGTGGAAGG - Intergenic
922461715 1:225818487-225818509 TAGAAGTTAGGGAGGTGGGAAGG + Intronic
922598824 1:226834497-226834519 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
922618783 1:226978345-226978367 GAGGTGTTCGGGTGGGTGGAGGG - Intronic
922640085 1:227221531-227221553 TAGTGGGAAGGGAGGGTGGGTGG - Intronic
923282332 1:232455938-232455960 TAGGGCTTATTGAGGGTGAAGGG + Intronic
923721144 1:236468113-236468135 TGGGGGCTGGGGTGGGTGGAGGG - Intronic
923747009 1:236710880-236710902 TGGGGGGTAGGGAAGGGGGATGG - Intronic
1062932236 10:1360971-1360993 GGGGGGCTGGGGAGGGTGGAGGG + Intronic
1063074017 10:2696306-2696328 CAGGGGTTGGTGAGGGTGGCTGG - Intergenic
1063180251 10:3591799-3591821 TGGGGGTGAGGGTGGGAGGAAGG + Intergenic
1063324179 10:5080682-5080704 TAGTGTTTAGGAAGGATGGAAGG + Intronic
1063336405 10:5219311-5219333 TAATGGTTAGGGAGGTGGGAGGG + Intergenic
1063370432 10:5518370-5518392 CAGGTGTTAGGGCTGGTGGATGG + Intergenic
1063486906 10:6428722-6428744 TGGGGATAAGGGAGGGTGGTGGG + Intronic
1064559184 10:16578871-16578893 TAGGGGTGAGAGAGGGAGTAGGG + Intergenic
1064961622 10:20971587-20971609 TAGGGTTGGGGGAGGGGGGAGGG - Intronic
1065042864 10:21715442-21715464 TTGGGGTTAGAGAGGGTGAAAGG + Intronic
1065289115 10:24212512-24212534 TAGAGGTCAGGGAGATTGGAAGG + Intronic
1065383858 10:25115191-25115213 AAGGAGGGAGGGAGGGTGGAAGG - Intergenic
1065383889 10:25115272-25115294 AAGGAGGGAGGGAGGGTGGAAGG - Intergenic
1065383920 10:25115353-25115375 AAGGAGGGAGGGAGGGTGGAAGG - Intergenic
1065383930 10:25115377-25115399 AAGGAGGGAGGGAGGGTGGAAGG - Intergenic
1065485309 10:26231205-26231227 TAGGAGACAGGGAGGGAGGAAGG + Intronic
1065528498 10:26645953-26645975 TGGGGGTGAGGCAGGGTGTAGGG + Intergenic
1066199011 10:33128057-33128079 GAGGGGAGAGGGAGGGGGGAAGG - Intergenic
1066433908 10:35379256-35379278 TAGGGGTTGGGGCTGGTCGAAGG + Intronic
1067178560 10:43968075-43968097 AAGGGGTTAGGAAGGGAGGTAGG + Intergenic
1067202986 10:44190346-44190368 CAGGGTTGGGGGAGGGTGGAGGG + Intergenic
1067481034 10:46597796-46597818 CGGGGGGTAGGGAGGGCGGAAGG - Intergenic
1067613717 10:47744026-47744048 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1067833193 10:49621946-49621968 TGGGGATGAGGGAGGGAGGAGGG + Intronic
1067919001 10:50433879-50433901 AAGGGGTTAGGGAGGAGAGATGG - Intronic
1068168341 10:53360072-53360094 TAGGGGATTGGGAGGGAGGTGGG - Intergenic
1068784872 10:60960957-60960979 TTGGGGTTCGTGGGGGTGGAGGG + Intronic
1069696130 10:70386895-70386917 GAGAGGTAAGGGAGGGAGGAAGG + Intergenic
1069894487 10:71672144-71672166 TGGGGGTCAGGGAGGGCAGAAGG + Intronic
1069909408 10:71750430-71750452 TAGGGGATGGGGAGGGCGGGGGG + Exonic
1070838495 10:79467043-79467065 CAGGGGCTGGGGAGGGTGGAGGG + Intergenic
1070959900 10:80491361-80491383 TGGGGGTGCGGGATGGTGGAGGG - Intronic
1071060136 10:81560532-81560554 TGGGGTTTGGGGAGGGGGGAGGG - Intergenic
1071187087 10:83058393-83058415 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1071249025 10:83796938-83796960 GAGGGGACAGGGAGGGAGGAGGG + Intergenic
1071438395 10:85667942-85667964 TAGGGCTTAGGGATGGGGAATGG - Intronic
1071536457 10:86436017-86436039 TAGGGGTTGGGGTGGGTAGAAGG + Exonic
1071629128 10:87203998-87204020 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1071731948 10:88256842-88256864 GAGGAGTGAGGGAGGGTGAATGG - Intergenic
1071971415 10:90911501-90911523 TAGGGGGTGGGGTGGGAGGAAGG + Intergenic
1072196653 10:93121890-93121912 AAGGAGTGAGGGAAGGTGGACGG - Intergenic
1072225539 10:93365174-93365196 TAGGCATTAGGGAGGGAGGAGGG - Intronic
1073153951 10:101331674-101331696 TTGGGGTGAGGGAGGGGGGAAGG + Intergenic
1073240672 10:102055930-102055952 GAGGGGAGAGGGAGGGAGGACGG - Intronic
1073389918 10:103166287-103166309 TAGAGATTGGGGTGGGTGGAGGG - Intronic
1075382402 10:122029912-122029934 CAGGGGGTGGGGAGGGTGGGAGG + Intronic
1075719468 10:124576452-124576474 TAGGGGTTCTGGAGGCAGGATGG - Intronic
1076215433 10:128689539-128689561 TGGGGGTACTGGAGGGTGGAGGG + Intergenic
1076230142 10:128813446-128813468 AAGGAGGGAGGGAGGGTGGAAGG + Intergenic
1077317817 11:1927145-1927167 GAGGTGGAAGGGAGGGTGGAGGG + Intronic
1077376088 11:2205648-2205670 TGGGAGTTGGGGAGGTTGGAAGG - Intergenic
1078133738 11:8635432-8635454 CTGGGGTTGGGCAGGGTGGAGGG - Intronic
1078173047 11:8944419-8944441 AAGGGGTTAGAGAAGGAGGAGGG - Intergenic
1078309520 11:10226471-10226493 GTGGGGTTGGGGAGGGGGGAGGG - Intronic
1078803171 11:14667688-14667710 TGGGGTTGGGGGAGGGTGGAGGG + Intronic
1078996141 11:16701765-16701787 GAGGGGTTCGGGGGGGTGGGAGG + Intronic
1079035773 11:17018615-17018637 CAGGAGTTAGGGATGGTGGTGGG + Intergenic
1079101603 11:17545276-17545298 GAGGTGTTAGGGAAGGTGGGAGG - Intergenic
1080824578 11:35837225-35837247 GAGGGGCTAGGAAGGGTGGAGGG - Intergenic
1080912231 11:36614059-36614081 TGGGGTTGGGGGAGGGTGGAGGG - Intronic
1081000188 11:37659739-37659761 GTGGGGTGGGGGAGGGTGGAGGG + Intergenic
1081102654 11:39024421-39024443 GAGGAGGGAGGGAGGGTGGAAGG - Intergenic
1082246921 11:49934555-49934577 TAGGGTTTATGGAGGAAGGAGGG + Intergenic
1082628642 11:55515371-55515393 TGGGGTTGAGGGAGGGGGGAGGG - Intergenic
1082755503 11:57072086-57072108 GAGTGGTTAGGGAGGGGTGATGG - Intergenic
1082814685 11:57500068-57500090 AAAGGCTTAGGGAGGTTGGAGGG - Intronic
1082923103 11:58517289-58517311 AATGAGTAAGGGAGGGTGGAGGG - Intergenic
1083014340 11:59437334-59437356 TAGGGGTCAGGGAGAGGGAAGGG - Intergenic
1083316003 11:61815493-61815515 TAGTGGATAGGGACAGTGGAGGG + Intronic
1083338854 11:61945728-61945750 GAGGGGTGGGGGTGGGTGGAAGG + Intergenic
1083592502 11:63903931-63903953 TAGGGGTGAGTGAGGGCGGGAGG - Intronic
1084113245 11:67026874-67026896 TAGGGGTTAGGGGGTCTGTATGG + Intronic
1084194770 11:67518219-67518241 ATGGAGTTAGGGAGGGAGGAAGG + Intergenic
1084421849 11:69064279-69064301 CGGGGGATAGGGAGGGGGGAGGG - Intronic
1084525789 11:69697287-69697309 CAGGGATTAGGGATGGTGGAGGG - Intergenic
1084536880 11:69762565-69762587 TAGGGGTTAGGAAGGGCTGCGGG + Intergenic
1084979227 11:72820381-72820403 CAGGGGTTAGGGATGGTTGGGGG - Intronic
1084998409 11:73006232-73006254 TAGGGTTTAGGGAAGGTGTCTGG - Intronic
1085084842 11:73660334-73660356 CAGGGGTTGGGGAGGAAGGAAGG - Intronic
1085806692 11:79643157-79643179 TAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1085830991 11:79900844-79900866 TAGAGGCTGGGGAGGGTGGGTGG + Intergenic
1086481160 11:87241646-87241668 TAGTGGTGGGGCAGGGTGGAGGG - Intronic
1087460362 11:98437663-98437685 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087951558 11:104227142-104227164 TAGAGGTGAGGTGGGGTGGATGG + Intergenic
1087953184 11:104251235-104251257 TGGGGTGGAGGGAGGGTGGAGGG - Intergenic
1088390857 11:109313734-109313756 TGGGGTTGAGGGAGGGGGGAGGG - Intergenic
1088490506 11:110382923-110382945 TGGGGTTTGGGGAGGGGGGAGGG - Intergenic
1090244645 11:125207212-125207234 AAGGGAGGAGGGAGGGTGGAAGG - Intronic
1090640668 11:128726522-128726544 TAGGGGGGTGGGAGGGTGGCAGG - Intronic
1091575765 12:1733748-1733770 TGGGGTTGAGGGAGGGGGGAGGG - Intronic
1091669844 12:2445143-2445165 TAGGGAGTAGGGAATGTGGAGGG - Intronic
1091842019 12:3628137-3628159 TGGGGGAGAGGGAGGGAGGAAGG - Intronic
1091899585 12:4134283-4134305 TTGGGGTGAGGGTGGTTGGAGGG - Intergenic
1091981374 12:4866701-4866723 TGGGGTCTAGGCAGGGTGGATGG + Intergenic
1091994455 12:4982294-4982316 TTGGGGTTTGGGTGGGTGGATGG + Intergenic
1092223483 12:6731153-6731175 TTGGGGTTAGGGGAGGTGAAGGG - Exonic
1093322131 12:17724737-17724759 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1093893563 12:24552077-24552099 TAGGGGTTGGGGAGTGGGGAAGG - Intergenic
1094037206 12:26084067-26084089 TAGGGTTGGGGGAGGGGGGAGGG + Intergenic
1094398582 12:30036219-30036241 TTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1095945412 12:47750853-47750875 GGGGGGTTTGGGAGTGTGGAGGG + Intronic
1096355571 12:50938192-50938214 TAGGGGGGTGGGGGGGTGGAGGG - Intergenic
1096448854 12:51720455-51720477 TAGGGTTGGGGGAGGGGGGAGGG + Intronic
1096638617 12:52976778-52976800 AAGGGCTGAGGGAGGGGGGATGG + Intergenic
1096984332 12:55745983-55746005 GGGGGGTTAGGGTGGGGGGAAGG + Intronic
1097053966 12:56239197-56239219 TAGGGGTTGGGTTGGGAGGAGGG + Exonic
1097159494 12:57036276-57036298 TAGGGGTTAGGGTGGATGTTAGG - Intronic
1097542345 12:60956446-60956468 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1098317854 12:69210968-69210990 TCAGGGGAAGGGAGGGTGGATGG - Intergenic
1098565800 12:71934222-71934244 TGGGGGTTGGGGAGGGTAGGAGG - Intergenic
1098621024 12:72598874-72598896 GAGGGGTAAGGGAGGGACGAAGG - Intronic
1099109999 12:78546850-78546872 TGGGGGTTAGGGTGGGGGGAGGG + Intergenic
1099303049 12:80921547-80921569 AAGGCGTTGGGGAGGGTGGGAGG + Intronic
1099880111 12:88457669-88457691 CAGGGGTTATGGAGCGTGTAAGG + Intergenic
1100005606 12:89891412-89891434 GTGGGGTGAGGGAGGGGGGAGGG + Intergenic
1100388926 12:94130046-94130068 GTGGGGTTGGGGAGGGAGGAGGG - Intergenic
1100940152 12:99716436-99716458 AAGGAGTAATGGAGGGTGGAAGG - Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1101699492 12:107158837-107158859 TAGAGGTGAGAGAGAGTGGAAGG + Intergenic
1102420512 12:112799677-112799699 CAGGGGTTAGGGAAGGTGAAGGG - Intronic
1102445567 12:112999640-112999662 TAGGGGTTAGGGTGGGCACAGGG - Intronic
1102691270 12:114763015-114763037 GTGGGGGCAGGGAGGGTGGAAGG - Intergenic
1103238915 12:119397805-119397827 AAGGGGGGAGGGAGGGGGGAGGG + Intronic
1103552051 12:121744864-121744886 TAAGGGGTAGAGAGTGTGGATGG + Intronic
1103747138 12:123132674-123132696 CAGGGGTTGGGGAGGGGAGATGG - Intronic
1103800641 12:123534632-123534654 TGGGGGGCGGGGAGGGTGGATGG - Intergenic
1103956804 12:124581979-124582001 TAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1104437488 12:128767385-128767407 CAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1104500025 12:129276131-129276153 TAGGGGTTAGGGAGGGTGGAGGG - Intronic
1104723722 12:131061793-131061815 CAGGAGTTAGGGATGGTAGAAGG - Intronic
1105215940 13:18285489-18285511 TAGGGGTGAGGGTGGGAGGTTGG - Intergenic
1105261974 13:18786272-18786294 TGGGGGTTGGGGAGGGTTGCGGG - Intergenic
1105347750 13:19589490-19589512 TAGGAGTTAGGCAGGGCAGAAGG - Intergenic
1105395726 13:20032412-20032434 TAGGGGTGGGGCAGGGTGGGAGG + Intronic
1106842404 13:33698263-33698285 TAGGGGTTAGGGTGGGAAGAGGG - Intergenic
1107112545 13:36713454-36713476 CAGAGGCTGGGGAGGGTGGAGGG - Intergenic
1107802580 13:44123209-44123231 GTGGGGTTGGGGAGGGCGGAGGG - Intergenic
1107994284 13:45845812-45845834 AAGGGGTGAGGGAGTGAGGAAGG + Intronic
1108104750 13:46997263-46997285 TAGGGAGTGGGGATGGTGGAGGG - Intergenic
1108250308 13:48560307-48560329 CAGGGGTTAAGGATGGGGGAGGG + Intergenic
1108532498 13:51340957-51340979 TAGGGGCTAGGGACGGCTGAGGG - Intronic
1108641247 13:52384392-52384414 TGTGGGATAGGGAGGGTGGGTGG - Intronic
1109038362 13:57296445-57296467 GGGGAGTTTGGGAGGGTGGAGGG + Intergenic
1109157489 13:58928748-58928770 CAGGGGTTGGGGAGGGTGGGAGG + Intergenic
1109691367 13:65895028-65895050 GAGGGGTTAGGGAGGGGAGAGGG + Intergenic
1109923212 13:69098338-69098360 TCTGGGTGAGGGAGGGAGGATGG - Intergenic
1109980725 13:69902755-69902777 TAGGGTTGGGGGAGGGGGGAGGG + Intronic
1110443540 13:75550617-75550639 TGGGGGTTGGGGAGGGAGGAGGG + Intronic
1111777228 13:92679883-92679905 AAGGGGGTGGGGAGGGTGGGGGG - Intronic
1112563433 13:100533144-100533166 TAGGAGTTGGGAAGGGTGGAAGG - Intronic
1112782156 13:102912903-102912925 AAGGAGGTAGAGAGGGTGGAAGG - Intergenic
1113902327 13:113804040-113804062 TGGGGGCTGGGGAAGGTGGAGGG + Intronic
1113918266 13:113887728-113887750 CAGGGGTGAGGGAGGAGGGAGGG - Intergenic
1114127984 14:19753057-19753079 GAGGTGTGAGGAAGGGTGGAGGG + Intronic
1114257999 14:21018726-21018748 TTGGGGTGAGTGAGGGAGGAGGG - Intronic
1114270014 14:21094719-21094741 TAGGGGTTGGGGGGGGGGGCGGG + Intronic
1114693452 14:24606352-24606374 TGGGGTTTAGGGAGGAGGGAGGG + Intergenic
1114860345 14:26510565-26510587 TGAGGGTTGGGGATGGTGGATGG + Intronic
1115650861 14:35402325-35402347 TAGGGGCCTGGGAGGGTGAAGGG + Intronic
1116363158 14:44027078-44027100 TGGGGTGGAGGGAGGGTGGAGGG + Intergenic
1116945884 14:50834812-50834834 TGGGGGCTAAGGTGGGTGGATGG + Intergenic
1117251125 14:53939816-53939838 TAGGGGTGAGGGAGAGGGGGAGG - Intergenic
1118035582 14:61862775-61862797 CAGGGGTTAGAAAGGGTAGAAGG - Intergenic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119217819 14:72882754-72882776 TAGGGGGAGGGCAGGGTGGATGG - Intronic
1119471612 14:74903599-74903621 TGGGGGTGGGGGAGGGGGGAAGG + Exonic
1119675050 14:76547323-76547345 TAGGGGTTAGGGGGCTTGGAGGG - Intergenic
1119935150 14:78585506-78585528 TAGGGACAAGGGAGGGTGGAGGG + Intronic
1120015811 14:79471995-79472017 TGGGCCTTTGGGAGGGTGGAGGG - Intronic
1120251541 14:82065542-82065564 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1120554656 14:85914824-85914846 CAGGGCTTAGGGAGGAAGGAAGG - Intergenic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121235978 14:92391492-92391514 ATGGGGTAAGGGAGTGTGGACGG - Intronic
1121366809 14:93320260-93320282 TGGGGGTTAGGGAGGGTGGAAGG - Intronic
1122294522 14:100697829-100697851 GAGGGGTGGGGGAGGGTGGTAGG + Intergenic
1122507479 14:102240870-102240892 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1122586633 14:102812156-102812178 TAGAGGTTAGGAAGGGTAGGAGG - Intronic
1122838469 14:104442929-104442951 CACGGGTGAGGGAGTGTGGATGG + Intergenic
1122900699 14:104781236-104781258 CAGGGGTTAGGGAGGGGGCCAGG + Intronic
1124011194 15:25840050-25840072 CAGGGGTTAGGGATGCAGGAGGG - Intronic
1124068773 15:26371586-26371608 AAGGGTTTGGGGAGGGCGGAGGG - Intergenic
1124202067 15:27687060-27687082 GAGGAGTTTGGGAGGCTGGAGGG + Intergenic
1124783551 15:32658503-32658525 TATGGGGAAGGGAGGGTGGCAGG + Intronic
1124824460 15:33080302-33080324 TAGGAGTGAAGGAAGGTGGAAGG + Intronic
1124914090 15:33951412-33951434 AAGGGGTGGGGGAGGGAGGAGGG + Intronic
1124954402 15:34350639-34350661 TAGGTGTCAGGGCAGGTGGATGG + Intronic
1125073532 15:35584991-35585013 TATGGGTTGGGGAGGGAGGTTGG + Intergenic
1125298374 15:38227534-38227556 TAGGGGGTAGGCGGGGTGAAGGG + Intergenic
1125983456 15:44025955-44025977 AAGGAATTAAGGAGGGTGGAAGG - Intronic
1126825824 15:52546635-52546657 TAGGGCTTTGGGTGGGGGGACGG + Intergenic
1127155239 15:56117300-56117322 TGGGTGTTAGGGTGGGTGGAGGG + Intronic
1127378443 15:58406758-58406780 GTGGGGATAGTGAGGGTGGAGGG - Intronic
1128150826 15:65362552-65362574 AAGGGGTGAGGGTGGGTGGGGGG + Intronic
1128225543 15:65998908-65998930 TAGGGGTTTGGGACTTTGGAGGG + Intronic
1128325142 15:66719358-66719380 GAGGGGCTAGCGAGGGTGCAGGG + Intronic
1128736998 15:70058985-70059007 TGAGGCCTAGGGAGGGTGGAAGG + Intronic
1129021475 15:72523474-72523496 TAGGGGTTAGTGAAGAGGGAGGG + Intronic
1129273660 15:74432449-74432471 TCTGGGTTAGGGAGGGGAGAAGG - Intronic
1129391704 15:75224023-75224045 TGGGGGTCAGGGAGGGGGGTGGG + Intergenic
1129675707 15:77631753-77631775 TGGGGAGTAGGGAGAGTGGAAGG - Intronic
1129996678 15:80012759-80012781 CAGGGGTTAGGGAGTAGGGAGGG - Intergenic
1130240126 15:82180184-82180206 TAGGAGTTGGGGAGTGGGGACGG - Intronic
1130571321 15:85046704-85046726 CAAGGGATAGGGAGGGTAGAGGG + Intronic
1130776922 15:86993967-86993989 TTGGGGTTTGGCAGGATGGATGG - Intronic
1131285516 15:91053781-91053803 CTGGGGTTAGGGAGGGGTGAAGG - Intergenic
1131380446 15:91959269-91959291 TGGGGGTTGGGGAGGTTGGAAGG + Intronic
1131447586 15:92512766-92512788 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1132262864 15:100441534-100441556 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1132499419 16:278741-278763 TAGGGGCTGGGCAGGGTGGGCGG + Intronic
1132573321 16:653492-653514 GAAGGGTGAGGGAGGGTGTAGGG - Intronic
1132966966 16:2662040-2662062 TAAGGGCTAGGGAGGGGGTATGG - Intergenic
1133384604 16:5358950-5358972 GAAGGGTAATGGAGGGTGGAGGG - Intergenic
1134203980 16:12222249-12222271 CAGGGGTGAGGGTGGGTTGAGGG + Intronic
1134908144 16:17999720-17999742 TGGGGGTTAAGGTGGGGGGAGGG + Intergenic
1135640238 16:24113517-24113539 AAGGGGGGAGGGAGGGAGGAAGG - Intronic
1135899812 16:26446985-26447007 AAGAGGTTAGTGAGGATGGATGG - Intergenic
1136287454 16:29252859-29252881 TGAGGGGCAGGGAGGGTGGAGGG + Intergenic
1136484992 16:30565908-30565930 TAGGGGACAGGGAGTGGGGAAGG - Intergenic
1136550779 16:30981268-30981290 CCGGGGTTAGGGAGTGTGCAAGG - Intronic
1136619223 16:31416991-31417013 GAGGGGGGAGGGAGGGGGGAAGG - Intronic
1136682998 16:31978758-31978780 TTGGGCTGAGGGAGGGTGGTGGG + Intergenic
1136783638 16:32922314-32922336 TTGGGCTGAGGGAGGGTGGTGGG + Intergenic
1136886152 16:33931492-33931514 TTGGGCTGAGGGAGGGTGGTGGG - Intergenic
1137236819 16:46624180-46624202 CAGGGCTTAGGGAGGGAGGGAGG - Intergenic
1137420132 16:48326325-48326347 TGTGGGTTAGGGATGGAGGAGGG - Intronic
1137966419 16:52938270-52938292 CAGGGGTTAGGGAGGAGGGAGGG + Intergenic
1138686389 16:58729804-58729826 TGGGGCTGAGGGAGGGTGGTGGG - Intronic
1138726999 16:59151173-59151195 TGGGAGATAGGGAGGGTGAAGGG - Intergenic
1138733167 16:59218812-59218834 TTTGGGTTAGGGTGAGTGGAAGG - Intergenic
1141193627 16:81842884-81842906 GAGGGCTGAGGGAGGGTGGCTGG + Intronic
1141565195 16:84896947-84896969 ACGGGATTAAGGAGGGTGGACGG - Intronic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141993182 16:87621755-87621777 TTGGGGTTTGGGTGGGTGGTGGG + Intronic
1142093069 16:88225488-88225510 TGAGGGGCAGGGAGGGTGGAGGG + Intergenic
1142340447 16:89518765-89518787 TAGGGGTTAAGGATGGGGGAAGG + Intronic
1203086284 16_KI270728v1_random:1186308-1186330 TTGGGCTGAGGGAGGGTGGTGGG + Intergenic
1142775542 17:2135467-2135489 TTGGGGTTGGTGGGGGTGGACGG - Intronic
1143539079 17:7558798-7558820 TGAGGCTGAGGGAGGGTGGAGGG + Exonic
1143554617 17:7652338-7652360 TCGGGGGTTGGGGGGGTGGAGGG + Intronic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1145014084 17:19385574-19385596 TTGGGGGTGGGGAGGGTGGTGGG + Intronic
1145043868 17:19596940-19596962 GAAGGGTTAGTGAGGGTAGAAGG + Intergenic
1145203097 17:20964586-20964608 AAGGGGTGAGGAAGGGTGGAGGG - Intergenic
1145961116 17:28887009-28887031 TAGGGGAGAGGGAGGGAGGGAGG + Intronic
1146477527 17:33174961-33174983 TAGGGGGCAGGGAGAGAGGAGGG - Intronic
1146671826 17:34743132-34743154 TGTGGGTTAGGAGGGGTGGAGGG - Intergenic
1146688340 17:34856656-34856678 GAGGGGTTGGAGAGGATGGAGGG + Intergenic
1147050143 17:37788239-37788261 AAGGGGAGAGGGAGGGAGGAGGG - Intergenic
1147119157 17:38325461-38325483 GAGGGGTGGGGGAGGGTGGATGG + Intergenic
1147143903 17:38474467-38474489 TTGGGCTGAGGGAGGGTGGTGGG + Intronic
1147662633 17:42125158-42125180 TTGGGGTGACCGAGGGTGGAGGG + Intronic
1147836519 17:43336427-43336449 TAAGGGCTAGGGAGGGGGTAAGG - Intergenic
1147836969 17:43340163-43340185 TAAGGGCTAGGGAGGGGGTATGG - Intergenic
1148243120 17:46012909-46012931 TGGGGGACAGGGAGGATGGATGG - Intronic
1148974667 17:51516551-51516573 TTGGGGTTGGCAAGGGTGGAGGG + Intergenic
1149443472 17:56694980-56695002 CAGGGGTTAGGGGAGGGGGAAGG - Intergenic
1150493808 17:65592470-65592492 TAGGGGTTGGAGAGGTTGGAGGG - Intronic
1150580583 17:66470284-66470306 TGGGGGTTGGGGAGGGGGGGTGG - Intronic
1151368149 17:73630465-73630487 TGGGGGTTGAGGAGGGAGGAGGG - Intronic
1152871074 17:82753205-82753227 TAGGAGTCAGGCAGGGTGGGGGG + Intronic
1152891043 17:82881925-82881947 TAGGAGGGAGGGAGGGAGGAAGG - Intronic
1153814141 18:8778699-8778721 GGGAGGTTGGGGAGGGTGGAAGG - Intronic
1153836750 18:8970484-8970506 GAGGGGGAAGGGAGGGAGGAAGG + Intergenic
1154426720 18:14277842-14277864 TGGGGGTTGGGGAGGGTTGGGGG + Intergenic
1154431738 18:14313782-14313804 TGGGGGTTGGGGAGGGTTGGGGG + Intergenic
1154532978 18:15367116-15367138 TGGGGTTGGGGGAGGGTGGAGGG - Intergenic
1154947570 18:21177266-21177288 TAGGGACTAGGGAGGGAGGGAGG + Intergenic
1154966904 18:21367463-21367485 GGGGAGTGAGGGAGGGTGGACGG + Intronic
1155228005 18:23747081-23747103 TGGGGGTCAGGGAGCCTGGAAGG + Intronic
1155776628 18:29771196-29771218 AAGGGGATAGGGATGGTAGAAGG + Intergenic
1157117554 18:44876331-44876353 TGGGGGTGTGGGAGGGTGTAAGG - Intronic
1157523428 18:48361036-48361058 TAGAGGCTAGGGAGGGAGGAAGG + Intronic
1157682189 18:49615833-49615855 TGGGGGTTGGGGGGGGTGGGTGG + Intergenic
1157879901 18:51311570-51311592 TTGGGGTAAGGGAGAGAGGATGG + Intergenic
1158228328 18:55224594-55224616 GAGGGGTTGGGGAGTGGGGAGGG - Intronic
1159034401 18:63263115-63263137 TAGGGGGCAGCGAGGGTGGACGG + Intronic
1159590763 18:70332721-70332743 TTGGGGGTGGGGAGGGTAGAGGG - Intergenic
1160632907 18:80258764-80258786 TAGGGGTAAGGGAGGGTTAGGGG + Intergenic
1160677182 19:397684-397706 TAGGTGTTCAGGATGGTGGACGG - Intergenic
1160677555 19:399477-399499 AAGGGGTTAGGGAGGTGAGAGGG + Intergenic
1160989918 19:1856272-1856294 GAGGGGCACGGGAGGGTGGAGGG + Intronic
1161227508 19:3153890-3153912 TGGGGGTGTGGGTGGGTGGATGG + Intronic
1161241364 19:3225392-3225414 GTGGGGTGAGGGAGGGAGGAAGG - Intronic
1161265962 19:3364751-3364773 TACAGGGGAGGGAGGGTGGAAGG + Intronic
1161422867 19:4185214-4185236 TAGGTGTTTGGGTGGGTGGATGG + Intronic
1161494502 19:4580167-4580189 TTGGGTTTAAGGAGGGAGGAGGG - Intergenic
1161612408 19:5250636-5250658 GAGGGGGTCGGGAGGGTGGGCGG + Intronic
1161928963 19:7323408-7323430 CAGGGGCTGGGGAGGGGGGATGG - Intergenic
1161978659 19:7619551-7619573 GAGGGGGTGGGGAGGGGGGATGG + Exonic
1162087619 19:8258003-8258025 TGGGGGTCAGGGAGGTGGGAGGG + Intronic
1162389010 19:10378043-10378065 TGGGTGGTTGGGAGGGTGGATGG + Intronic
1162736135 19:12748143-12748165 GAGGGGGTGGGGAGGGTGGAGGG - Exonic
1162910992 19:13847695-13847717 TAGGGGGGAGGGTGTGTGGAGGG - Intergenic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163093821 19:15041287-15041309 GAGGGGGGAGGGAGGGGGGAGGG - Intergenic
1163729633 19:18941398-18941420 AGGGGGTTAGGGGCGGTGGAGGG + Intergenic
1164025353 19:21346646-21346668 AAGGGGGTAGGGAGGGAGGGAGG + Intergenic
1164083644 19:21882024-21882046 TAAGGGCTAGGGAGGGGGTATGG - Intergenic
1164202644 19:23031268-23031290 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1164258613 19:23550495-23550517 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1164530876 19:29047346-29047368 TAGGGCCTAGGGAGGGTGAGGGG - Intergenic
1164744217 19:30599332-30599354 GAGGGATCAGGGAGGGAGGAAGG - Intronic
1164757386 19:30700328-30700350 GAGGGGGGAGGGAGGGAGGAAGG - Intronic
1165832452 19:38736391-38736413 CAGGGGTTAGGCAGGGTGGACGG - Intronic
1165941491 19:39416773-39416795 GAGGGGTTAGGGAGGGGCCAGGG - Intronic
1166044927 19:40224454-40224476 GTGGGGTTTGGGAGGGTGGATGG - Intronic
1166207474 19:41281005-41281027 TAGGGGTGGGGAAGGGTGAAAGG - Intronic
1166333689 19:42092585-42092607 TAGGGGCTGGGGAGGGGCGAAGG + Intronic
1166409397 19:42546741-42546763 ACAGGGTTGGGGAGGGTGGAAGG + Intronic
1166765649 19:45251266-45251288 GAGGGGCTGGGGAGGGAGGAAGG - Exonic
1166881869 19:45934839-45934861 TAGGGGTGAGGGATGGGGGTGGG + Exonic
1166886051 19:45961530-45961552 AGGGGGTCAGGGAGGGTGGGAGG + Intronic
1167062958 19:47162584-47162606 TAGGGGGTGGGGAGGGTAGAGGG - Intronic
1167121690 19:47521113-47521135 CAGGGGACAGGGAGGGTGGGGGG + Exonic
1167245206 19:48369108-48369130 GGGGGGGTAGGGACGGTGGAAGG - Intronic
1167427587 19:49437342-49437364 TAGGGGGTAGGGAGGGGGAGTGG + Intronic
1167434058 19:49468840-49468862 TAGGGGATAGAGAGAGTGAAAGG - Intronic
1167541256 19:50088941-50088963 TAGGGGTTTGGGAGGAGGGAAGG + Intergenic
1167628837 19:50610545-50610567 TAGGGGTTTGGGAGGAGGGAAGG - Intergenic
1167636705 19:50659784-50659806 GCGGGGTTGGGGAGGGTGTAGGG - Intronic
1167663181 19:50808416-50808438 TATGGGTTAGGGACAGTGTAGGG - Intergenic
1167900908 19:52621645-52621667 TAGGAGGAATGGAGGGTGGATGG - Intronic
1167958250 19:53085379-53085401 AAGATGTGAGGGAGGGTGGAAGG + Intronic
1202676819 1_KI270711v1_random:14728-14750 TAGGGTGTGGGGAGGGAGGAGGG - Intergenic
925017594 2:543654-543676 TAGGAGGCAGGGAGGGGGGAGGG + Intergenic
925316479 2:2930411-2930433 TGGGTGTGAGGGAGGATGGAAGG - Intergenic
925336414 2:3102185-3102207 TGGGGGCTAGGGAGGGTTAAAGG - Intergenic
925420207 2:3704499-3704521 TAGGGGAGGGGGAGGGGGGAGGG + Intronic
925420296 2:3704697-3704719 TAGGGGAGGGGGAGGGGGGAGGG + Intronic
925896208 2:8474205-8474227 GAGGGGTTAGGGAGGAGGTAAGG - Intergenic
926523439 2:13946636-13946658 TGGGGTTGGGGGAGGGTGGAGGG - Intergenic
927284454 2:21341901-21341923 TTGGGGTGGGGGAGGGGGGAGGG + Intergenic
928125934 2:28616059-28616081 TAGAGGCTGGGAAGGGTGGATGG + Intronic
928535190 2:32233119-32233141 GAGGGGTGGGGGAGGGAGGAAGG + Intronic
929070915 2:38029697-38029719 TAGGGAGCAGGGAGAGTGGAGGG + Intronic
929933325 2:46275500-46275522 GAGGGGTCAGGGAGCATGGATGG - Intergenic
930024864 2:47023873-47023895 TAGGGGCTGGGGATGGTGGAAGG - Intronic
930568204 2:53049660-53049682 TGGGGTGTAGGGAGGGGGGAAGG + Intergenic
931047227 2:58368662-58368684 TAGGGCTTGGGGAGGGGGAATGG + Intergenic
931784530 2:65607498-65607520 AAGGGGATGAGGAGGGTGGAGGG + Intergenic
932809303 2:74810848-74810870 TGGGTGTTGGGGAGGGGGGATGG + Intergenic
932999220 2:76901195-76901217 TAGGGGTTTGGGATGGGGGAGGG - Intronic
933234511 2:79850283-79850305 GAGGGGGGAGGGAGGGAGGAAGG - Intronic
933252002 2:80039174-80039196 TGGAGGGTAGGGAGGATGGAAGG + Intronic
933404952 2:81845904-81845926 TGGGGGTGGGGGAGGGGGGAGGG + Intergenic
933518408 2:83335953-83335975 CAGAGATTAGGGATGGTGGAGGG - Intergenic
934298388 2:91761237-91761259 TAGGGGTGAGGGTGGGAGGTTGG + Intergenic
934564542 2:95331007-95331029 GAGGGGTGAGGGAGAGTGAAAGG + Intronic
934766257 2:96881734-96881756 CAGGGGGCAGGGAGGGGGGAGGG + Intronic
934783251 2:96986334-96986356 CCGGGGTGAGGGAGGGTGGCGGG + Exonic
935381971 2:102462043-102462065 CAGGAGTTAGGGATGGAGGAGGG + Intergenic
936917517 2:117655049-117655071 TAGGGTGGGGGGAGGGTGGAGGG + Intergenic
937286811 2:120759005-120759027 TGGGGGTGGGGGAGGGTGCAGGG - Intronic
937328085 2:121004251-121004273 TATGGGGCAGGGTGGGTGGAGGG + Intergenic
937811462 2:126204047-126204069 CAGGGCTTAGGGATGGTGGAGGG + Intergenic
937914706 2:127093102-127093124 GAGGGGTCAGGGAGGGAGGGCGG + Intronic
938310324 2:130285146-130285168 AAGGGGTGAGGCAGGGAGGAGGG - Intergenic
938549695 2:132368846-132368868 TAGGGTTGGGGGAGGGGGGAGGG - Intergenic
938945083 2:136204997-136205019 TGGGGGTCAGGGAGGGTTGAGGG + Intergenic
939942631 2:148368324-148368346 CAGGGGTTAGGGGGTATGGAAGG + Intronic
940658984 2:156523248-156523270 CAGGGGTTAGGGGAGGGGGAAGG - Intronic
941100737 2:161292154-161292176 GTGGGGTGAGGGAGGGGGGAGGG + Intergenic
943422312 2:187681611-187681633 TATGGGTTAGGGAAGTGGGATGG + Intergenic
943645864 2:190407963-190407985 TGGGGGTGCGGGGGGGTGGAGGG + Intergenic
943950273 2:194125538-194125560 TAGGGTGAAGGGTGGGTGGAGGG - Intergenic
944087339 2:195864614-195864636 TAGGGGTTGGAGGGAGTGGAAGG - Exonic
944474778 2:200092488-200092510 GTGGGGATAGGGAGGATGGAGGG + Intergenic
944622542 2:201531539-201531561 TAGGGATGGAGGAGGGTGGATGG + Intronic
944891603 2:204123060-204123082 TGGGAGTTACGGAGGCTGGAGGG - Intergenic
945195576 2:207234540-207234562 GAGGGGGTAGGGATGGTGGGGGG - Intergenic
945317931 2:208391074-208391096 TTGGGCTTAGGGAGGGAGGCAGG + Intronic
945693965 2:213079438-213079460 AAGGAGGGAGGGAGGGTGGAAGG + Intronic
945849239 2:214985392-214985414 TGGGGCTTTCGGAGGGTGGAGGG + Intronic
946002156 2:216491439-216491461 TAGGGCTGAGGGAGGGAGGGAGG - Intergenic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946129403 2:217594122-217594144 TAGGGGATAAGAAGGGAGGAAGG + Intronic
946243119 2:218368748-218368770 GGGGGGTTGGGGAGGGAGGAGGG + Intergenic
946441535 2:219701129-219701151 AAAGGGGTAGGGAGGGAGGAAGG - Intergenic
946674917 2:222149043-222149065 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
946684223 2:222251245-222251267 TGGGGTTGGGGGAGGGTGGAGGG - Intronic
947210409 2:227703338-227703360 TAGGGGTTGGGGAGGTAGGAAGG + Intronic
947258358 2:228191437-228191459 TAAAGGTTTGGGAGGGTGGCAGG + Intergenic
947796420 2:232896645-232896667 TAGGGGTTGGGGTGGGGGTAGGG + Intronic
947796569 2:232897045-232897067 TAGGGGTAAGGGTGGGAGTAGGG + Intronic
948097987 2:235351426-235351448 TAGGGGTAAGGGAAGGGGGAGGG + Intergenic
948231707 2:236353800-236353822 TAGGGGTTAGGGAGGGTGCAGGG + Intronic
948299898 2:236897118-236897140 TAGAGGTTTGGGAAGGAGGAGGG + Intergenic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
1168812080 20:710626-710648 TGGGGGTTAGGGGAGGTGGGAGG + Intergenic
1169210950 20:3766093-3766115 GAAGAGGTAGGGAGGGTGGAAGG - Intronic
1169832088 20:9836539-9836561 TAGAGGTTTTGGAGGGTGCATGG + Intronic
1170062391 20:12272953-12272975 TATGGGTGAGTGAGGGTGGCTGG - Intergenic
1170215337 20:13885283-13885305 TAGTGGTGAGGGAGGCTGGCAGG - Intronic
1170712473 20:18804421-18804443 CAGAGGTTAGGGAGGAGGGAAGG + Intergenic
1170961504 20:21029596-21029618 TAAGGGGTAGGGTGGGTGGATGG + Intergenic
1171187568 20:23133718-23133740 CACTGGTTAGGGAGGGAGGAAGG + Intergenic
1171279101 20:23881547-23881569 TCAGGAGTAGGGAGGGTGGAAGG + Intergenic
1171358911 20:24572828-24572850 CAGGGGTTAAGGATGGAGGAAGG + Intronic
1171940447 20:31323863-31323885 TAGGGATTAGGCAGGGTGATGGG - Intergenic
1172280437 20:33703983-33704005 TAGGGGTTGGGGAGGGCAGAGGG - Exonic
1172281194 20:33709732-33709754 TAGAGGTAGGGGTGGGTGGAGGG - Intronic
1172336584 20:34121620-34121642 TAGGGGCTAGGGAGAGAGGGGGG + Intergenic
1172366308 20:34352512-34352534 TATGGTTTGGGGAGGGAGGAAGG + Intergenic
1172458118 20:35093311-35093333 TAGGGGAAAGGGAGGGTGTCTGG + Intergenic
1172540727 20:35713758-35713780 TAGAGATTAGGGTGGGAGGATGG + Intronic
1172581970 20:36055550-36055572 GACGGGCTGGGGAGGGTGGATGG - Intergenic
1173150812 20:40565313-40565335 TAGGGGAGAGGGAGGGAGAATGG + Intergenic
1173185447 20:40836755-40836777 AAGGGGTTGTGGAGGCTGGAGGG - Intergenic
1173219914 20:41124009-41124031 TTGGGGTTGGGGAGGGATGAAGG + Exonic
1173234373 20:41231025-41231047 CAGGAGTTAGGGAGGAGGGAGGG - Intronic
1173400825 20:42724472-42724494 TTGGGGTAGGGGATGGTGGAGGG - Intronic
1173939354 20:46896131-46896153 TAGCTGTTAGCGAGGGCGGAGGG + Intronic
1174406910 20:50308833-50308855 AAGGGGTTAAGGGGGGTGGCGGG - Intergenic
1175260402 20:57670475-57670497 TAGGAGGGAGGGAGGTTGGAAGG - Intronic
1175692581 20:61076183-61076205 TATGGGTGAGGAAGGCTGGATGG - Intergenic
1175771341 20:61626511-61626533 AAGGGGTTGGAGAGGATGGACGG + Intronic
1175790319 20:61736592-61736614 AAGGGGAGAGGGAGGGAGGAAGG + Intronic
1175901125 20:62360311-62360333 TAGGGGGGTGGGTGGGTGGATGG + Intronic
1175911867 20:62408813-62408835 AAGGGGCGAGTGAGGGTGGAGGG + Intergenic
1176289797 21:5037920-5037942 TGGGGGTGGGGGAAGGTGGAGGG - Intronic
1176423375 21:6533341-6533363 GAGGGGTGAGGGAGGGGTGAGGG - Intergenic
1176848030 21:13891537-13891559 TGGGGGTTGGGGAGGGTTGGGGG - Intergenic
1178091292 21:29166161-29166183 CAGAGGTTGGGGAGGGTGGTAGG - Intronic
1178516080 21:33248375-33248397 TAGGGGGGAGGGAGGGAGGGGGG + Intronic
1178555384 21:33586395-33586417 TTGGGGGTAGGGGTGGTGGAGGG + Intronic
1179218583 21:39387665-39387687 TGGGGAGTAGGGGGGGTGGAGGG - Intronic
1179388926 21:40969826-40969848 TAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1179698869 21:43141657-43141679 GAGGGGTGAGGGAGGGGTGAGGG - Intergenic
1179867433 21:44225667-44225689 TGGGGGTGGGGGAAGGTGGAGGG + Intronic
1180002625 21:45002139-45002161 GAGGGGTCAGGGAGGGGGGCTGG + Intergenic
1180002662 21:45002220-45002242 GAGGGGTTAGGGAGGGGGCTGGG + Intergenic
1180002709 21:45002337-45002359 GAGGGGTTAGGGAGGGAGCTGGG + Intergenic
1180115099 21:45697988-45698010 TAGTGTGTAGGGAAGGTGGATGG - Intronic
1181528259 22:23502239-23502261 TGGGGGATAGGGATGGGGGATGG - Intergenic
1181678271 22:24472178-24472200 TAGGGGTTAGGAGGAATGGAGGG - Intergenic
1181738627 22:24901982-24902004 TAGGGGATGGGGATGGTGGGTGG + Intronic
1182023999 22:27103038-27103060 GAGGGGGCAGGGAGGATGGAGGG + Intergenic
1182074849 22:27488464-27488486 TGGGGGCCAGGGAGGGTGGGAGG + Intergenic
1183263324 22:36810418-36810440 TAGGGGGTTGGGAGTGAGGAAGG + Intronic
1184059053 22:42070918-42070940 AAGGGCTTAGGGAGGCTGGGAGG - Intergenic
1184431164 22:44442174-44442196 TATGGGTGAGGTAGGGTGGACGG + Intergenic
1185074060 22:48673715-48673737 AGGAGGTGAGGGAGGGTGGAAGG + Intronic
1185261778 22:49869964-49869986 GAGGAGTGAGGGAGGGAGGAAGG - Intronic
1185325721 22:50225057-50225079 TGGGGGTGGGGGAGGGTGGGCGG - Intronic
1185409857 22:50676161-50676183 TTGGAGTTTGGCAGGGTGGAGGG + Intergenic
949287498 3:2424206-2424228 TAGGGTGGAGGGAGGGGGGAGGG - Intronic
949354876 3:3169935-3169957 TGTGGGTTGGGGAGGGCGGAGGG - Intronic
949564084 3:5229038-5229060 TAGGGGTAAGGGTGGGTGTGGGG + Intergenic
950062377 3:10082709-10082731 TGGGGGTTAGAGAGGCAGGATGG - Intronic
950439944 3:13004696-13004718 TAGGTGGGAGGGAGGGTGGCTGG + Intronic
951467463 3:23017707-23017729 TAGGGGTAGGGGAGGGGAGAGGG + Intergenic
951540240 3:23775582-23775604 AATGGATTAGGGAAGGTGGACGG - Intergenic
951788523 3:26452466-26452488 TAGGTGTTCAGGAGGGTGTAGGG + Intergenic
951891603 3:27572872-27572894 TAGGAGGTAGAGAGGGAGGAAGG - Intergenic
952205569 3:31178798-31178820 GAGGGGTCAGGGTGGGTTGATGG - Intergenic
952219789 3:31313533-31313555 TGGGGGTAAAGGAGAGTGGAGGG - Intergenic
952670229 3:35958157-35958179 TGGGGGTGGGGGAGGGGGGAGGG - Intergenic
952755039 3:36858507-36858529 GAGTGGTCAGGGAGGGTTGATGG - Intronic
953280383 3:41548658-41548680 TAGTGGGCAGGGAGGGTGGGTGG - Intronic
953785787 3:45910173-45910195 TGGGGGTTAGGGGTGGTGCAAGG + Intronic
954374981 3:50189289-50189311 TCAGGGTCAGGGAGGGTGGGTGG + Intergenic
954405858 3:50344788-50344810 GAGGGGTTGGGGAGGGCGGGAGG - Intronic
954582296 3:51709454-51709476 TGGGGGCTAGGGAGGGAGGCCGG + Intronic
954780539 3:53056361-53056383 TGGGGGTCAGGTAGGGTTGAGGG - Intronic
955506002 3:59633762-59633784 TGGGGGCTGGGGAGGCTGGATGG + Intergenic
955512484 3:59695370-59695392 TAGGGGAAATGGAGGGTGGAGGG - Intergenic
956080210 3:65549334-65549356 AGGGGGTTAGGAAGGGAGGAAGG - Intronic
956777548 3:72577961-72577983 GAGGGGTTTGGGAAGGTGAAGGG - Intergenic
957259096 3:77877403-77877425 TGGGGTTTGGGGAGGGGGGAGGG - Intergenic
959543854 3:107571123-107571145 AAGGGGGAATGGAGGGTGGAAGG + Intronic
959903474 3:111685164-111685186 TAGCTGTTAGTGAGGGTAGAAGG - Intronic
960452069 3:117822305-117822327 TGGGGGAAAGGGAGGGAGGAAGG + Intergenic
960734621 3:120765024-120765046 TTGGGGATGGGGAGGGTGGGGGG - Intronic
960941816 3:122939905-122939927 AAGGGGTGAGTCAGGGTGGAGGG - Intronic
960994066 3:123329628-123329650 CAGGTGTTAGGGAGGGTCTAGGG - Intronic
960995874 3:123339712-123339734 GAGGGGTTTGGGTGGGTGGGAGG - Intronic
961048764 3:123728561-123728583 TTGTTGTTTGGGAGGGTGGAGGG - Intronic
961230488 3:125303196-125303218 CAGGGGTTAGGAATGATGGAAGG + Intronic
961247957 3:125473179-125473201 GAGCGGGGAGGGAGGGTGGAAGG - Intronic
961316684 3:126041257-126041279 TAGGAGTTATGGAGGGGGGGTGG + Intronic
961749938 3:129088877-129088899 CAGGGCTTAGGGAGGGAGGGAGG - Exonic
962188963 3:133290144-133290166 TAGGGGATAGGAAATGTGGAGGG + Intronic
962610228 3:137069540-137069562 TAGGGGTTGAGGGGGGTGGTTGG + Intergenic
962936014 3:140081596-140081618 TGGGGGTAAGGGTGGGAGGAGGG - Intronic
962944432 3:140154360-140154382 TGGGGGTGAGGGAAGGTGGTAGG + Intronic
963632065 3:147745757-147745779 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
963784360 3:149518582-149518604 GAGGGCTTAGGGAGAGTGAAAGG + Exonic
965050726 3:163643508-163643530 TGGGGTTGAGGGAGGGAGGAGGG + Intergenic
965343409 3:167517875-167517897 TGGGGTTGGGGGAGGGTGGAGGG - Intronic
965445915 3:168773032-168773054 TCGGGGTTACGGAGGGAGTAGGG - Intergenic
965526466 3:169724552-169724574 CAGGGATTAGGGAGGGAGGAAGG + Intergenic
965565440 3:170111484-170111506 TGGGGGTTAGGAATGGAGGAAGG + Intronic
966126278 3:176580470-176580492 TGGAGGTGATGGAGGGTGGAAGG + Intergenic
966251777 3:177874179-177874201 TGTGGGTTAGTGAGGGAGGATGG + Intergenic
966398596 3:179525390-179525412 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
967046238 3:185739846-185739868 TGGGGGGTAGGGGGGGTGGGGGG - Intronic
967065284 3:185909914-185909936 TGGGGTTGGGGGAGGGTGGAGGG - Intergenic
967834860 3:193952694-193952716 TAGAGGCTAGGAAGGGTGGCAGG - Intergenic
968233455 3:197017327-197017349 AAGGGGTTGGGGCGGGTGGCGGG + Intronic
968264262 3:197350497-197350519 CAGGGGCTGGGGAGGGAGGAAGG - Intergenic
968614621 4:1571745-1571767 CAGGGGGAAGGGAGCGTGGAAGG + Intergenic
968970476 4:3791110-3791132 TAGGGCCTAGGAAGGGTTGATGG - Intergenic
969082120 4:4627046-4627068 GAGGGGTTAGGGACTGTGGCTGG - Intergenic
969085099 4:4650615-4650637 GAGGAGTTAGGGAGTGAGGAGGG + Intergenic
969393438 4:6906138-6906160 AAGGGGATTGGGAGGGAGGATGG + Intergenic
969433937 4:7173162-7173184 TAGGGGGTCAGGAGTGTGGACGG + Intergenic
970538297 4:17052478-17052500 CAGGGGTTAGGGAGTGTCCAGGG - Intergenic
970551509 4:17186211-17186233 TAGGGGTTTGGGAGCATGGTGGG + Intergenic
970597737 4:17615296-17615318 TGGAGGTTAGGGAGGGAGGGAGG + Intronic
970695863 4:18676220-18676242 TTGGGTTTTGGAAGGGTGGAGGG + Intergenic
971263342 4:25076642-25076664 TATGGGTTTGGGAGAGTGGCAGG - Intergenic
971542690 4:27840854-27840876 GAGGGGAGAGGGCGGGTGGAGGG - Intergenic
972445483 4:39139377-39139399 TAGGGGTTAGGGGAGAGGGAAGG + Intergenic
973750975 4:54021058-54021080 AAGGGGGAATGGAGGGTGGAAGG - Intronic
973770425 4:54201373-54201395 CAGGGGTTGGGGAGGAGGGAGGG + Intronic
975036762 4:69694242-69694264 TAGGGTGGAGGGAGGGGGGAGGG - Intergenic
975148425 4:70994385-70994407 CAGGGAATAGGAAGGGTGGAGGG - Intronic
976038188 4:80849705-80849727 CAGAGGCTAGGGAGGGTAGAGGG + Intronic
976066940 4:81198483-81198505 TGGGGGTGAGGTAGGGTGGGTGG - Intronic
976567926 4:86574046-86574068 TGGGGTGGAGGGAGGGTGGAAGG - Intronic
977191358 4:94004669-94004691 TAGGGTTGGGGGAGGGGGGAGGG + Intergenic
977488365 4:97678766-97678788 TAGGGTCGGGGGAGGGTGGAGGG - Intronic
977590965 4:98826761-98826783 TAGGGCTGAGGGAGGGAGGATGG - Intergenic
978065989 4:104403256-104403278 CAGGGGTTAGGGAGAAGGGAGGG - Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978303379 4:107294905-107294927 AAGGGGTAATGGAGGGTGGAAGG + Intergenic
979495909 4:121381595-121381617 CAGGAGTTAGAGATGGTGGAGGG - Intergenic
979704093 4:123700322-123700344 AAGGGTTTAGTGAGGGTGGCAGG + Intergenic
980971351 4:139570168-139570190 TAGAGGTTGGGAAGGGTAGAGGG + Intronic
981001018 4:139829129-139829151 AAGGAGTAAGGGAGGGAGGAAGG + Intronic
981448095 4:144864133-144864155 TAGGGTGGAGGGAGGGAGGAAGG + Intergenic
981482867 4:145256000-145256022 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
981978707 4:150765252-150765274 TAGGGGTTAGTGGGAATGGAGGG + Intronic
982317692 4:154048060-154048082 TTGGGGAAAGGGTGGGTGGAGGG + Intergenic
982410869 4:155075864-155075886 TAGGGGGAAGGGTGGGTGGGGGG - Intergenic
982424318 4:155239452-155239474 TTGGCTTTAGGGAGGGGGGAGGG + Intergenic
983534162 4:168839575-168839597 GAGGGGTGAGGGAGGGGGGATGG + Intronic
984037287 4:174685210-174685232 CAGGTATTGGGGAGGGTGGAAGG - Intronic
984482716 4:180326553-180326575 TAGGGGTTAGGGATGGAGGTGGG - Intergenic
984787372 4:183580795-183580817 TAGGGGGTTGGGAGGGAGCAGGG - Intergenic
986065926 5:4233826-4233848 ACGGGGTGATGGAGGGTGGATGG - Intergenic
986175018 5:5344564-5344586 AAAGGGGTAGGGAGAGTGGATGG - Intergenic
987044852 5:14098406-14098428 TGGGGCTGAGGGAGGGAGGAAGG + Intergenic
988686764 5:33532903-33532925 TAGTGGTCAGGGTGGGTGGCTGG + Intronic
988965577 5:36414169-36414191 CAGGGGTTAGGGAGGACAGAGGG + Intergenic
989240222 5:39194891-39194913 CAGGGATTAAGGAGGGTGGGTGG + Intronic
989486648 5:41998419-41998441 TAAGGCTTAGGGAGATTGGATGG - Intergenic
989859114 5:46342914-46342936 TGGGGGTTTGTGAGGGGGGAGGG + Intergenic
990604956 5:57399864-57399886 TAGAGGTTAGGAAGGGTAGGGGG - Intergenic
990634025 5:57703371-57703393 GAGGAGAGAGGGAGGGTGGAAGG - Intergenic
990675590 5:58181161-58181183 TTGGGGACAGGGAGGGTGGGAGG + Intergenic
990780389 5:59354688-59354710 GAAGGGTTAGGGAGGTAGGAAGG - Intronic
990976801 5:61568006-61568028 AAGGGGGGAGGGAGGGAGGAAGG - Intergenic
991257073 5:64626237-64626259 TAGGGGGTAGGGAGGTTGCAGGG + Intergenic
991703869 5:69339441-69339463 TTGGGGTTGGGGGAGGTGGAAGG + Intergenic
991718969 5:69478317-69478339 AAGGGGTAAGGGAAGCTGGAAGG - Intergenic
991741851 5:69687480-69687502 GAGGGGTTAGGGAGGTTTGATGG - Intergenic
991755842 5:69867728-69867750 GAGGGGTTAGGGAGGTTTGATGG + Intergenic
991793425 5:70267219-70267241 GAGGGGTTAGGGAGGTTTGATGG - Intergenic
991821237 5:70562783-70562805 GAGGGGTTAGGGAGGTTTGATGG - Intergenic
991835169 5:70742876-70742898 GAGGGGTTAGGGAGGTTTGATGG + Intergenic
991885802 5:71266752-71266774 GAGGGGTTAGGGAGGTTTGATGG - Intergenic
992115122 5:73532214-73532236 GAGGGGTGAGGGTGGGAGGAGGG + Intergenic
992131905 5:73701614-73701636 CAGGGGTTAGGAATGGTGGGGGG - Intronic
992386791 5:76292334-76292356 AAGGGGATAGGGAGTGTGGAGGG - Intronic
992787398 5:80183285-80183307 TGGGGTGGAGGGAGGGTGGAGGG + Intronic
993469527 5:88289575-88289597 GAGGGGTTGGGGAGGCTAGATGG + Intergenic
993521234 5:88904264-88904286 TAGGGGGTCGGGAGGGGGGAGGG - Intergenic
993816088 5:92547148-92547170 TAGGGTTGGGGGAGGGGGGAGGG + Intergenic
994647557 5:102490075-102490097 TAGAGGCTGGAGAGGGTGGAAGG + Intronic
994946958 5:106406869-106406891 TAGGGGTTGGGGAGTGGGAAGGG + Intergenic
994989399 5:106979641-106979663 TAGGAGGAATGGAGGGTGGAAGG - Intergenic
995426213 5:112026489-112026511 GTGGGGTGAGGGAGGGGGGAGGG - Intergenic
996276932 5:121678177-121678199 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
996305790 5:122046188-122046210 GTGGGGTGAGGGGGGGTGGAGGG - Intronic
996397859 5:123031534-123031556 TAGGGGTTAGAGTGGGTGGGGGG + Intronic
996526178 5:124482234-124482256 TAGGGGTTGCTGAAGGTGGATGG + Intergenic
996623724 5:125542748-125542770 GAAGGGTTAGGAATGGTGGAAGG - Intergenic
996770727 5:127082613-127082635 TGGGGGTTGGGGAGGGTGGCGGG + Intergenic
996780538 5:127181930-127181952 TAGGAGATGTGGAGGGTGGAAGG - Intergenic
996992249 5:129649549-129649571 CAGGGATTAGGGATGGTGGTGGG + Intronic
997624812 5:135324463-135324485 CAGGGGTGAGGGAGGATGGCAGG + Intronic
997781820 5:136667237-136667259 TAGGTCTTAGGGAGGGTGTGGGG - Intergenic
997817519 5:137033373-137033395 TAGGGGTTTGGTAGGGAGGCAGG - Intronic
997852738 5:137347101-137347123 TTGGTGCAAGGGAGGGTGGAGGG - Intronic
998401892 5:141852689-141852711 GAGGGGGTAGGGAGGTTGGGGGG - Intergenic
998652677 5:144139170-144139192 TAAGGGATAGGGAGAGGGGAAGG + Intergenic
999147349 5:149405279-149405301 AAGGAATGAGGGAGGGTGGAGGG + Intergenic
1000209223 5:159095713-159095735 GAGAGGTTACGGAGGGTGGGTGG + Intronic
1000521171 5:162296400-162296422 TAGGGCTTATTGAGTGTGGAGGG - Intergenic
1001103250 5:168831304-168831326 TGGGGGTGGGGGAGAGTGGAGGG + Intronic
1001331603 5:170766464-170766486 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1002255430 5:177954769-177954791 GAGGGGGGAGGGAGGGAGGAGGG + Intergenic
1002442130 5:179269992-179270014 AAGGGGTGAGGGAGCGGGGAGGG - Intronic
1002969592 6:2000450-2000472 TAGGGATTGGGGAGGGTTGAAGG - Intronic
1003153134 6:3569912-3569934 GAGGGGAGAGGGAGGGAGGATGG - Intergenic
1003261141 6:4517255-4517277 TGGGGGTGAGGGTGGGAGGAGGG - Intergenic
1003739063 6:8914011-8914033 TGGGGGCTATTGAGGGTGGAGGG + Intergenic
1003812376 6:9799073-9799095 CAGGGATTAGGATGGGTGGAGGG + Intronic
1003946021 6:11076757-11076779 AAGGGCACAGGGAGGGTGGAAGG - Intergenic
1004139286 6:13000638-13000660 AAGGGGGGAGGGAGGGAGGAAGG + Intronic
1004591741 6:17058656-17058678 TAGGGGTTGGGAAGGGTAGTGGG + Intergenic
1004607279 6:17206432-17206454 GAGGGGGGAGGGAGGGTGCAGGG + Intergenic
1005014806 6:21365943-21365965 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1005665107 6:28044452-28044474 AAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1006321881 6:33323975-33323997 TTGTGTTTAGGGAGGCTGGAGGG + Intronic
1006468789 6:34213691-34213713 CAGGGTTTAGGGATGGAGGAAGG - Intergenic
1006830637 6:36965894-36965916 TTGGGGCTGGGGAGGTTGGAGGG - Intergenic
1007279133 6:40697423-40697445 GAGGGTGTAGGGAAGGTGGAAGG + Intergenic
1007378028 6:41469559-41469581 GAGGGGTGAGGGAGGCTGGAAGG + Intergenic
1007389632 6:41543608-41543630 TGGGTGTTTGGGAGGGAGGATGG - Intergenic
1007732322 6:43954699-43954721 GTGGGGTGGGGGAGGGTGGAGGG - Intergenic
1007917911 6:45578090-45578112 AAGGGGGTTGGGAGGGTGGGAGG + Intronic
1009457393 6:63873143-63873165 TGGGGTGTAGGGAGGGGGGAGGG - Intronic
1010467089 6:76180750-76180772 TGGGGCTTTTGGAGGGTGGAGGG - Intergenic
1011718744 6:90133682-90133704 TGGGGTGTGGGGAGGGTGGAGGG - Intronic
1012052390 6:94361749-94361771 TAGGGGTCAGGGATGGGGGGGGG + Intergenic
1012166200 6:95955519-95955541 TAGGGATAGGGGAGGGTGGATGG + Intergenic
1012528161 6:100202327-100202349 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1012535857 6:100296005-100296027 TAGGGGAGAGAGAGGGTAGAAGG + Intergenic
1012691273 6:102314557-102314579 TACTGGGTGGGGAGGGTGGAAGG + Intergenic
1014211067 6:118708771-118708793 TAGGGAAAAGGGAGGGAGGAAGG - Intronic
1014324271 6:119972326-119972348 TAGGGATTAGGGGTGATGGACGG + Intergenic
1014424845 6:121290999-121291021 TGGGGTTGGGGGAGGGTGGATGG + Intronic
1014701065 6:124688637-124688659 TAGAGGTTAGAAAGGATGGAGGG - Intronic
1015403489 6:132812925-132812947 AGGGGGTTAGGGAGTGGGGATGG - Intergenic
1017006185 6:150029338-150029360 TAGGGGTATGGGAAAGTGGATGG + Intergenic
1017138459 6:151168582-151168604 GAGTGGTTAGGGAAGGTGGGAGG + Intergenic
1018123995 6:160664478-160664500 TAGGGGTGAGGGAAGGAGTAAGG - Intergenic
1018639007 6:165889902-165889924 GAGGAGTGAGGGAGGGAGGAGGG - Intronic
1018639021 6:165889946-165889968 GAGGAGTGAGGGAGGGAGGAGGG - Intronic
1018639042 6:165890020-165890042 GAGGAGTGAGGGAGGGAGGAGGG - Intronic
1018657392 6:166051526-166051548 CTGGGGTTAGGGATGGTGGGGGG - Intergenic
1018756127 6:166851138-166851160 CAGGGCTGAGGGAGGGTGCAAGG + Intronic
1019157255 6:170047633-170047655 GAGGAGTTGGGGAGGGTGTAAGG - Intergenic
1019204191 6:170345126-170345148 TAGAGGTCAGGAAGGCTGGAAGG + Intronic
1019286976 7:228527-228549 TGGGGGCTGTGGAGGGTGGAAGG + Exonic
1019407973 7:893824-893846 TTGGGGCTGGGGAGGGAGGAGGG + Intronic
1020027922 7:4912196-4912218 GAGGTGTTCAGGAGGGTGGAGGG + Intronic
1020459483 7:8412693-8412715 TGGGGGACAGGGAGAGTGGAAGG + Intergenic
1021182134 7:17518963-17518985 TGGGGGTTAGGGGGTGGGGAAGG + Intergenic
1021320169 7:19199688-19199710 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1022447258 7:30480499-30480521 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1022468382 7:30666432-30666454 CAGGGGTTGGGTAGGGTGGAGGG - Intronic
1023156369 7:37256489-37256511 TAGGAGGGAGGGAGGATGGAGGG + Intronic
1023482656 7:40650862-40650884 TGAGGGTTAGGGTGGGAGGAGGG - Intronic
1024680696 7:51683868-51683890 TAGGGTTGGGGGAGGGGGGAGGG + Intergenic
1024799153 7:53056200-53056222 TAGGAGTAAGGGAGGCTGGCAGG - Intergenic
1025088588 7:56043647-56043669 CAGGGGTTGGGGTGGGTGGGGGG - Intronic
1026094720 7:67335742-67335764 TAGGGGGTCGGGAGGGGGGAGGG + Intergenic
1026308829 7:69166258-69166280 AAGGGGATGGGGAGGGGGGAAGG + Intergenic
1027352907 7:77329882-77329904 TAGGGGTTGGGGTAGTTGGAGGG - Intronic
1027354263 7:77340924-77340946 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1027437150 7:78176040-78176062 TAGAGGGCAGGGAGGCTGGAGGG + Intronic
1027622654 7:80510134-80510156 TAGGGGCTAGGGTGGTTGGGGGG - Intronic
1027885411 7:83898677-83898699 TGGGGGGTAGGGTGGGGGGAGGG - Intergenic
1028040334 7:86044527-86044549 TGGGGCCTATGGAGGGTGGAGGG - Intergenic
1028154196 7:87410797-87410819 CAGAGGATAGGGAGGCTGGAAGG + Intronic
1028580640 7:92406266-92406288 CAGCGGTTAGGGATGGTGGGGGG + Intergenic
1028618226 7:92794653-92794675 TGTGGGAGAGGGAGGGTGGAAGG - Intronic
1028861141 7:95651932-95651954 CAGGGGTTAGGGATGAAGGATGG - Intergenic
1029345811 7:99977741-99977763 TAAGGGCTAGGGAGGGGGTATGG + Intergenic
1029441832 7:100590945-100590967 TAGGGGTGAGGGAGGATGACCGG + Intronic
1030397379 7:109003805-109003827 TAGGGCTTAGGGTTGGAGGAAGG + Intergenic
1030472282 7:109980210-109980232 TGGGGTTGAGGGAGGGGGGAGGG - Intergenic
1031451871 7:121931442-121931464 CTGGGTTTAGGGAGAGTGGAGGG - Intronic
1031999280 7:128254275-128254297 AAGTGGTGAGGGAGGGTGGAAGG + Intronic
1032373455 7:131384214-131384236 TAGGGGTGGGGGTGGGGGGAGGG - Intronic
1032616438 7:133477315-133477337 CAGGGGTTAGGGAGGGTGGAGGG - Intronic
1033225621 7:139559938-139559960 TAGGGGAAAAGGTGGGTGGAGGG + Intergenic
1033268011 7:139903091-139903113 TGGGGGTTGGGGAGAGTGGGAGG - Intronic
1033820808 7:145131966-145131988 TAGGGGTGGGGCAGGGTGGTGGG - Intergenic
1034757391 7:153635534-153635556 GAGGGGGGAGGGAGGGGGGAGGG - Intergenic
1034919510 7:155068417-155068439 AGGGGGTAAGGGAGGGGGGAAGG + Exonic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414113 7:158668320-158668342 TGTGGGTAAGGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035711628 8:1720835-1720857 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1035712344 8:1728227-1728249 TAGGAGTTAGGGCAGCTGGAGGG + Intergenic
1035902305 8:3470686-3470708 CAGGGGTTAGGGACAGTGAAGGG - Intronic
1035909842 8:3554472-3554494 TGAGGGGAAGGGAGGGTGGAAGG + Intronic
1036218863 8:6903730-6903752 TGGGGCTGAGGGATGGTGGATGG - Intergenic
1036463497 8:8974741-8974763 AAGGGGTTGGGGAGGGTGAAGGG - Intergenic
1036472491 8:9063909-9063931 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1036550574 8:9811909-9811931 TAGGAGTTAGTCAGGGTGGTGGG + Intergenic
1036600481 8:10256130-10256152 CAGGGGTTGGGGGGGGAGGATGG - Intronic
1038029721 8:23627217-23627239 TAGGGACTTGGGAGGGAGGAGGG + Intergenic
1038037558 8:23699443-23699465 AAGGGGTTTGGGAGGTGGGAAGG - Intergenic
1038100568 8:24369649-24369671 CAGGAGTTAGGGAGGAGGGAGGG - Intergenic
1038336164 8:26647370-26647392 CCAGGGTTAGGGAGGGTGGAGGG - Intronic
1038476983 8:27875440-27875462 TAGGGGTGAGGGAGCATGGAAGG + Intronic
1038711090 8:29946444-29946466 TGGGGGTTAGGGAGAGGAGAAGG - Intergenic
1038855914 8:31333249-31333271 TAGCGGTTGGGGAAGATGGAAGG - Intergenic
1038970142 8:32624322-32624344 TTGGGGTTAGTGAGGGCAGATGG + Intronic
1039304470 8:36246745-36246767 TAGATGTTAGGGAGGGAGGAGGG - Intergenic
1040060014 8:43095857-43095879 TAGGGGTAAGGAGGGTTGGAGGG + Intronic
1040450653 8:47542847-47542869 TAGGGGTTCTGGAGGGTGACAGG - Intronic
1041255705 8:55978295-55978317 CAGGGATGAGGGAGGGAGGATGG + Intronic
1041358566 8:57025373-57025395 TAGGGTGTAGGGAGAGGGGAGGG + Intergenic
1041557896 8:59179515-59179537 TAAGGGTTAGGAAGAGAGGAAGG - Intergenic
1041650373 8:60296327-60296349 AAGGGGTTAGGGCAGGTGCAGGG + Intergenic
1041709359 8:60879197-60879219 AAGAGGTTGGGGAGGGTAGAGGG - Intergenic
1041763156 8:61388925-61388947 TAGAGGCTAGGGAGGGTTGGGGG - Intronic
1042142752 8:65695941-65695963 TTGGGGTTGGGGAGGGTGATGGG - Intronic
1042333406 8:67606181-67606203 TTGGGGTGGGGGAGGGGGGAGGG + Intronic
1042523020 8:69734248-69734270 TAGTGGCAAAGGAGGGTGGAGGG - Intronic
1042713719 8:71748061-71748083 TGGTGATTGGGGAGGGTGGAGGG - Intergenic
1043260691 8:78192102-78192124 TGGGGTTGGGGGAGGGTGGACGG - Intergenic
1043376387 8:79654344-79654366 TGGGGGATAGGGAGGGGGGAAGG + Intronic
1043675434 8:82946570-82946592 TAGGGATTAGAGAGGAGGGAGGG + Intergenic
1043774028 8:84241996-84242018 TGGGGGTGTGGGAGGGAGGAAGG - Intronic
1043807965 8:84697742-84697764 TAGGGCCTTTGGAGGGTGGAGGG - Intronic
1044217059 8:89624660-89624682 CAGGGGTTTGGGAGGAGGGAAGG - Intergenic
1044314836 8:90738014-90738036 TAGGGCTGACAGAGGGTGGAAGG + Intronic
1044483370 8:92719651-92719673 TAGAGGGTAGGGTGGGTAGAGGG - Intergenic
1045084094 8:98661876-98661898 TGGGAGTTAGGGTGGGTGGTAGG - Intronic
1045370467 8:101517363-101517385 GAGGGGTTAGGCTGAGTGGAAGG - Intronic
1045514456 8:102845139-102845161 GGGGCATTAGGGAGGGTGGAGGG - Intronic
1046092573 8:109520527-109520549 TAGAAGTTAGGGATGGTGGGAGG + Intronic
1046242252 8:111511467-111511489 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
1046748002 8:117896718-117896740 TAGGGATTTGGGGAGGTGGATGG + Intronic
1047416204 8:124666697-124666719 CATGGGATAGGGAGGGTGGAGGG + Intronic
1047483058 8:125302700-125302722 GAGGGGTTGGGGAGCGTGCAGGG + Intronic
1047750369 8:127876022-127876044 TGAGGGTGAGGGGGGGTGGAGGG - Intergenic
1047950818 8:129933229-129933251 GAGGGATCAGGGAGTGTGGAGGG - Intronic
1048414372 8:134209957-134209979 TCGGGGTTAGGGAGGTGAGAGGG - Intergenic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1048835486 8:138514913-138514935 TGGGGGTTAGGGAGAATGAAGGG + Intergenic
1048887872 8:138923112-138923134 GAGGGGAGAGGGAGGTTGGATGG + Intergenic
1049317204 8:141975582-141975604 GAGGGGTTTGGGTGGGTGGGGGG + Intergenic
1050200031 9:3134946-3134968 TAGGGGTTAGGGGAAGGGGAAGG + Intergenic
1050809874 9:9731600-9731622 TGGGGTGTAGGGAGGGGGGAAGG - Intronic
1051442731 9:17103408-17103430 TAAGGGTGAGGGTGGGAGGAGGG - Intergenic
1052005541 9:23343559-23343581 AAGGGGTTAGGGATGTTGCAAGG + Intergenic
1052484836 9:29083432-29083454 GTGGGGTGAGGGAGGGGGGATGG + Intergenic
1052563540 9:30116850-30116872 TAGGGGGTGGGGAGGTAGGAGGG + Intergenic
1052632975 9:31064525-31064547 CTGGTGTTAGGGAGGATGGATGG + Intergenic
1052821184 9:33138922-33138944 TTGGGGTTGGGGAGAGAGGAGGG - Intronic
1053398985 9:37801007-37801029 GAGGGCTTCGGGCGGGTGGAGGG - Exonic
1053504913 9:38634022-38634044 CAGGGATTAGGGACAGTGGAGGG - Intergenic
1053684587 9:40509919-40509941 TAGGGGTTAGGCAGCCTGGCCGG + Intergenic
1053934554 9:43138197-43138219 TAGGGGTTAGGCAGCCTGGCCGG + Intergenic
1054279138 9:63115042-63115064 TAGGGGTTAGGCAGCCTGGCCGG - Intergenic
1054297683 9:63345381-63345403 TAGGGGTTAGGCAGCCTGGCCGG + Intergenic
1054395698 9:64649892-64649914 TAGGGGTTAGGCAGCCTGGCCGG + Intergenic
1054430342 9:65155087-65155109 TAGGGGTTAGGCAGCCTGGCCGG + Intergenic
1054500038 9:65866434-65866456 TAGGGGTTAGGCAGCCTGGCCGG - Intergenic
1054521445 9:66077619-66077641 TAGGGTTGTGGGAGGGTGGTGGG - Intergenic
1055206600 9:73738247-73738269 CAGGGGTTAGGGAGGAGAGAGGG - Intergenic
1055819316 9:80242802-80242824 AAGGAGGTAGGGAGGGAGGAAGG - Intergenic
1056303621 9:85268192-85268214 AAGGGGTCAGGGTGGGAGGAGGG - Intergenic
1056391725 9:86147034-86147056 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1056735022 9:89201994-89202016 TTGGGGTTGGAGAGGGTGGATGG - Intergenic
1057012955 9:91622634-91622656 TAGGGGTTTGGGGTGGCGGATGG - Intronic
1057195865 9:93115459-93115481 GAGGGGTGAGGGAGGGGTGAGGG + Intergenic
1057195870 9:93115470-93115492 GAGGGGTGAGGGAGGGGTGAGGG + Intergenic
1057195978 9:93115780-93115802 AGGGGGTGAGGGAGGGTTGAGGG + Intergenic
1057677552 9:97147600-97147622 TAAAGGTGGGGGAGGGTGGAAGG - Intergenic
1057759368 9:97860239-97860261 TAGGGGCTAAGGAGTGGGGATGG + Intergenic
1058732899 9:107867641-107867663 TAGGGGCTGGGTGGGGTGGAGGG - Intergenic
1058840516 9:108903218-108903240 GTGGGGTGGGGGAGGGTGGAGGG - Intronic
1059669336 9:116478109-116478131 GAGGGGGTAGGGAGGGAGAAAGG + Intronic
1059693328 9:116707502-116707524 GAGGGGTTGGGGAGGAGGGAAGG - Intronic
1059714919 9:116904937-116904959 TTGGGGGTGCGGAGGGTGGAAGG - Intronic
1059945821 9:119407247-119407269 GAGGGTGTAGGGTGGGTGGAAGG - Intergenic
1060203845 9:121670077-121670099 CAGGGGTTAGGGATGGTGGTGGG - Intronic
1060329695 9:122655686-122655708 TGGGGGTTGGGGTGGGGGGAGGG + Intergenic
1060490875 9:124083281-124083303 TAGGGGTGGGTGAGGGTGGGAGG + Intergenic
1060641390 9:125241766-125241788 TCGGGGTGAGGGATGGAGGAAGG - Intergenic
1060943041 9:127554306-127554328 TTGGGGTAAGGGTGAGTGGAGGG - Intronic
1061580825 9:131534800-131534822 TAGTGGTTAGGGTGGCTTGAAGG - Intergenic
1061768178 9:132896018-132896040 AGGGGGTTAGGGCGGGTGGAGGG + Exonic
1061900073 9:133668422-133668444 TAAGGGAGAGGGAGGGTGAAGGG - Intronic
1062088671 9:134662482-134662504 TAGGGGTCAGGAAGGGTGCTGGG - Intronic
1062089718 9:134669129-134669151 TAGGTGGAAGGGAGGGTGGATGG - Intronic
1062250777 9:135592521-135592543 TGGGGGTGAGTGAGGGTGGGGGG + Intergenic
1062369760 9:136231887-136231909 GAGGGGGTGGAGAGGGTGGAGGG - Intronic
1185883123 X:3758579-3758601 TAGGTGAGAGGGTGGGTGGATGG - Intergenic
1186465275 X:9779910-9779932 GAGGGCTTGGAGAGGGTGGAGGG - Intronic
1186560608 X:10608569-10608591 TGGGGGTTAGGGATGGGGTAAGG + Intronic
1187279529 X:17847316-17847338 TGGGGGATGGGGACGGTGGAGGG - Intronic
1187483404 X:19679124-19679146 AAGTTGTTAGGGAGGCTGGAAGG - Intronic
1187625384 X:21106519-21106541 TAGGGGTTAGGAAAGGGGCAGGG - Intergenic
1187635036 X:21218760-21218782 TGGGGTGTAGGGAGGGGGGAGGG - Intergenic
1187636544 X:21235474-21235496 GAGGGGGTAGGGTGGGAGGATGG + Intergenic
1187694548 X:21905424-21905446 AAGGGGTTAGGGAGGGGGGAGGG + Intergenic
1187783268 X:22854045-22854067 TAGGAGTTAGGGAAGAGGGAGGG + Intergenic
1187889956 X:23924664-23924686 TGGGGATGAGGGAGGGGGGAGGG + Intronic
1187977874 X:24721981-24722003 AGGGGGTAACGGAGGGTGGATGG - Intronic
1188096957 X:26034920-26034942 TGGGGTTGAGGGAGGGGGGAAGG + Intergenic
1188270599 X:28135408-28135430 CAGGGTTTAGGGATGGTGGGAGG - Intergenic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1188430873 X:30104600-30104622 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1188465868 X:30480311-30480333 TAGGGTTGAGGGAAGGTGAAGGG + Intergenic
1189030353 X:37443043-37443065 GAGGGGTTGGGGAGAGTTGAAGG + Intronic
1189315628 X:40054169-40054191 TATGGGTGAGGGAAAGTGGATGG - Intronic
1189623703 X:42872280-42872302 TTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1189661435 X:43304204-43304226 TAGGGTTGGGGGAGGGGGGAGGG - Intergenic
1189770443 X:44420342-44420364 CAGGAGTTAGGCATGGTGGATGG + Intergenic
1190176238 X:48152579-48152601 CAGGGGTTGGGGATGGTGGATGG + Intergenic
1190186904 X:48243294-48243316 CAGGGGTTAGGGATGGTGGATGG + Intronic
1190191770 X:48282525-48282547 CAGGGGTTAGGGGTGGTAGATGG - Intergenic
1190195050 X:48310082-48310104 CAGGGGTTAGGGATGGTGGATGG - Intergenic
1190201013 X:48360843-48360865 CAGGGATTAGGGATGGCGGATGG - Intergenic
1190202850 X:48378914-48378936 CAGGGGTTAGGGATGGTGGACGG + Intergenic
1190207688 X:48416499-48416521 CAGGGGTTAGGGATGGTGGACGG - Intergenic
1190210807 X:48445857-48445879 CAGGGATTAGGGATGGTGGATGG + Intergenic
1190328878 X:49223657-49223679 TTGGGGTTAGGGTTGGTGGTAGG + Intronic
1190656177 X:52614138-52614160 CAGGGGTTAGGAATGGTGGGTGG - Intergenic
1190661482 X:52658305-52658327 CAGGGGTTAGGGATGGTGGATGG - Intronic
1190667839 X:52711293-52711315 CAGGGATTAGGGATGGCGGATGG - Intergenic
1190669126 X:52723572-52723594 CAGGGGTTAGGGATGGCGGATGG - Intergenic
1190670291 X:52734832-52734854 CAGGGGTTAGGGATGGCGGATGG + Intergenic
1190671578 X:52747111-52747133 CAGGGATTAGGGATGGCGGATGG + Intergenic
1190717566 X:53116586-53116608 GGAGGGTTAGGGAGGGAGGATGG + Intergenic
1191083669 X:56540421-56540443 TGGGGGTGAGGGAAGGTGGGAGG + Intergenic
1191145957 X:57165540-57165562 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1191641240 X:63431264-63431286 TAGGGGTTAGGGTGAGTCCAAGG + Intergenic
1191763812 X:64673691-64673713 GAGGGTTGAGGGTGGGTGGAGGG + Intergenic
1191805962 X:65134117-65134139 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1192061981 X:67837397-67837419 TGGGGTTGAGGGAGGGGGGAGGG + Intergenic
1192105821 X:68315282-68315304 AAGGAGGTAGGGAGGGAGGAAGG + Intronic
1192424161 X:71060774-71060796 TTGGGGTTGGGGTGGGTGGGTGG - Exonic
1192921913 X:75715789-75715811 TTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1193009481 X:76660416-76660438 TGGGGTTGGGGGAGGGTGGAGGG - Intergenic
1193010302 X:76668105-76668127 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1193057736 X:77172443-77172465 TAGGGGTTAGGAAGAGTAGGGGG + Intergenic
1193651165 X:84134438-84134460 CAGGAGTTAGGGAAGGTGGAGGG + Intronic
1193760477 X:85459936-85459958 TGGGGGTTAGGGGGTGGGGATGG + Intergenic
1193932175 X:87566902-87566924 GAGGCGTTTTGGAGGGTGGAGGG + Intronic
1194683002 X:96876760-96876782 TGGGGTTTGGGGAGGGGGGAGGG + Intronic
1194899345 X:99489492-99489514 TAGAGGTTGGGAAGGGTGGCAGG - Intergenic
1194992452 X:100559395-100559417 CAGGGGTTAGGGAGGAGGGAAGG + Intergenic
1195001844 X:100649881-100649903 TAGGGCTCAGGGAGGCTGGAAGG + Intronic
1195506989 X:105669019-105669041 GTGGGGTTAAAGAGGGTGGAAGG + Intronic
1195549461 X:106150616-106150638 AAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1195758084 X:108219080-108219102 AAGGGATTAGGCTGGGTGGATGG + Intronic
1196410279 X:115411285-115411307 TTGTGGTTAGGGAGGGAGGGAGG + Intergenic
1196630075 X:117927813-117927835 CAGGGTTTAGGGATGGTGGTGGG + Intronic
1196698236 X:118637218-118637240 ACAGGGGTAGGGAGGGTGGAGGG + Intronic
1196928513 X:120658003-120658025 TAGGGGTTAGGGAAGTTGAGAGG + Intergenic
1197264423 X:124352835-124352857 CAGAGGTTGGGAAGGGTGGAAGG + Intronic
1197470811 X:126864352-126864374 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1197873484 X:131081990-131082012 TAGGGGTCTGGCAGGGTGGGAGG + Intronic
1197907058 X:131436834-131436856 TGGGGTTGGGGGAGGGTGGAAGG - Intergenic
1197908340 X:131451194-131451216 TGGGGTGGAGGGAGGGTGGAGGG + Intergenic
1198131704 X:133702589-133702611 TTGGGGTTGGTGAGGGGGGAGGG - Intronic
1198250962 X:134878846-134878868 CAGAGGTTAGGGATGGTGGGGGG - Intergenic
1198540970 X:137639433-137639455 TTGGGGCGAGGGTGGGTGGAAGG + Intergenic
1199303547 X:146240744-146240766 AAGGGGATAGGGAGGGAGGAGGG - Intergenic
1199317058 X:146393471-146393493 TGGGGGGGAGGGAGGGAGGAAGG - Intergenic
1200078507 X:153564114-153564136 TGGGGGCTAGAGAGGGTGGGAGG - Intronic
1201013766 Y:9576616-9576638 TGGGGCGGAGGGAGGGTGGAGGG + Intergenic
1201708030 Y:16958177-16958199 TAAGGGCTAGGGAGGGGGTATGG + Intergenic