ID: 1104501212

View in Genome Browser
Species Human (GRCh38)
Location 12:129287326-129287348
Sequence ATGTAAATTAATAAACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 864
Summary {0: 1, 1: 0, 2: 0, 3: 55, 4: 808}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104501210_1104501212 14 Left 1104501210 12:129287289-129287311 CCATGAGTTCAGAGCTGATGTAA 0: 1
1: 0
2: 4
3: 16
4: 254
Right 1104501212 12:129287326-129287348 ATGTAAATTAATAAACAGGAAGG 0: 1
1: 0
2: 0
3: 55
4: 808

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104501212 Original CRISPR ATGTAAATTAATAAACAGGA AGG Intronic
900955889 1:5886276-5886298 ATGTACATTCGTAAACAGGCAGG + Intronic
901321328 1:8341909-8341931 ATGTAAATAAATAAATAGGCCGG + Intronic
901335735 1:8447515-8447537 AGGAAAACTAATAAACAGAAAGG - Intronic
901695863 1:11007585-11007607 ATGTAAATTAATAACATGGCTGG - Intergenic
904191941 1:28752143-28752165 ATGTAATTTAATGTACAGAAAGG - Intronic
905015032 1:34771957-34771979 ATGAAAATTAAAAAAGAAGAAGG - Intronic
905409828 1:37761125-37761147 ATGAAAATAAATAAACGAGAAGG + Intronic
905934816 1:41815022-41815044 AAGTAAATAAATAAATAAGATGG + Intronic
906265256 1:44424178-44424200 ATGTAAAATAACAGACAGTAAGG + Intronic
906385512 1:45365489-45365511 ATGAAAATAAATAAACAAGGAGG - Intronic
906739847 1:48172438-48172460 AGGAAAACTAATAAACAGAAAGG - Intergenic
907231770 1:53005572-53005594 AGGAAAATTAACAAACAGAAAGG + Intronic
909314029 1:74192590-74192612 ATGTAAATTAATATAGTGTATGG - Intronic
909682755 1:78310964-78310986 ATGAAAACTAACAAACAGAAAGG + Intronic
910161810 1:84280131-84280153 ATGTAAATTAAAGCAAAGGAAGG - Intergenic
910446754 1:87306207-87306229 AAGCAAATAAATAAACAGAAAGG - Intergenic
910679356 1:89846114-89846136 AAATAAATTAATAAACTGGGGGG - Intronic
911091586 1:94021724-94021746 ATGTAAACAAACAAACAAGACGG + Intronic
911133281 1:94413360-94413382 ATTTAAATAAATAAACACTACGG + Intergenic
911270768 1:95798147-95798169 AGGAAAATTAACAAACAGAAAGG + Intergenic
911395128 1:97296377-97296399 ATCTAAATAAATAAACTGGAAGG - Intronic
911572310 1:99532930-99532952 ATGTAAATCAGTAGAGAGGATGG + Intergenic
911634536 1:100219396-100219418 ATTTATATTTATAAACAGCACGG + Intronic
911815120 1:102339769-102339791 ATATAAATGGAGAAACAGGAGGG - Intergenic
911830700 1:102547193-102547215 ATGTAAATTAGTATACAGTAAGG + Intergenic
911867792 1:103050790-103050812 AGGAAAACTAACAAACAGGAAGG - Intronic
913337464 1:117721619-117721641 AGGAAAACTAATAAACAGAAAGG + Intergenic
913419651 1:118651249-118651271 AAGTTAATAAATAAACAAGAGGG - Intergenic
913473498 1:119214625-119214647 ATGAAAACTAACAAACAGAAAGG - Intergenic
914232610 1:145777830-145777852 ATTCAAAATAAAAAACAGGATGG + Intronic
915207354 1:154280023-154280045 AAGTAAATAAATAAATAGGCCGG + Intergenic
915809059 1:158886914-158886936 AGGAAAACTAATAAACAGAAAGG + Intergenic
916262868 1:162860114-162860136 ATGTGAATTAATGAACTGGCAGG - Intronic
916851372 1:168707665-168707687 AAGTAATTTAATCAAGAGGACGG + Intronic
916899785 1:169208742-169208764 ATGTTAATTAATTAGTAGGAAGG + Intronic
916913225 1:169374944-169374966 ATGCAAATAAATAAATAGTAAGG + Intronic
917015061 1:170520933-170520955 ATGGAAACTATTAAACAGGAGGG + Intergenic
917126917 1:171695588-171695610 AGGAAAACTAATAAACAGAAAGG - Intergenic
917699380 1:177564541-177564563 AGGAAAACTAATAAACAGAAAGG + Intergenic
918294692 1:183145335-183145357 ATGTAATGTAATTGACAGGATGG + Exonic
918300269 1:183197710-183197732 AAGTAAATAAATAAAGTGGATGG + Intronic
918325700 1:183408600-183408622 ATGGAAACTAATAAACTGAATGG - Intronic
918596220 1:186296472-186296494 ATGTAATTTAATAAGCATCATGG - Intronic
918950909 1:191135793-191135815 AAATAAATTAATAAAAAAGAAGG + Intergenic
919265434 1:195257740-195257762 ATGTAAGTTGAAAAAAAGGATGG + Intergenic
919270988 1:195344776-195344798 ATATAAATTCAGAATCAGGATGG + Intergenic
919623216 1:199886137-199886159 AGGAAAACTAACAAACAGGAAGG - Intergenic
920151038 1:203907989-203908011 AAGTAAATAAATAAAAATGAAGG + Intergenic
920407835 1:205731989-205732011 ATTTAAATTCAAAGACAGGATGG + Intronic
920723559 1:208412589-208412611 AAATAAATAAATAAAAAGGAGGG + Intergenic
920728934 1:208464387-208464409 AAATAAATAAATAAACAGTAAGG - Intergenic
921243803 1:213214829-213214851 ATGAAAACTAACAAACAGAAAGG + Intronic
921258067 1:213360747-213360769 ATGAAAACTAACAAACAGAAAGG - Intergenic
922172641 1:223168429-223168451 AGGAAAATTAACAAACAGAAAGG + Intergenic
922456396 1:225777128-225777150 AAGTAAATAAATAAAGAAGATGG - Intergenic
922958021 1:229621523-229621545 CTGTAAATTAAAAAATAGGAAGG + Intronic
922989283 1:229892458-229892480 ATTTAAGTTTATAAACAGTATGG - Intergenic
923235367 1:232027915-232027937 ATGTAAAGTTATAACAAGGAAGG - Intronic
923599143 1:235386988-235387010 AGGAAAACTAACAAACAGGAAGG - Intronic
923845990 1:237733289-237733311 ATGACAATTAAAAAACAAGATGG - Intronic
923880843 1:238102485-238102507 ATATATATTAATAAACTGGTAGG + Intergenic
923970005 1:239189799-239189821 AAGTAAATAAATAAAAAGGCTGG + Intergenic
923992238 1:239451678-239451700 ATTTAACTTAATAACCAGTAGGG + Intronic
924910381 1:248505700-248505722 TTGTAAAATAATAAAGATGATGG - Intergenic
924913719 1:248542339-248542361 TTGTAAAATAATAAAGATGATGG + Intergenic
1062793638 10:325883-325905 ATGAAAATTAAAAAAAAGGCCGG + Intronic
1063904806 10:10770534-10770556 AGGGAAATTATTAAATAGGAAGG + Intergenic
1064141047 10:12790638-12790660 ATGTAAATTAAAAAAAATGAAGG - Intronic
1064907876 10:20367439-20367461 ATGTAAATGAATAAAAAAGCTGG - Intergenic
1065049758 10:21779547-21779569 AGGAAAATTAACAAACAGAAAGG + Intronic
1065748498 10:28863824-28863846 ATATAAATTAAAAAACAAAAAGG - Intronic
1066042819 10:31568021-31568043 AGGAAAACTAATAAACAGAAAGG - Intergenic
1066060382 10:31718865-31718887 AGGAAAACTAATAAACAGAAAGG - Intergenic
1066139288 10:32487674-32487696 AGGAAAATTAACAAACAGAAAGG - Intronic
1066162935 10:32754628-32754650 TTATAAAATAATAAACATGAGGG + Intronic
1066488296 10:35870572-35870594 ATGTAAATGAAAAAAAATGAAGG - Intergenic
1066682857 10:37951875-37951897 ATGCAAATTGTAAAACAGGAAGG - Exonic
1067197909 10:44138157-44138179 AGGAAAACTAATAAACAGAAAGG + Intergenic
1067366322 10:45632367-45632389 AAGTGAATAAATAAAAAGGATGG + Intronic
1067377011 10:45736605-45736627 AAATAAATAAATAAGCAGGAAGG + Intronic
1067855834 10:49792085-49792107 ATCTAAATGGATAAAGAGGAAGG - Intergenic
1067884715 10:50077299-50077321 AAATAAATAAATAAGCAGGAAGG + Intronic
1068068921 10:52170690-52170712 AAATAAATTTGTAAACAGGAGGG - Intronic
1068253592 10:54477071-54477093 ATGTAAATAAATTATCAGGGAGG - Intronic
1068272611 10:54748389-54748411 ATGTGAATTAAAAAAGAGCACGG - Intronic
1068608327 10:59030952-59030974 ATGGAAATTGATAGAGAGGAAGG + Intergenic
1070435921 10:76393255-76393277 ATGTAAGTTAAAAAACAGTATGG - Intronic
1071085524 10:81864402-81864424 ATGCATTTTAACAAACAGGAAGG - Intergenic
1071519749 10:86322236-86322258 AAGTAAATTAAAAGACATGAAGG + Intronic
1071844425 10:89506495-89506517 AGGAAAATTAACAAACAGAAAGG + Intronic
1071884638 10:89936730-89936752 AGGAAAACTAATAAACAGAAAGG - Intergenic
1072394244 10:95022693-95022715 AGGAAAATTAACAAACAGAAAGG - Intergenic
1072869298 10:99099944-99099966 ATGAAAACTAACAAACAGAAAGG + Intronic
1073464894 10:103688865-103688887 CTCTAAATAAATAAATAGGAAGG - Intronic
1073630722 10:105146024-105146046 CTGTAACTTAATAATCAGGCAGG - Intronic
1073690896 10:105808480-105808502 ATGTGAATGAAGAAACAGGTAGG - Intergenic
1074180331 10:111056837-111056859 ATGTAGATTGGTAAACAGTATGG + Intergenic
1074947005 10:118289774-118289796 ACCTAAATAAATAAACAGGTAGG - Intergenic
1076155193 10:128199145-128199167 ATTTAAAATAATAAAGAGAAAGG - Intergenic
1077655586 11:4016265-4016287 AGGAAAATTAACAAACAGAAAGG - Intronic
1077764343 11:5141827-5141849 ATGTAATTTGATAACCAAGAAGG + Intergenic
1078437219 11:11335321-11335343 AAGTCAATTAATACACAGGAAGG - Intronic
1079134680 11:17769712-17769734 ATAAAAATTTAAAAACAGGAAGG + Intronic
1079510463 11:21204832-21204854 AGGAAAATTAACAAACAGAAAGG - Intronic
1079790181 11:24727645-24727667 AAGTTAAATAATAAACAGCAAGG - Intronic
1079810040 11:24986677-24986699 AGGCAAATTAATAAACAAAAAGG + Intronic
1079873841 11:25832224-25832246 AGGAAAATTAACAAACAGAAAGG + Intergenic
1079905781 11:26245458-26245480 AAGTAATCTAAGAAACAGGAAGG - Intergenic
1080490045 11:32752493-32752515 ATGTAAATTAATATAGATAATGG - Intronic
1080831728 11:35900226-35900248 ATTAAAATTGATAAACATGATGG + Intergenic
1080917481 11:36674331-36674353 AGGAAAACTAATAAACAGAAAGG + Intergenic
1081056793 11:38419394-38419416 ATGTAAACTAGTAAATAGGATGG - Intergenic
1082103097 11:48190933-48190955 AGGAAAACTAACAAACAGGAAGG - Intergenic
1082112607 11:48293376-48293398 AGGAAAACTAACAAACAGGAAGG + Intergenic
1082613754 11:55334477-55334499 AGGAAAACTAACAAACAGGAAGG - Intergenic
1082713109 11:56578642-56578664 GTGTACATGAATAAACAGGCAGG - Intergenic
1082951143 11:58816900-58816922 ATGAAAACTAACAAACAGAAAGG + Intergenic
1083008671 11:59372953-59372975 AGGAAAATTAACAAACAGAAAGG + Intergenic
1083503369 11:63132502-63132524 ATGAAAACTAACAAACAGAAAGG - Intronic
1083521160 11:63313937-63313959 AGGAAAATTAACAAACAGAAAGG + Intronic
1085425870 11:76404111-76404133 AAGTAAATAAATAAACAAAATGG - Exonic
1085994986 11:81901136-81901158 AGGAAAATTAACAAACAGAAAGG + Intergenic
1086788420 11:91002566-91002588 AAGTAAATAAATCAACTGGATGG + Intergenic
1088063784 11:105690274-105690296 ATGGAAATTATTAAACATAAGGG - Intronic
1088150972 11:106744580-106744602 ATGAAAAGTAATAAGCAGGAAGG + Intronic
1088514927 11:110621640-110621662 ATTTAAATTAATAAAAAGATAGG - Intronic
1088731048 11:112683737-112683759 AGGAAAACTAACAAACAGGAAGG - Intergenic
1089221883 11:116878975-116878997 AAGTAAATACATAAACAAGATGG - Intronic
1089879743 11:121762454-121762476 ATGTAAATTAATTAAAAAGAAGG + Intergenic
1089989501 11:122845711-122845733 AAATAAATAAATAAAAAGGAGGG + Intronic
1090054912 11:123414627-123414649 AAGTAAATAAAAAAACAGGTTGG - Intergenic
1090069583 11:123532031-123532053 TTAAGAATTAATAAACAGGACGG - Intronic
1090935891 11:131342006-131342028 GTGTAAAGCAATAAACTGGATGG + Intergenic
1091326489 11:134693009-134693031 AGGAAAATTAATAAACAGAAAGG + Intergenic
1091479502 12:812678-812700 AGAAAAATTAATGAACAGGAAGG + Intronic
1092023174 12:5219255-5219277 ATGAAAATGAAAAAAGAGGATGG + Intergenic
1093053376 12:14530786-14530808 ATGCAAATTAATAATCAAGGAGG - Intronic
1093992804 12:25609541-25609563 AGGAAAACTAACAAACAGGAAGG - Intronic
1093998208 12:25665647-25665669 AGGAAAACTAACAAACAGGAAGG - Intergenic
1094139935 12:27171092-27171114 AGGAAAATTAAAAAACAGAAAGG - Intergenic
1094453409 12:30605072-30605094 AGGAAAACTAATAAACAGAAAGG + Intergenic
1095209319 12:39474840-39474862 AGGAAAATTAAAAAACAGAAAGG - Intergenic
1095235284 12:39787694-39787716 ATGCAAATGAATAAATAGCAAGG + Intronic
1095441595 12:42243489-42243511 ATTCCAATTAATAAACAAGATGG - Intronic
1097304356 12:58052751-58052773 AGGAAAACTAATAAACAGAAAGG + Intergenic
1097581249 12:61459480-61459502 AAGTATAATAATAAAAAGGAAGG + Intergenic
1098183078 12:67869089-67869111 AGGAAAACTAATAAACAGAAAGG - Intergenic
1098428168 12:70389831-70389853 AAATAAATTAAGAAAGAGGAAGG - Intronic
1098604689 12:72375717-72375739 ATGTAACTTAATAAATGAGAAGG + Intronic
1098842332 12:75491412-75491434 ATCTAAATTCTTCAACAGGATGG - Exonic
1099270866 12:80508467-80508489 ATGAAAATGAATAAAGAGGGAGG + Intronic
1099338071 12:81390603-81390625 ATGTAAATCAATTAATATGAAGG - Intronic
1099655783 12:85488521-85488543 AGGAAAAATAATAAACAGGAGGG - Intergenic
1099674475 12:85741445-85741467 ATGGAAATCAAAACACAGGAAGG + Intergenic
1099906642 12:88779155-88779177 AAATAAATAAATAAAAAGGAAGG + Intergenic
1100900883 12:99238836-99238858 AGGAAAACTAATAAACAGAAAGG + Intronic
1100904193 12:99278740-99278762 ATGTAAATTAATAAAATAAATGG + Intronic
1101195553 12:102378303-102378325 AAATAAATTAATACACAGGAAGG + Intergenic
1101622148 12:106398785-106398807 AGGAAAACTAACAAACAGGAAGG + Intronic
1101667549 12:106833159-106833181 ATGTAAATAAATATACTTGAGGG - Intronic
1101738800 12:107483678-107483700 AAATAAATAAATAAACAGCATGG - Intronic
1102378922 12:112446701-112446723 TTTTAAATAAATCAACAGGAAGG - Intronic
1102778774 12:115544802-115544824 ATGTAAAATCATATAAAGGAGGG + Intergenic
1104004570 12:124882975-124882997 ATGCAATTAAATCAACAGGAGGG + Intergenic
1104392761 12:128404938-128404960 AAGAAAATGGATAAACAGGAAGG + Intronic
1104501212 12:129287326-129287348 ATGTAAATTAATAAACAGGAAGG + Intronic
1104617944 12:130285893-130285915 ATGTAAAAAAATAAAGAGGCTGG - Intergenic
1105983845 13:25546426-25546448 ATGTTATTTCACAAACAGGATGG - Intronic
1106429148 13:29663161-29663183 ATGAACATTAATACACAGAATGG - Intergenic
1106608180 13:31251135-31251157 AGGAAAACTAATAAACAGAAAGG + Intronic
1106991595 13:35427322-35427344 AGGAAAACTAACAAACAGGAAGG - Intronic
1107164383 13:37268172-37268194 ATATAAATAAATAAGCAGGCTGG + Intergenic
1107477661 13:40755043-40755065 ATAAAAAATAATAAACTGGAGGG + Intronic
1107558481 13:41539934-41539956 AGGAAAACTAACAAACAGGAAGG - Intergenic
1108048700 13:46408285-46408307 ATGAAAACTAACAAACAGAAAGG - Intronic
1108308484 13:49162830-49162852 AGGAAAACTAACAAACAGGAAGG - Intronic
1108905904 13:55472525-55472547 ATGGAAATTCAGACACAGGAAGG + Intergenic
1108988852 13:56629615-56629637 AAGAAAACTAATAAACAGAAAGG + Intergenic
1109320547 13:60805064-60805086 AGGCAAATTAACAAACAGAAAGG - Intergenic
1109465744 13:62729417-62729439 AGGAAAATTAACAAACAGAAAGG - Intergenic
1109541233 13:63781630-63781652 ATGAAAACTAACAAACAGAAAGG - Intergenic
1109891274 13:68617573-68617595 AAGAAAATTAACAAACAGAAAGG + Intergenic
1109898450 13:68728211-68728233 ATGAAATTTAATGAAGAGGAAGG - Intergenic
1109900564 13:68764076-68764098 AAATAAATAAATAAACAGTATGG - Intergenic
1110556158 13:76861629-76861651 TTGTAAAATAATAACCAGGCTGG - Intergenic
1110993571 13:82074687-82074709 ATGGAGATTAATAGACAAGAAGG - Intergenic
1111907633 13:94273348-94273370 GTGCAAGTTAATAAAGAGGAAGG + Intronic
1112216967 13:97441321-97441343 ATTTAAATTATTAAACATTAAGG + Intronic
1112233113 13:97608596-97608618 AGGAAAATTAACAAACAGAAAGG + Intergenic
1112291711 13:98149278-98149300 AAATAAACTAATAAAGAGGATGG - Intronic
1112725651 13:102301498-102301520 ATGTAAATTAATAAAGGAGGTGG + Intronic
1112732507 13:102381113-102381135 ACTTAAAGTAAAAAACAGGATGG + Intronic
1113607118 13:111617058-111617080 ATGTACATTAATACAGAGGCAGG - Intronic
1113774125 13:112933044-112933066 AAATAAATAAATAAACATGAAGG + Intronic
1114151452 14:20044555-20044577 ATGTCAAATAATAATCAGGACGG - Intergenic
1114517999 14:23312564-23312586 ATGCAAATTGATAAACTGGATGG + Intronic
1115037651 14:28879551-28879573 ATGGATATTATTAAACAGCATGG + Intergenic
1115145384 14:30220203-30220225 ATGTAAATTCATAAGGAAGATGG + Intergenic
1115598877 14:34936447-34936469 TTGTAAAGTAAAAAACAGCAAGG - Intergenic
1115624785 14:35179923-35179945 AGGAAAATTAACAAACAGAAAGG - Intronic
1115792661 14:36897723-36897745 AGGAAAATTAACAAACAGAAAGG - Intronic
1115854810 14:37619811-37619833 ATTTGAAATAATAAACAGGCTGG - Intronic
1116302766 14:43206835-43206857 ATGCAAATTAAAAAATAGAAAGG - Intergenic
1116422926 14:44753979-44754001 ATGTAAATCAATATACATCAAGG + Intergenic
1116474585 14:45325426-45325448 AGGAAAATTAACAAACAGAAAGG - Intergenic
1116489093 14:45485825-45485847 AGGAAAATTAACAAACAGAAAGG - Intergenic
1116704950 14:48284895-48284917 AGGAAAATTAACAAACAGAAAGG - Intergenic
1116883623 14:50196764-50196786 AAATAAATTAATAAATAGGAAGG + Intronic
1117123597 14:52596038-52596060 AGGAAAACTAATAAACAGAAAGG - Intronic
1117172873 14:53118083-53118105 AGGAAAATTAACAAACAGAAAGG + Intronic
1117502261 14:56364791-56364813 AGGAAAATTAACAAACAGAAGGG - Intergenic
1117655573 14:57952208-57952230 AGGAAAACTAACAAACAGGAAGG + Intronic
1117771744 14:59140485-59140507 TTGTAAATTATTATTCAGGAAGG - Intergenic
1117998188 14:61498009-61498031 AAATAAATAAATAAATAGGATGG - Intronic
1118058734 14:62111964-62111986 AAGTAAATTTAGAAATAGGATGG - Exonic
1118094598 14:62522028-62522050 AGGAAAACTAACAAACAGGAAGG + Intergenic
1118145719 14:63133595-63133617 ATGTAAATTGGAAAACAGTATGG + Intergenic
1118418959 14:65577629-65577651 ATGTAAAATAATTAACACAATGG + Intronic
1119256740 14:73204738-73204760 ATGGAAATCCATAAACAGGCTGG + Intronic
1119528287 14:75340754-75340776 AAGTACATTGAGAAACAGGATGG - Intergenic
1120084219 14:80250874-80250896 AGGAAAACTAATAAACAGAAAGG - Intronic
1120114297 14:80595473-80595495 AAAAAAATTAATAAACAGGAAGG + Intronic
1120123787 14:80715657-80715679 ACGGAAATTAGTAAAAAGGAGGG + Intronic
1120565230 14:86047553-86047575 AGGAAAACTAACAAACAGGAAGG - Intergenic
1120800646 14:88684464-88684486 ATGTAAATAATAAAACAGGCCGG - Intronic
1122258344 14:100497275-100497297 AAGTAGATTAAAAAACAGCAAGG - Intronic
1122357848 14:101134726-101134748 ATGGAAACTATAAAACAGGATGG + Intergenic
1122462416 14:101906622-101906644 ATATCAATTAAAAAACAAGAAGG + Intronic
1122544633 14:102515390-102515412 ATGTAACTTAGTACACAGGCAGG - Intergenic
1123429140 15:20200051-20200073 AGGAAAACTAACAAACAGGAAGG - Intergenic
1124227990 15:27912582-27912604 ATGTAAATAAATAAAGGAGAAGG + Intronic
1125134624 15:36327525-36327547 ATATAAATAAATAAATAAGAGGG - Intergenic
1125628957 15:41132166-41132188 ATGTAGGTTAATAATCAGGCAGG - Intergenic
1125632683 15:41160364-41160386 ATGTAAATCAGTAAACAGTTTGG + Intergenic
1127031693 15:54871679-54871701 AAATAAATTATTGAACAGGATGG + Intergenic
1127452470 15:59130758-59130780 AGGAAAATTAACAAACAGAAAGG - Intergenic
1128404126 15:67317766-67317788 ATGTAATTGAATGAAGAGGAAGG + Intronic
1128464530 15:67898922-67898944 ATATAAATTATTAAATAGGCCGG - Intergenic
1129583963 15:76843079-76843101 TTATAAATTCATAAACAGGTAGG - Intronic
1129631071 15:77261074-77261096 AGGAAAACTAATAAACAGAAAGG + Intronic
1130188493 15:81709878-81709900 ATGTAAGTTAAAAAAAAGAAAGG - Intergenic
1130291955 15:82610422-82610444 ATTTAGATTAATAAACAGATAGG - Intronic
1130318045 15:82813383-82813405 AAGTAAATAAATAAACATAATGG - Intronic
1130729418 15:86475026-86475048 AGGAAAACTAATAAACAGAAAGG + Intronic
1131703780 15:94970593-94970615 ATTTAAAGAAATAAAAAGGAGGG + Intergenic
1131894978 15:97017601-97017623 ATGTAAATTCAAAACCATGAAGG - Intergenic
1131916520 15:97271608-97271630 AAGTGAATAAATAAACAGGTGGG - Intergenic
1132492007 16:237048-237070 ACATAAATAAATAAACAGGCTGG - Intronic
1135807662 16:25557063-25557085 AGGAAAATTAACAAACAGAAAGG + Intergenic
1136010610 16:27361141-27361163 CTGTATATTAAAAAAAAGGAGGG - Intronic
1136538231 16:30913075-30913097 ATGTGAATTAACACACAGCAAGG + Intergenic
1136855180 16:33649681-33649703 AGGAAAACTAACAAACAGGAAGG + Intergenic
1136983109 16:35075726-35075748 AGGAAAATTAACAAACAGAAAGG + Intergenic
1137901710 16:52275864-52275886 ATGTGACTTAATCAGCAGGATGG + Intergenic
1138692803 16:58785062-58785084 AGGAAAACTAACAAACAGGAAGG - Intergenic
1138706360 16:58919893-58919915 AGGAAAATTAACAAACAGAAAGG - Intergenic
1139489073 16:67276993-67277015 AAATAAATAAATAAAAAGGAGGG - Intergenic
1139499748 16:67352981-67353003 ATATAAATAAATAAACAGGCTGG - Intronic
1140618940 16:76703921-76703943 ATATAAATTTATAACCAGTATGG - Intergenic
1141303386 16:82838454-82838476 CTTTAAGTCAATAAACAGGAAGG - Intronic
1142220525 16:88852304-88852326 AGGAAAATTAACAAACAGAAAGG + Intronic
1142404287 16:89878504-89878526 ATTTCAGTTAATAACCAGGAAGG - Intronic
1203116762 16_KI270728v1_random:1498165-1498187 AGGAAAACTAACAAACAGGAAGG + Intergenic
1142935238 17:3324548-3324570 AGGAAAACTAACAAACAGGAAGG - Intergenic
1144114623 17:12075421-12075443 ATGTAAATTCATAAACACAAGGG + Intronic
1144114706 17:12076461-12076483 AGATAAATTAATAATCGGGAAGG + Intronic
1144264235 17:13552721-13552743 ATGTAAATTAAGACAAAGAAAGG + Intronic
1144359384 17:14477507-14477529 AAGTAAATAAATAAATAAGAAGG + Intergenic
1144994192 17:19255922-19255944 ATAAAAAATAAAAAACAGGAGGG - Intronic
1145192386 17:20854839-20854861 ATTTAAATTCAAAAACATGACGG + Intronic
1146142033 17:30376771-30376793 ATGTAAATAAACAAGCATGAGGG - Intergenic
1146145411 17:30412080-30412102 AGGAAAATTAACAAACAGGAAGG - Intronic
1146294048 17:31634464-31634486 ATGAAATTAAATGAACAGGAGGG + Intergenic
1146580304 17:34031314-34031336 AGGAAAACTAACAAACAGGAAGG + Intronic
1146829151 17:36052353-36052375 ATCTGAATTAAAAAAGAGGAAGG + Intergenic
1147027132 17:37596587-37596609 ATGCATATTAAAAAACAGTATGG + Intronic
1149011169 17:51858063-51858085 ATGTAAATTGAGAAACGGAAAGG + Intronic
1149078390 17:52624547-52624569 ATGGAAATTAATAAAGTAGAAGG + Intergenic
1149142263 17:53446004-53446026 ATTTAACTTCATAAAAAGGAAGG - Intergenic
1149212290 17:54317282-54317304 AGGAAAACTAATAAACAGAAAGG + Intergenic
1149359457 17:55878528-55878550 AGGAAAACTAATAAACAGAAAGG - Intergenic
1150503706 17:65676759-65676781 GTGTGATTTCATAAACAGGAAGG - Intronic
1203175992 17_KI270729v1_random:13454-13476 ATGGAACTGAATAAACTGGAAGG - Intergenic
1153107634 18:1546264-1546286 ATGTAATGTAGAAAACAGGAAGG - Intergenic
1153241851 18:3038299-3038321 AAATAAATAAATAAACAGGCGGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155232490 18:23786983-23787005 ATGAAAATAAATAAACAGGCCGG + Intronic
1156103069 18:33621885-33621907 ATGTAAATAAAGAAACAGAGTGG - Intronic
1156725216 18:40119250-40119272 ATGAAAACTAACAAACAGAAAGG - Intergenic
1157058164 18:44255481-44255503 AGGAAAACTAATAAACAGAAAGG - Intergenic
1157138535 18:45082566-45082588 ATGTAAGTGAATAAATAGAAGGG + Intergenic
1157217654 18:45799253-45799275 AGGAAAATTAACAAACAGAAAGG - Intergenic
1158054238 18:53260392-53260414 AGGAAAATTAACAAACAGAAAGG - Intronic
1158168939 18:54574688-54574710 AAGAAAACTAACAAACAGGAAGG - Intergenic
1158672251 18:59486872-59486894 ACGTAAATAAATAAATAGGTAGG - Intronic
1158798251 18:60874760-60874782 CTGTTAAATAGTAAACAGGATGG + Intergenic
1158853481 18:61518540-61518562 ATGAAAACTAACAAACAGAAAGG + Intronic
1159236097 18:65674242-65674264 ATTTATATAAATAAATAGGATGG - Intergenic
1159510159 18:69387487-69387509 ATTTTAATTAATGAATAGGAAGG - Intergenic
1159645694 18:70915974-70915996 AGGCAAATTAACAAACAGAAAGG - Intergenic
1159755744 18:72361544-72361566 AAATAAATAAATAAAAAGGAAGG - Intergenic
1161748834 19:6079162-6079184 CTGTAAATTACCAAACAGAATGG + Intronic
1161751336 19:6099362-6099384 AGGGAAATTAATTAACAGTAGGG + Intronic
1161854885 19:6758606-6758628 ATGAAAATTAAAACACAGGAAGG - Intronic
1161927362 19:7311298-7311320 AAATAAATAAATAAATAGGAAGG - Intergenic
1162175651 19:8828178-8828200 ATGGAACTTGTTAAACAGGAAGG + Intronic
1162580984 19:11530154-11530176 CAGTAAATAAATAAATAGGAAGG + Intergenic
1163001895 19:14373599-14373621 ATGTAAATTAAAAAATAAAAGGG + Intergenic
1163013925 19:14442201-14442223 TTTTAAATTAAAAAACAGGCTGG - Intronic
1163064427 19:14782777-14782799 ATGTAAATTAAAAAATAAAAGGG - Intergenic
1163380326 19:16961960-16961982 AGGAAAATTAACAAACAGAAAGG + Intronic
1163858976 19:19730525-19730547 ATTTACATTAATAAACTTGACGG + Intronic
1164091366 19:21956026-21956048 AGGAAAATTAACAAACAGAAGGG - Intronic
1164111165 19:22160716-22160738 AGGAAAATTAACAAACAGAAAGG - Intergenic
1164328895 19:24232174-24232196 AGGAAAATTAACAAACAGAAAGG + Intergenic
1164495609 19:28757783-28757805 AGGAAAATTAACAAACAGAAAGG + Intergenic
1164688573 19:30189856-30189878 AGGAAAACTAACAAACAGGAAGG - Intergenic
1165854670 19:38872187-38872209 ATATAAATGAATAAACAGTCAGG + Intronic
1166249761 19:41561426-41561448 ATATAAATAACTAAACAGGTGGG + Intronic
1167616151 19:50535162-50535184 AAATAAATAAATAAACAGGCCGG - Intronic
1167936492 19:52912805-52912827 AGGTAAATTAAAAAACAGATAGG + Intergenic
925252353 2:2450910-2450932 AGGAAAACTAACAAACAGGAAGG - Intergenic
925270402 2:2602112-2602134 ATATAAATAAATAAACAAAAAGG + Intergenic
925556812 2:5140096-5140118 TTCTAAAATAATAAAGAGGAAGG - Intergenic
926360590 2:12082945-12082967 AAGTAAATCAATAAAAAGAATGG + Intergenic
927064133 2:19453360-19453382 ATGTAAATTCACAATCATGATGG - Intergenic
927361505 2:22240049-22240071 ATCTAGATTAGTAAACAGGAAGG - Intergenic
928042833 2:27895788-27895810 ATTCAAATTAATAAACGGGGAGG - Intronic
928158862 2:28902678-28902700 ATGCAAATAAAGAGACAGGAAGG + Intronic
928522635 2:32105650-32105672 AGGAAAATTAACAAACAGAAAGG - Intronic
928773384 2:34729484-34729506 ATGTAGAATAATAGATAGGATGG - Intergenic
928810373 2:35217380-35217402 CTGTAAATTAAATAACTGGAAGG + Intergenic
929068943 2:38009900-38009922 AGGAAAACTAATAAACAGAAAGG - Intronic
929298714 2:40277029-40277051 ATGTAAATTAAAAACAATGATGG + Intronic
930143237 2:47974442-47974464 AGGAAAACTAACAAACAGGAAGG + Intergenic
930598068 2:53411837-53411859 AGGAAAATTAACAAACAGAAAGG + Intergenic
930725164 2:54675050-54675072 ATGTAGGTTAACAAGCAGGAAGG + Intergenic
931130231 2:59327245-59327267 ACGAAAACTAACAAACAGGAAGG + Intergenic
931133425 2:59366419-59366441 AGGAAAAATAATAAACATGATGG + Intergenic
932891837 2:75604225-75604247 ATGTAAATAAGTAAACACAAAGG - Intergenic
934932971 2:98443411-98443433 AAATAAATAAATAAACAGCATGG + Intergenic
935073992 2:99722740-99722762 ATGGAAATTTATATACAGAATGG + Intronic
936642026 2:114324050-114324072 ATGTAAACCAGTAAACATGAGGG - Intergenic
936806345 2:116337027-116337049 AGGAAAACTAATAAACAGAAAGG - Intergenic
937074984 2:119096642-119096664 ATGAAAACTAACAAACAGAAAGG + Intergenic
937115559 2:119402673-119402695 ATGTGAATCAATTACCAGGAGGG - Intergenic
937615279 2:123914405-123914427 CAGTAAATCAATAAACATGATGG - Intergenic
937782149 2:125850811-125850833 ATTTAAATGTAAAAACAGGAAGG - Intergenic
938167412 2:129043333-129043355 ATGAAAACTAACAAACAGAAAGG - Intergenic
939130437 2:138229475-138229497 ATCTAATTTGATAAACAGTATGG - Intergenic
939239282 2:139538008-139538030 AGGAAAACTAATAAACAGAAAGG - Intergenic
939353120 2:141066944-141066966 AGATAAATTAATAAACATGGAGG - Intronic
939720143 2:145639132-145639154 ATGTAAATTAGAAAACAGTATGG + Intergenic
940513191 2:154645887-154645909 AAGTAAATTAGTAAACAATATGG - Intergenic
940745245 2:157560318-157560340 ATGTAAATTAATTAATTTGAAGG - Intronic
941089041 2:161153386-161153408 ATTTAAATTAAAAATCAGGCTGG + Intronic
941147628 2:161871878-161871900 ATGTAAAGCATTAAAAAGGACGG - Intronic
941399804 2:165016735-165016757 ATGTATATTTAGAAAGAGGAAGG - Intergenic
941479244 2:165985343-165985365 AGGTAAAGTAAGAAAAAGGAAGG + Intergenic
942031614 2:171968035-171968057 CTGTAGAATAATAAACTGGAGGG + Intronic
942471262 2:176263007-176263029 ATGTATATAAAAAAACTGGATGG - Intergenic
942779999 2:179630442-179630464 AGGAAAACTAATAAACAGAAAGG + Intronic
942853784 2:180522400-180522422 ATGTACATTTAAAAACATGAAGG - Intergenic
943303494 2:186231268-186231290 AGGAAAACTAACAAACAGGAAGG + Intergenic
943407383 2:187506898-187506920 AAATAAATAAATAAACAGTATGG - Intronic
944317252 2:198296169-198296191 AAATAAATAAATAAAAAGGAAGG + Intronic
945360940 2:208894872-208894894 AGGAAAACTAATAAACAGAAAGG + Intergenic
946505215 2:220292830-220292852 TTGTAAAAGAATAAACTGGATGG - Intergenic
946849015 2:223886901-223886923 ATCTAAAATAAGAAATAGGAAGG - Intronic
946859175 2:223983914-223983936 ATATAAATAAATAAATAAGATGG - Intronic
947185811 2:227454384-227454406 ATAAAAATAAATAAACAGAATGG + Intergenic
948327444 2:237137441-237137463 AACTGAATAAATAAACAGGAGGG - Intergenic
948418103 2:237831750-237831772 AGGTAAAGTAGTAAAGAGGAAGG - Intronic
1168908436 20:1425629-1425651 CTGTAAATAAATACACAGCAAGG - Intergenic
1169707909 20:8527386-8527408 ATGAAAATAAATAAACAGCATGG + Intronic
1170229279 20:14027630-14027652 AGGAAAATTAACAAACAGAAAGG - Intronic
1171106443 20:22438012-22438034 ATGTTAATAAGAAAACAGGAGGG + Intergenic
1171168255 20:22992762-22992784 AGGAAAATTAACAAACAGAAAGG - Intergenic
1171321723 20:24250424-24250446 AGGTAAAGGAATATACAGGATGG + Intergenic
1171352386 20:24513078-24513100 AGGAAAACTAATAAACAGAAAGG + Intronic
1171892868 20:30732137-30732159 AGGAAAATTAACAAACAGAAAGG + Intergenic
1172570895 20:35969496-35969518 ATATAAAAATATAAACAGGAAGG - Intronic
1172638891 20:36429061-36429083 AAATAAATAAATAAACAGGCAGG - Intronic
1173176527 20:40768962-40768984 ACATAAATAAATAAATAGGAAGG + Intergenic
1173213002 20:41051868-41051890 ATGTAAATTAATCAAGGAGAAGG + Intronic
1175013947 20:55768306-55768328 TTGTAAAAGAATAAACAGGTCGG + Intergenic
1175584771 20:60129951-60129973 ATTTAATTTAAGAAAAAGGATGG + Intergenic
1177631690 21:23736794-23736816 ATGTAACATAAGAAACAGAATGG - Intergenic
1177672430 21:24250100-24250122 ATGTAAACAAATAAACAAAAAGG + Intergenic
1177778293 21:25594581-25594603 ATGTAAAATAACAAGCAGTAAGG - Intronic
1178433252 21:32535009-32535031 AAATAAATAAATAAAAAGGAAGG + Intergenic
1178433640 21:32537880-32537902 AAGTAAATAAATAAACAAAATGG - Intergenic
1178451323 21:32704226-32704248 ATGTAAATAACTAAACTGCAAGG - Intronic
1178593301 21:33930775-33930797 AGGAAAACTAATAAACAGAAAGG - Intergenic
1180350814 22:11801048-11801070 AGGAAAATTAACAAACAGAAAGG + Intergenic
1180394901 22:12322672-12322694 AGGAAAACTAATAAACAGAAAGG - Intergenic
1180404841 22:12542076-12542098 AGGAAAACTAATAAACAGAAAGG + Intergenic
1180419756 22:12802273-12802295 AGGAAAACTAACAAACAGGAAGG + Intergenic
1181451578 22:23026257-23026279 ATGCAAATTAATAAGGAAGAAGG + Intergenic
1183038140 22:35155736-35155758 AAATAAATAAATAAACAGGGAGG + Intergenic
949275101 3:2270243-2270265 AAGTAAATAAATAAATAGGCCGG - Intronic
949399394 3:3649844-3649866 ATGACAATTAATTAGCAGGATGG - Intergenic
949429081 3:3953577-3953599 ATGCAAAATAATAAATATGATGG - Intronic
949594484 3:5530193-5530215 AGGAAAACTAATAAACAGAAAGG - Intergenic
950620563 3:14202125-14202147 ATGTAAATTAATAACTAGTTAGG - Intergenic
951173760 3:19575145-19575167 ACTGAAAGTAATAAACAGGATGG + Intergenic
951277229 3:20703082-20703104 GTGTAAAATAATATAGAGGAAGG - Intergenic
951434535 3:22646344-22646366 ATGTAAATTAACAACCACTATGG - Intergenic
951634590 3:24759216-24759238 ATGTAAATAAATGAGCAGTATGG - Intergenic
951641146 3:24836951-24836973 ATGTCCATCAATAAACAGGAAGG + Intergenic
951659048 3:25041903-25041925 ATGTAAAATACTGAAAAGGAAGG + Intergenic
951684573 3:25329458-25329480 AGGAAAACTAATAAACAGAAAGG + Intronic
951791355 3:26488211-26488233 CTTTAAATTAAGAAACTGGAGGG + Intergenic
952077076 3:29710026-29710048 ATGGAAATTAATCAAATGGAAGG + Intronic
953098261 3:39800137-39800159 AAGAAAATTAACAAACAGAAAGG - Intergenic
953281643 3:41564081-41564103 AGGAAAATTAACAAACAGAAAGG - Intronic
953289420 3:41647382-41647404 AGGAAAACTAACAAACAGGAAGG - Intronic
953940625 3:47092351-47092373 ATGTAATTTAATTGAAAGGAAGG - Intronic
954056100 3:48027209-48027231 ATGTAAAATAAAAAAGAGTAAGG + Intronic
954356641 3:50087649-50087671 AAATAAATAAATAAAAAGGAGGG - Intronic
955031171 3:55220794-55220816 ATGTCAACTAATCCACAGGAAGG - Intergenic
955284646 3:57627596-57627618 ATGTCTATTAATAAACACAATGG + Exonic
955740090 3:62081344-62081366 ATCTAAATAAATAAATAAGAAGG - Intronic
956243518 3:67155192-67155214 AGGAAAACTAATAAACAGAAAGG + Intergenic
956929045 3:74021704-74021726 ATGTAATTAATTAAACTGGAAGG - Intergenic
957308407 3:78487980-78488002 AGGAAAATTAACAAACAGAAAGG + Intergenic
957309188 3:78497746-78497768 AAATAAATAAATAAAAAGGATGG - Intergenic
957311289 3:78522536-78522558 AAGTAAACAAATAAACAGTATGG + Intergenic
957709751 3:83840559-83840581 ATGTGAATTTTTAAAAAGGAAGG - Intergenic
958261156 3:91382972-91382994 AGGAAAATTAACAAACAGAAAGG - Intergenic
958479812 3:94631541-94631563 ATGAAAACTAACAAACAGAAAGG + Intergenic
958506993 3:94992604-94992626 TGGGAAATTAATATACAGGAGGG + Intergenic
958608719 3:96395359-96395381 ATGAAACTAAATAAACAAGAGGG + Intergenic
958811005 3:98859676-98859698 AGGAAAATTAACAAACAGAAAGG + Intronic
958827054 3:99042598-99042620 ATGTAAATTCAAAAATAAGAAGG + Intergenic
958829831 3:99073711-99073733 ATGAAAACTAATGAACAGAAAGG - Intergenic
958950333 3:100409346-100409368 TTGTAAATAAATAAATAGGCTGG + Intronic
959025760 3:101237639-101237661 AGGGAAATTAACAAACAGAAAGG + Intronic
959100986 3:102009141-102009163 AGGAAAACTAACAAACAGGAAGG + Intergenic
959428577 3:106223608-106223630 AGGAAAACTAACAAACAGGAAGG - Intergenic
959634948 3:108555377-108555399 AAGTAACTTGTTAAACAGGAAGG + Intronic
959769295 3:110072953-110072975 ATGTAAAATAAAAAACAAGTTGG - Intergenic
959783560 3:110265917-110265939 ATGTAAAGGAAAAAACAGAATGG - Intergenic
959840440 3:110968815-110968837 TTGTAAATCAAAAAGCAGGAAGG - Intergenic
960851652 3:122060908-122060930 ATTTACATCAATAAACAGAATGG + Intronic
961255831 3:125551194-125551216 AATTAAATTAAAAAAAAGGATGG + Intronic
961860159 3:129910520-129910542 ATGAAAATAAATAAATAGGGTGG - Intergenic
962341382 3:134587414-134587436 AGGAAAACTAATAAACAGGAAGG - Intergenic
962761468 3:138518634-138518656 AGGAAAACTAACAAACAGGAAGG + Intronic
962902453 3:139773192-139773214 ATGTAATTTAATCAAGGGGAGGG - Intergenic
963595765 3:147322229-147322251 ATGAGAATTAATATACAGTATGG + Intergenic
963605397 3:147408718-147408740 ATCTTAAATTATAAACAGGAGGG + Intronic
963981906 3:151547230-151547252 ATGAAAACTATTAAAAAGGATGG - Intergenic
964500301 3:157340976-157340998 AGGAAAACTAACAAACAGGAAGG + Intronic
964715186 3:159714241-159714263 ATAAAAAATAATAAAAAGGAAGG + Intronic
965764252 3:172113478-172113500 ATATAAATTATTAAGCAGCAAGG - Intronic
966272617 3:178125945-178125967 ATTTAAATTAACAAAAAGAAGGG + Intergenic
966637804 3:182155924-182155946 AGGAAAATTAACAAACAGAAAGG - Intergenic
967619939 3:191620750-191620772 AAGTAAATTAAAAAAAAGAAAGG - Intergenic
967638715 3:191835371-191835393 AGGAAAATTAACAAACAGAAAGG + Intergenic
969064110 4:4464164-4464186 ATGTAAATTAATGAAAAAGTTGG - Intronic
969181212 4:5443790-5443812 AGGAAAACTAATAAACAGAAAGG - Intronic
969504018 4:7572272-7572294 ATGTAAATAAAGAAACAGTAGGG - Intronic
970225096 4:13849539-13849561 ATGCAACTTAATAAGCAAGAAGG + Intergenic
970379741 4:15494866-15494888 ATGTAAATTTAAAAACAGAATGG + Intronic
970509432 4:16766219-16766241 ATGTATATTAATATAAAAGATGG - Intronic
970581401 4:17477311-17477333 AGGAAATTTAATAAAGAGGATGG + Intronic
970986961 4:22170336-22170358 AAGTAAATCAATAAAAAGGAGGG - Intergenic
971004603 4:22358466-22358488 AGGAAAATTAACAAACAGAAAGG + Intronic
971074373 4:23130685-23130707 ATGTAAATTAATTAAAATTAAGG + Intergenic
971137392 4:23884366-23884388 ATATAAATTAATAAATAAGAAGG - Intronic
971612366 4:28742120-28742142 ATGAAAATAAATGAGCAGGAAGG - Intergenic
971674007 4:29600838-29600860 ATGTAAAAAAATAAATAGTATGG + Intergenic
971747105 4:30596654-30596676 TTGTAAAAAAATAAACAGGGTGG - Intergenic
972611802 4:40662561-40662583 AAATAAATAAATAAACAGGCTGG - Intergenic
972677573 4:41275609-41275631 ATGAAAACTAACAAACAGAAAGG - Intergenic
972814625 4:42630313-42630335 CTCTAAATTATTAAACAGCAAGG - Intronic
973111792 4:46405594-46405616 AGGAAAACTAATAAACAGAAAGG + Intronic
973313032 4:48729661-48729683 AGGAAAACTAATAAACAGAAAGG + Intronic
973592862 4:52459904-52459926 AGGAAAATTAACAAACAGAAAGG + Intergenic
973657949 4:53069877-53069899 ATGTATATTATTAAAGTGGAAGG - Intronic
973684146 4:53352787-53352809 ATGTAAATTCATAAAATGGGAGG + Intronic
973732325 4:53834270-53834292 AGGTAAACTAACAAACAGAAAGG + Intronic
974006807 4:56566181-56566203 AAGTAAATAAATAAATAAGAAGG - Intronic
974037670 4:56831179-56831201 ATATAAATAAATAAATAGGCTGG + Intergenic
974204777 4:58687282-58687304 ATGTAAACTAATTAACAAAATGG - Intergenic
974491522 4:62571143-62571165 AGGAAAATTAACAAACAGAAAGG - Intergenic
974504030 4:62744891-62744913 ATGTAAAGCAATAAAAAGCAGGG + Intergenic
974673097 4:65057364-65057386 AGGAAAATTAACAAACAGAAAGG - Intergenic
974780450 4:66546018-66546040 AGGAAAACTAACAAACAGGAAGG + Intergenic
975034333 4:69661746-69661768 AGGAAAATTAACAAACAGAAAGG + Intergenic
975062348 4:70018838-70018860 AGGAAAACTAATAAACAGAAAGG - Intergenic
975096750 4:70465171-70465193 AGGAAAACTAATAAACAGAAAGG + Intronic
975367465 4:73545356-73545378 AAGAAAACTAATAAACAGAAAGG + Intergenic
975467677 4:74727688-74727710 AGTTAAATTTATAAACTGGAGGG + Intergenic
975638895 4:76478901-76478923 AGGAAAACTAATAAACAGAAAGG + Intronic
976032647 4:80775771-80775793 ATGCAAATTCATAAACAAAATGG + Intronic
976342084 4:83957373-83957395 ATGAAAACTAACAAACAGAAAGG - Intergenic
976438406 4:85044570-85044592 AGGAAAATTAACAAACAGAAAGG + Intergenic
976669611 4:87637093-87637115 AGGAAAACTAATAAACAGAAAGG + Intergenic
976794836 4:88920503-88920525 AGGAAAACTAATAAACAGAAAGG + Intronic
976961170 4:90976692-90976714 CTGTAAATAAATAAAAATGAAGG + Intronic
976977197 4:91179999-91180021 AGGAAAACTAATAAACAGAAAGG - Intronic
977973977 4:103243263-103243285 AGGAAAATTAACAAACAGAAAGG - Intergenic
978536029 4:109764445-109764467 ATGGAAATTAATACACAGAAAGG + Intronic
978725071 4:111959945-111959967 AAGTAAATGAATGAAAAGGAAGG + Intergenic
978810053 4:112839578-112839600 ATCTGAATTAATACACAGAATGG - Intronic
978857494 4:113409837-113409859 TTCTAAATGAATAAACAGGTTGG - Intergenic
978889769 4:113810688-113810710 ATTTAAATTAAGAAAAATGATGG - Intergenic
979050729 4:115928381-115928403 ATGTAAATGGAAAAACAGAATGG + Intergenic
979324846 4:119367097-119367119 ATGCTAAATCATAAACAGGATGG - Intergenic
980088771 4:128419475-128419497 ATGCTAATTAATAAAAAGTAAGG - Intergenic
980165579 4:129222863-129222885 ATTTTAATTAATTAAAAGGAAGG - Intergenic
980584134 4:134790171-134790193 AGGAAAATTAACAAACAGAAAGG + Intergenic
980772577 4:137396040-137396062 ATATAAAATAATAAATAGAAGGG + Intergenic
981083512 4:140659253-140659275 AAAAAAATTAATAAAGAGGATGG - Intronic
981197108 4:141934441-141934463 ATGGAAATTACTAAAATGGAAGG - Intergenic
981345600 4:143673281-143673303 AGGAAAACTAACAAACAGGAAGG - Intronic
981578235 4:146227061-146227083 ACCTAAATTAATAAAGAGGCCGG - Intronic
981634380 4:146859365-146859387 ATAAAAAATAATAAACAAGAGGG - Intronic
981864220 4:149395537-149395559 ATATAAAAGTATAAACAGGAAGG + Intergenic
981864586 4:149400641-149400663 ATGTATTTTAATATACAGAAGGG - Intergenic
981958141 4:150503543-150503565 AGGAAAACTAACAAACAGGAAGG + Intronic
982405970 4:155020964-155020986 AGGAAAACTAACAAACAGGAAGG - Intergenic
982785591 4:159533258-159533280 AGGAAAACTAATAAACAGAAAGG - Intergenic
982908981 4:161116066-161116088 ATGGAAATTAAAAAAAAGCAGGG - Intergenic
982928754 4:161375042-161375064 ATGGAAATGAATAAGCAGCACGG + Intergenic
984145910 4:176060631-176060653 ATGTATAGTAATAAAAAGCATGG - Intergenic
984154842 4:176183428-176183450 ATGTAAATGAAGATACAGGATGG - Intergenic
984303147 4:177950180-177950202 ATGTAAAAAAAAAAAAAGGAAGG - Intronic
984362447 4:178753077-178753099 ATGTAGATTAATAAAAAGGGGGG - Intergenic
985267498 4:188163621-188163643 AAGTAAATAAATAACCAGGCCGG + Intergenic
986379734 5:7171498-7171520 AGGAAAACTAACAAACAGGAAGG + Intergenic
986605922 5:9522583-9522605 AAATAAATAAATAAAAAGGAGGG + Intronic
986753182 5:10809108-10809130 CTGTATATTAATCAACTGGAGGG - Intergenic
986756918 5:10845370-10845392 ATGTCAATGAATAAACTAGAAGG + Intergenic
987384948 5:17320214-17320236 AAATAAATAAATAAAGAGGATGG + Intergenic
987921802 5:24293106-24293128 ATGTAAAGTACTAAGCATGAAGG + Intergenic
988062803 5:26194734-26194756 ACTTAAAATAATAAACAGGCTGG - Intergenic
988230459 5:28471603-28471625 CTGTAAATTAATGAAAAGTATGG - Intergenic
988350423 5:30098582-30098604 ATGAAAATTAATAAATATGTAGG + Intergenic
988845258 5:35120976-35120998 ATTTATATAAATAAACAGGCTGG + Intronic
988933193 5:36057177-36057199 TTGCAAATAAATAAACAGTATGG + Intronic
988961260 5:36373825-36373847 ATGCAAAGTTATAATCAGGAGGG + Intergenic
988963204 5:36390272-36390294 CTGCAAATTAAGAAACAGCATGG + Intergenic
989528675 5:42482070-42482092 AGGAAAACTAATGAACAGGAAGG - Intronic
989682126 5:44041849-44041871 AGGAAAATTAACAAACAGAAAGG + Intergenic
990060221 5:51637692-51637714 AGGAAAACTAACAAACAGGAAGG + Intergenic
991046674 5:62230493-62230515 AGGAAAACTAACAAACAGGAAGG - Intergenic
991517000 5:67448085-67448107 AGCAAAATTAATAAACATGAAGG - Intergenic
992197170 5:74351369-74351391 ATGTAAATTAATAAGAATGATGG - Intergenic
992242001 5:74781377-74781399 ATGGTAATTAATAAACAGCATGG - Exonic
992287959 5:75255176-75255198 AGGAAAACTAATAAACAGAAAGG - Intergenic
992338404 5:75797817-75797839 AGGAAAACTAACAAACAGGAAGG - Intergenic
992354650 5:75968124-75968146 ATGAAAACTAACAAACAGGAAGG + Intergenic
992896490 5:81250114-81250136 ATGTAAATTAAGAGATATGATGG - Intronic
992904340 5:81331239-81331261 TTTTAAATTAAAAAACAGGCCGG + Intronic
993358196 5:86941037-86941059 AGGAAAATTAACAAACAGAAAGG - Intergenic
993541730 5:89160097-89160119 AAGAAAATTAACAAACAGAAAGG + Intergenic
993640065 5:90391851-90391873 ATGTATATTAACAAAAAAGACGG + Intergenic
993804960 5:92394870-92394892 CTGAAAATTTATAAACAAGATGG + Intergenic
993895088 5:93523775-93523797 AGGAAAATTAACAAACAGAAAGG + Intergenic
994233427 5:97335615-97335637 AGGAAAACTAACAAACAGGAAGG - Intergenic
994334424 5:98547488-98547510 AGGAAAATTAACAAACAGAAAGG + Intergenic
994522147 5:100853439-100853461 ATGTAGATTTGTGAACAGGAAGG + Intronic
994662687 5:102672039-102672061 AGGAAAATTAACAAACAGAAAGG + Intergenic
994920921 5:106042020-106042042 ATTTAAATTAAAAAAAAGTATGG + Intergenic
995179064 5:109213643-109213665 AGGAAAATTAACAAACAGAAAGG - Intergenic
995334828 5:110986543-110986565 AGGAAAACTAACAAACAGGAAGG + Intergenic
995626653 5:114086126-114086148 AGGTTAAAAAATAAACAGGAAGG - Intergenic
995771505 5:115675461-115675483 AGGAAAATTAACAAACAGAAAGG + Intergenic
995811041 5:116107901-116107923 AGGAAAACTAATAAACAGAAAGG - Intronic
996625110 5:125561578-125561600 ATGTAATTTAAGAGATAGGAAGG - Intergenic
996938258 5:128972986-128973008 AGGAAAACTAATAAACAGAAAGG - Intronic
997026455 5:130068250-130068272 ATGAAAATTAAAAAATAAGATGG + Intronic
997110756 5:131071497-131071519 ATTTAAAGTAAGAAACAGTATGG - Intergenic
997184942 5:131871950-131871972 AGGAAAACTAACAAACAGGAAGG + Intronic
997443160 5:133922912-133922934 AAGTAAATAAATAAAAAGGTGGG - Intergenic
998009559 5:138683868-138683890 AGGAAAACTAATAAACAGAAAGG - Intronic
998275064 5:140744610-140744632 AAGTAAATAAATAAATGGGAGGG - Intergenic
998964577 5:147525332-147525354 ATGTATATTATTAATCAGTAAGG - Intergenic
999225219 5:150016604-150016626 ATATAAATTAGTTAAAAGGATGG - Intronic
999649626 5:153752701-153752723 AAGTAAATGAATAAATAGTATGG + Intronic
999811155 5:155128618-155128640 CTGTATCTTAATAAACAGGGAGG - Intergenic
1000473010 5:161669936-161669958 AAGCAAATTAATAAATATGAAGG + Intronic
1000727366 5:164788505-164788527 ATGCAAATTAATACCCAGGCTGG + Intergenic
1000972150 5:167726441-167726463 AAGTAAATAAATAAAAAGGAAGG - Intronic
1001571703 5:172734479-172734501 AAATAAATAAATAAATAGGAGGG - Intergenic
1002019775 5:176355803-176355825 CTTTAAATTAATCTACAGGAAGG + Intronic
1003783779 6:9460143-9460165 TTAAAAATTAATAAACAGGCCGG + Intergenic
1004608573 6:17217022-17217044 AAATAAATAAATAAAAAGGAAGG + Intergenic
1004832864 6:19495960-19495982 AGGAAAACTAATAAACAGAAAGG + Intergenic
1004944368 6:20595891-20595913 AGGAAAATTAACAAACAGAAAGG - Intronic
1005356390 6:24987725-24987747 ATGTAAATGACTAAACGGCAAGG - Intronic
1005373580 6:25159122-25159144 AGGAAAACTAATCAACAGGAAGG + Intergenic
1005756118 6:28926211-28926233 TTTTAAATTAAAAAAAAGGAAGG - Intergenic
1006548330 6:34798860-34798882 ATGTACATTAAGAGAAAGGAGGG + Intronic
1007129354 6:39455322-39455344 AGGAAAACTAACAAACAGGAAGG + Intronic
1007283979 6:40734406-40734428 AAATAAATAAATAAAGAGGAAGG - Intergenic
1008576151 6:52861766-52861788 AGGTAAACTAACAAACAGAAAGG + Intronic
1008785214 6:55159228-55159250 AGGAAAATTAACAAACAGAAAGG + Intronic
1008796625 6:55311300-55311322 AGGAAAACTAACAAACAGGAAGG - Intergenic
1008994007 6:57637178-57637200 AGGAAAATTAACAAACAGAAAGG + Intronic
1009182613 6:60536268-60536290 AGGAAAATTAACAAACAGAAAGG + Intergenic
1009230181 6:61052593-61052615 AGGAAAATTAACAAACAGAAAGG - Intergenic
1009410518 6:63360845-63360867 AGGAAAATTAACAAACAGAAAGG - Intergenic
1009767278 6:68096434-68096456 ATGTATATTAGAAAACAGAAAGG + Intergenic
1009801293 6:68539756-68539778 ATGTAAAGTAATATCCTGGATGG + Intergenic
1010160771 6:72852052-72852074 AAATTAATTAATAAACAGCAAGG + Intronic
1010171724 6:72983894-72983916 AGGAAAATTAACAAACAGAAAGG - Intronic
1010594125 6:77743921-77743943 AGGAAAACTAATAAACAGAAAGG + Intronic
1010620412 6:78066920-78066942 ATGTAAACTAAGCAACAGTAAGG - Intergenic
1010677057 6:78757036-78757058 AGGAAAACTAATAAACAGAAAGG + Intergenic
1010681691 6:78806856-78806878 AGGAAAATTAACAAACAGAAAGG - Intergenic
1010701792 6:79057877-79057899 CTATAAAGTAATGAACAGGATGG - Intronic
1010866866 6:80986321-80986343 ATAAAAATTAATAAAAAGGGAGG - Intergenic
1010994122 6:82513198-82513220 AGGAAAATTAACAAACAGAAAGG + Intergenic
1011188050 6:84700275-84700297 AGGAAAACTAATAAACAGAAAGG + Intronic
1011354117 6:86456028-86456050 ATTTCAATTAAAAAACAGAAGGG + Intergenic
1011358444 6:86497297-86497319 AAGAAAACTAATAAACAGAAAGG - Intergenic
1011760804 6:90563024-90563046 AGGAAAACTAATAAACAGAAAGG + Intronic
1011905042 6:92354504-92354526 ATCTAAACTAATAAACAGTGAGG + Intergenic
1012056760 6:94422389-94422411 ATGGAAATTAAAAAACACCAGGG - Intergenic
1012478597 6:99642082-99642104 ATGTAATTTAATAACACGGAAGG - Intergenic
1012985467 6:105871170-105871192 ATTTAAATTAAGTAACATGAAGG - Intergenic
1014396938 6:120935404-120935426 AAATAAATTAATAAACCTGATGG - Intergenic
1014439733 6:121460602-121460624 AAATAAATAAATAAAAAGGAAGG - Intergenic
1014922538 6:127229411-127229433 AGGAAAATTAACAAACAGAAAGG + Intergenic
1015056619 6:128910826-128910848 AGGAAAACTAATAAACAGAAAGG - Intronic
1015179617 6:130347032-130347054 AGGAAAACTAATAAACAGAAAGG + Intronic
1015321582 6:131881370-131881392 ATAAATATTAATAAATAGGATGG - Intronic
1015584520 6:134761604-134761626 ATGAAAATTAATAAATAGCAGGG + Intergenic
1015898661 6:138041545-138041567 ATTTAAAATAATAAACAAAAAGG - Intergenic
1015962707 6:138666742-138666764 ACGTATATTGATATACAGGAGGG + Intronic
1016158492 6:140845069-140845091 ATGCAATTTAATTAACAAGATGG - Intergenic
1016414154 6:143815589-143815611 ATGTGAATAAATTTACAGGAAGG + Intronic
1016511850 6:144851228-144851250 GTGTAAATTAATGAACAGAGAGG + Exonic
1016727237 6:147386807-147386829 ATGTAGATTAATATACTGGTTGG + Intergenic
1016919735 6:149280021-149280043 ATGTACAATAATAAATAAGAGGG - Intronic
1017118953 6:151006020-151006042 AGGTCAATGAAAAAACAGGATGG - Intronic
1017248704 6:152256452-152256474 AAATAAATAAATAAATAGGATGG + Intronic
1017364460 6:153618219-153618241 ATGTATATTAGTTAACAGCAGGG - Intergenic
1017531577 6:155297652-155297674 ATGTAAAAGGAAAAACAGGAGGG + Intronic
1017892667 6:158652222-158652244 AAGTAAATAAATAAACAGGCTGG - Intronic
1017968595 6:159289773-159289795 AGGAAAATTAACAAACAGAAAGG - Intergenic
1018382602 6:163272331-163272353 TTGAAAATTAATACACAGGCCGG - Intronic
1018425940 6:163680560-163680582 TTATAAATAAATAAATAGGAAGG - Intergenic
1018641283 6:165906901-165906923 AAGTAAATTAATATCCAAGACGG + Intronic
1018914028 6:168121809-168121831 ATCTGGATTAATAGACAGGAAGG + Intergenic
1019112449 6:169726826-169726848 GTGTAACTTAGTAAACAGTAAGG - Intergenic
1019753018 7:2744471-2744493 AGGAAAACTAACAAACAGGAAGG + Intronic
1020510500 7:9050288-9050310 TTGTAAAATAATAAATAGTATGG + Intergenic
1020708072 7:11570641-11570663 ATGTAAAATATTAAAAAGCAAGG - Intronic
1020887526 7:13836644-13836666 AAGAAAAAAAATAAACAGGATGG + Intergenic
1021285144 7:18771512-18771534 CTGTAAATTTATAAATAAGAGGG - Intronic
1021870475 7:25001469-25001491 AGGAAAATTAACAAACAGAAAGG - Intergenic
1021947801 7:25744647-25744669 AGGAAAACTAATAAACAGAAAGG + Intergenic
1022464190 7:30642000-30642022 AGGAAAACTAATAAACAGAAAGG - Intergenic
1022576861 7:31506390-31506412 AGGAAAACTAACAAACAGGAAGG - Intergenic
1022869233 7:34458128-34458150 AGGAAAACTAATAAACAGAAAGG + Intergenic
1023021586 7:36016343-36016365 AAGTAAATAAATAAAAAAGACGG + Intergenic
1023283011 7:38591022-38591044 AAGTTCATTTATAAACAGGAGGG + Intronic
1023408028 7:39857272-39857294 ATGCAAATTAGTTAAAAGGATGG - Intergenic
1023450801 7:40282869-40282891 ATGTAAATAAATAAATAATATGG + Intronic
1023463003 7:40421046-40421068 ATGTAAATAAAGGCACAGGATGG - Intronic
1024380078 7:48685881-48685903 AGGAAAACTAACAAACAGGAAGG + Intergenic
1024624749 7:51196535-51196557 AAATAAATAAATAAAGAGGAAGG - Intronic
1024795615 7:53016071-53016093 ATGATAATTAATACCCAGGAAGG + Intergenic
1024878650 7:54058297-54058319 AAATAAATCAATAAACAGAATGG + Intergenic
1025137830 7:56435278-56435300 ATGCAAATTAGTTAAAAGGATGG + Intergenic
1026274093 7:68861829-68861851 ATGTAAATCAATAAAGACCATGG + Intergenic
1026357316 7:69569880-69569902 ATGCAAATTAAGGAACAGGCGGG + Intergenic
1026789772 7:73324142-73324164 CTGCAAATAAAAAAACAGGAAGG + Intronic
1027443924 7:78250124-78250146 ATGAATATTAAAAAACAGCAAGG + Intronic
1027664440 7:81027182-81027204 AAATAAATTAACAAACAAGACGG + Intergenic
1028303422 7:89230531-89230553 ATGTAAATAAGTAAATAAGACGG + Intronic
1028636934 7:92999599-92999621 ATGTGAATGAATGAACAGGCTGG - Intergenic
1029167313 7:98601693-98601715 ATGTATTTTAATACACAGAATGG + Intergenic
1029484352 7:100830053-100830075 AAGTAAATAAATAAATAGGCTGG + Intronic
1029780174 7:102723493-102723515 AGGAAAACTAACAAACAGGAAGG + Intergenic
1029808115 7:103017277-103017299 AGGAAAATTAACAAACAGAAAGG + Intronic
1029951583 7:104592313-104592335 AGGAAAATTAAGAAACAGAAAGG - Intronic
1030215896 7:107044128-107044150 ACGAAACATAATAAACAGGATGG + Intergenic
1030510137 7:110473156-110473178 AGGAAAATTAACAAACAGAAAGG + Intergenic
1030526399 7:110660307-110660329 AGGAAAACTAATAAACAGAAAGG - Intergenic
1030758879 7:113325486-113325508 AAGGAAAATAATAAACATGAGGG + Intergenic
1030893602 7:115030276-115030298 AGGAAAACTAATAAACAGAAAGG - Intergenic
1030949999 7:115778348-115778370 ATTTAAATTAAAATACAGCAAGG + Intergenic
1031314523 7:120240020-120240042 AGGAAAACTAACAAACAGGAAGG - Intergenic
1031336458 7:120538891-120538913 AGTTAAATAAATAAACAGGTGGG - Intronic
1031465490 7:122105229-122105251 ATATTAATTAATCAACATGAAGG + Intronic
1031670441 7:124536552-124536574 ATGTAAATAAATAAAAATGAGGG - Intergenic
1031673052 7:124575379-124575401 ATGGAAATGAATAAACTGCAAGG + Intergenic
1031739104 7:125405607-125405629 ATGTAAATTTAAAAACATGTAGG - Intergenic
1032236441 7:130127986-130128008 TTGTAAATTAAAAGACAGGAAGG - Intronic
1032389057 7:131544003-131544025 ATGGGAAATACTAAACAGGAAGG + Intronic
1032636190 7:133711860-133711882 AAATAAATAAATAAACAGGAAGG - Intronic
1032911180 7:136432131-136432153 AGGAAAACTAACAAACAGGAAGG + Intergenic
1032950912 7:136911391-136911413 ATGTAAATTGAGAAACATAATGG - Intronic
1033262164 7:139853336-139853358 ATGTAAAGTGAGAAACAGTAGGG + Intronic
1033855992 7:145561719-145561741 AGGAAAATTAACAAACAGAAAGG + Intergenic
1033999667 7:147397658-147397680 TGGTAAATTAATAAAATGGAAGG + Intronic
1034027806 7:147726049-147726071 ATCTAAAATAATCAACAGTATGG + Intronic
1034715786 7:153239938-153239960 ATGTCACTTTATAATCAGGAAGG + Intergenic
1035493391 7:159299314-159299336 AGGAAAACTAACAAACAGGAAGG + Intergenic
1035882157 8:3255060-3255082 ATGAAAACTAACAAACAGGAAGG - Intronic
1035924632 8:3714389-3714411 ATGTAAGTTAATATATATGATGG - Intronic
1037187113 8:16077647-16077669 AAATAAATTAATAAAGAGCACGG - Intergenic
1037197211 8:16205074-16205096 AGGAAAATTAACAAACAGAAAGG + Intronic
1037546772 8:19931099-19931121 AGGAAAACTAACAAACAGGAAGG + Intronic
1038877459 8:31567045-31567067 AGGAAAACTAACAAACAGGAAGG + Intergenic
1038988291 8:32837408-32837430 ATGTAAATAAGTAATAAGGACGG - Intergenic
1039075016 8:33682345-33682367 ATATAAAATAATATCCAGGATGG - Intergenic
1039116146 8:34093301-34093323 AAGTAAATTGTTAAACAAGAAGG - Intergenic
1039283080 8:36007334-36007356 AGGAAAATTAACAAACAGAAAGG + Intergenic
1039495286 8:37975720-37975742 AAATAAATCAATAAATAGGAGGG + Intergenic
1039629755 8:39097706-39097728 AATTAAATTAATTAAGAGGATGG + Intronic
1039722926 8:40184321-40184343 ATGTGAATAAATAAATAGGTAGG + Intergenic
1040461919 8:47657727-47657749 ATTTCAATTAATAAAAAGGCAGG + Intronic
1041006342 8:53500012-53500034 AAATAAATTAACAAAAAGGAAGG + Intergenic
1041145794 8:54875022-54875044 ATTCAAATTAATAAAGAGAATGG + Intergenic
1041428445 8:57750116-57750138 GTGTAAATAAATAATGAGGAAGG + Intergenic
1041697459 8:60751270-60751292 ATGCATATTAATAAAAATGAAGG - Intronic
1041704132 8:60827570-60827592 CAGTAAATTCATAAACAGTAAGG - Intronic
1042247181 8:66719618-66719640 GTGTTAAATAAGAAACAGGATGG - Intronic
1042476610 8:69255034-69255056 AGGAAAACTAACAAACAGGAAGG + Intergenic
1042698915 8:71589531-71589553 AGGTAAATTTAAAAATAGGAAGG - Intronic
1042763135 8:72291982-72292004 AGGAAAATTAACAAACAGAAAGG + Intergenic
1042792353 8:72622578-72622600 AGGTAAATTAAAAAAAAGAATGG + Intronic
1043058567 8:75471600-75471622 TTGGAAATTAATAAGAAGGAAGG - Intronic
1043077602 8:75721105-75721127 AAGTAAATAAATAAACAAGATGG + Intergenic
1043129316 8:76441629-76441651 AGGAAAACTAATAAACAGAAAGG - Intergenic
1043708569 8:83383391-83383413 ATGGAAATCAATAAAGAGCAGGG + Intergenic
1043722878 8:83568988-83569010 CTGTAAAACTATAAACAGGACGG + Intergenic
1043870209 8:85424033-85424055 AGGAAAACTAACAAACAGGAAGG - Intronic
1044292663 8:90491229-90491251 ATGAAAACTAACAAACAGAAAGG - Intergenic
1044708934 8:95036589-95036611 GTGTAAAGTAATAAATAGAAAGG - Intronic
1044970504 8:97615105-97615127 AAGTAAATAAATAAATAGGCTGG + Intergenic
1045180928 8:99781645-99781667 ATGTAAATTAAAGAACACAAGGG - Intronic
1045293521 8:100853260-100853282 AGGAAAACTAACAAACAGGAAGG + Intergenic
1045349771 8:101328316-101328338 AAATAAATAAATAAATAGGATGG + Intergenic
1045357717 8:101404274-101404296 ATTTAAATAAATAAACACTAAGG - Intergenic
1045448840 8:102298538-102298560 ATGAACATTTATAATCAGGAAGG - Intronic
1045513179 8:102831245-102831267 GTCTAAACTCATAAACAGGAGGG + Intronic
1045570280 8:103361708-103361730 ATGTAATATAATATATAGGAGGG + Intergenic
1046115157 8:109776159-109776181 AGGAAAACTAATAAACAGAAAGG - Intergenic
1046183423 8:110682562-110682584 AAGTAAATAAATAAAAACGAGGG - Intergenic
1047212606 8:122852000-122852022 ATTTAAAAAATTAAACAGGAAGG - Intronic
1047386522 8:124415248-124415270 ATGTAAATCCCCAAACAGGATGG + Intergenic
1047636725 8:126771667-126771689 TTGTTAATTAATAGACAGCAAGG + Intergenic
1047793317 8:128228241-128228263 ATGTACATTGATAAACACTAAGG + Intergenic
1047840417 8:128745424-128745446 AGGAAAATTAACAAACAGAAAGG + Intergenic
1048805175 8:138234085-138234107 ATTTTCATTAATAAAAAGGATGG + Intronic
1050047208 9:1559370-1559392 AGGAAAACTAACAAACAGGAAGG + Intergenic
1050144127 9:2547652-2547674 ATGTAGATTGATTACCAGGAAGG + Intergenic
1050266438 9:3895387-3895409 TTGTAACCTAACAAACAGGAAGG - Intronic
1050509058 9:6375136-6375158 AGGTAAACTAATAAACAGAAAGG + Intergenic
1050994071 9:12191440-12191462 ATGTAAAAAAAAAAAAAGGAAGG - Intergenic
1051434297 9:17014364-17014386 AAGAAAATGAATAAAAAGGAGGG - Intergenic
1051940116 9:22495666-22495688 AGGAAAATTAACAAACAGAAAGG - Intergenic
1053026090 9:34729569-34729591 ATGTACCTTATGAAACAGGAGGG - Intergenic
1053037600 9:34838635-34838657 ATGTACCTTATGAAACAGGAGGG - Intergenic
1053519019 9:38758547-38758569 AATCAAATAAATAAACAGGAAGG - Intergenic
1054791203 9:69258604-69258626 ATTTAAAATAAAAAGCAGGATGG - Intergenic
1055051284 9:71983925-71983947 ATGTAAATAAACAAACATGCTGG + Intronic
1055548647 9:77409251-77409273 AGGAAAACTAATAAACAGAAAGG + Intronic
1055638851 9:78303771-78303793 AGGTAAATTAATAAAGGGCAGGG - Intronic
1055866198 9:80816796-80816818 AGGAAAATTAACAAAGAGGAAGG + Intergenic
1056439935 9:86611225-86611247 ATGAAAACTAACAAACAGAAAGG - Intergenic
1056898286 9:90572255-90572277 ATGTACATACATAAAGAGGAAGG + Intergenic
1057171833 9:92967569-92967591 AAGTAAATAAATAAACCGGAAGG - Intronic
1057203713 9:93158003-93158025 AAATAAATAAATAAATAGGAAGG - Intergenic
1057682854 9:97206095-97206117 AGGCAAACTAATAAACAGAAAGG + Intergenic
1058098129 9:100886696-100886718 AGTTAAAATATTAAACAGGATGG - Intergenic
1058219983 9:102286712-102286734 ATGTAAATAAAAAAACAGAGTGG - Intergenic
1058778120 9:108305431-108305453 ATGTAAATTCTTATACAGGAGGG - Intergenic
1059129654 9:111733194-111733216 ATGTAAATTAGTAAAATGTATGG + Intronic
1059224809 9:112662219-112662241 ATTATAATTAATAATCAGGAGGG + Exonic
1059865126 9:118505459-118505481 AGGAAAATTAACAAACAGAAAGG + Intergenic
1060122856 9:121011531-121011553 ATGTAAATTACTATACACTATGG + Intronic
1061833373 9:133310828-133310850 AGGAAAACTAACAAACAGGAAGG + Intergenic
1062213035 9:135374798-135374820 CTGTAAGTGGATAAACAGGAAGG - Intergenic
1203443759 Un_GL000219v1:34916-34938 ATGAAAACTAACAAACAGAAAGG + Intergenic
1203410496 Un_KI270581v1:3991-4013 AGGAAAACTAATAAACAGAAAGG + Intergenic
1203514567 Un_KI270741v1:153825-153847 ATGAAAACTAACAAACAGAAAGG + Intergenic
1185662210 X:1736370-1736392 AAGTAACTTGATAAACAAGAAGG - Intergenic
1185881378 X:3744408-3744430 AGGTAAATAAATAAATAGGCTGG + Intergenic
1186758651 X:12700181-12700203 ACAGAAATTAAAAAACAGGAGGG + Intronic
1186768682 X:12796175-12796197 ATGAAAATTTAAAAACAGGCTGG - Intronic
1187343734 X:18444280-18444302 ATGTAAATTAAACAACACGAAGG - Intronic
1187554955 X:20342744-20342766 ATGTAAATAATGTAACAGGAAGG + Intergenic
1187624028 X:21090119-21090141 AGGAAAACTAACAAACAGGAAGG + Intergenic
1187667828 X:21633814-21633836 ATGAAAATTAATATACAATAGGG + Intronic
1187848416 X:23565853-23565875 AGGAAAATTAACAAACAGAAAGG - Intergenic
1188085984 X:25901833-25901855 AAGTAAATAAATAAATAGGAAGG - Intergenic
1188685856 X:33069099-33069121 ATGTAAACTAATAAAAACGTTGG + Intronic
1188962992 X:36516238-36516260 ATGTTAATGAATAAACAATATGG + Intergenic
1189618990 X:42815893-42815915 AAGTAAACTAACAAACAGAAAGG - Intergenic
1190209650 X:48434385-48434407 ATGAAAACTAACAAACAGAAAGG + Intergenic
1190494672 X:51017845-51017867 AGGAAAATTAACAAACAGAAAGG - Intergenic
1190920381 X:54845791-54845813 AGGAAAATTAATAAACAGAAAGG + Intergenic
1191016010 X:55811238-55811260 ATGAAAACTAACAAACAGAAAGG - Intergenic
1191117898 X:56869934-56869956 AGGAAAATTAACAAACAGAAAGG + Intergenic
1191171263 X:57449521-57449543 GTGTAAATTAATTAACATAAGGG + Intronic
1191625458 X:63266265-63266287 AGGAAAATTAACAAACAGAAAGG - Intergenic
1191699937 X:64031012-64031034 AAGCAACTTAATATACAGGAGGG - Intergenic
1191984939 X:66969396-66969418 ATGAAAACTAACAAACAGAAAGG + Intergenic
1192033062 X:67535570-67535592 ATGTAAGTTAATAAAAAGAAGGG - Intergenic
1192066292 X:67889149-67889171 AGGAAAATTAACAAACAGAAAGG - Intergenic
1192243297 X:69351695-69351717 AGGAAAATTAACAAACAGAAAGG + Intergenic
1192466234 X:71358450-71358472 AATTAAATAAATAAAAAGGAGGG - Intergenic
1192532589 X:71902256-71902278 AGGAAAACTAACAAACAGGAAGG - Intergenic
1192835409 X:74794165-74794187 AGGAAAACTAATAAACAGAAAGG - Intronic
1192907399 X:75566464-75566486 AGGAAAACTAATAAACAGAAAGG - Intergenic
1192949976 X:76007013-76007035 AGGAAAACTAATAAACAGAAAGG - Intergenic
1193017913 X:76756513-76756535 AGGAAAATTAACAAACAGAAAGG + Intergenic
1193018498 X:76763112-76763134 ATGAAAATAACTAAAGAGGACGG + Intergenic
1193033601 X:76925307-76925329 AGGAAAATTAACAAACAGAAAGG + Intergenic
1193120756 X:77820658-77820680 ATATAAATAAATAAAAAGAATGG - Intergenic
1193334499 X:80272734-80272756 AAGTAAATAAATAAATAAGAAGG + Intergenic
1193334753 X:80274646-80274668 AGGAAAATTAACAAACAGAAAGG + Intergenic
1193409432 X:81144420-81144442 AGGAAAATTAACAAACAGAAAGG + Intronic
1193488631 X:82119541-82119563 AAATAAATAAATAAACAGGAAGG - Intergenic
1193726290 X:85043103-85043125 ATGGAAATTTACAAACAGCAGGG - Intronic
1194515228 X:94844408-94844430 AGGAAAACTAACAAACAGGAAGG - Intergenic
1194642167 X:96414899-96414921 AAATAAATAAATAAACAGAATGG + Intergenic
1195603061 X:106770945-106770967 AGGAAAACTAATAAACAGAAAGG - Intronic
1195696041 X:107668313-107668335 AAATAAATAAATAAAAAGGATGG + Intergenic
1195723487 X:107890307-107890329 AGGAAAACTAATAAACAGAAAGG - Intronic
1196960108 X:120992268-120992290 AGGAAAACTAACAAACAGGAAGG - Intergenic
1197003981 X:121474102-121474124 ATGAAAACTAACAAACAGAAAGG - Intergenic
1197485683 X:127048005-127048027 AAGTAAATCAATATACAGTATGG - Intergenic
1197808629 X:130421266-130421288 ATTTAAGTTAATAATCATGAAGG - Intergenic
1197988165 X:132289664-132289686 AGGAAAACTAACAAACAGGAAGG - Intergenic
1198172234 X:134118115-134118137 AGGAAAACTAACAAACAGGAAGG + Intergenic
1198592501 X:138199218-138199240 AGGGAAATTAATAAACAGAAAGG + Intergenic
1199379069 X:147147200-147147222 AGGAAAACTAACAAACAGGAAGG - Intergenic
1199559535 X:149147981-149148003 ATATAAATTAGTAAAAAGAATGG - Intergenic
1199888573 X:152049823-152049845 TTGTCAATTTATAAGCAGGATGG + Intergenic
1199907590 X:152249813-152249835 AAGTAAATTAAAAGACAGGGAGG - Intronic
1199937725 X:152592199-152592221 AAGTAAATTACTGTACAGGATGG - Intergenic
1200537717 Y:4419584-4419606 AGGAAAATTAAAAAACAGAAAGG + Intergenic
1200856120 Y:7940389-7940411 GTGAAAAATAAAAAACAGGAAGG + Intergenic
1201062059 Y:10055066-10055088 TTGTAAATCAATAAATTGGATGG + Intergenic
1201449281 Y:14093445-14093467 ATTTAACTTAATAAAAAGAAGGG - Intergenic
1201450192 Y:14103080-14103102 AGGAAAACTAACAAACAGGAAGG + Intergenic
1201466160 Y:14283103-14283125 AGGAAAATTAACAAACAGAAAGG + Intergenic
1201527618 Y:14953701-14953723 AGGAAAATTAACAAACAGAAAGG + Intergenic
1201588548 Y:15588811-15588833 ATGTAAAACAAAAAACAGCAGGG - Intergenic
1201633823 Y:16099520-16099542 AGGAAAACTAATAAACAGAAAGG + Intergenic
1201752151 Y:17444947-17444969 AGGAAAATTAACAAACAGAAAGG - Intergenic
1201778706 Y:17695251-17695273 ATGAAAACTAACAAACAGAAAGG - Intergenic
1201800057 Y:17945116-17945138 AGGAAAATTAACAAACAGAAAGG + Intergenic
1201801496 Y:17960840-17960862 AGGAAAATTAACAAACAGAAAGG - Intergenic
1201822850 Y:18210741-18210763 ATGAAAACTAACAAACAGAAAGG + Intergenic
1201899656 Y:19035442-19035464 AGGAAAACTAACAAACAGGAAGG + Intergenic
1202054777 Y:20818425-20818447 ATGAAAACTAACAAACAGAAAGG + Intergenic
1202253875 Y:22901192-22901214 AGGAAAATTAACAAACAGAAAGG - Intergenic
1202333307 Y:23778194-23778216 AGGAAAACTAACAAACAGGAGGG - Intergenic
1202383410 Y:24299604-24299626 AGGAAAACTAACAAACAGGAAGG - Intergenic
1202406865 Y:24534941-24534963 AGGAAAATTAACAAACAGAAAGG - Intergenic
1202463916 Y:25135140-25135162 AGGAAAATTAACAAACAGAAAGG + Intergenic
1202487374 Y:25370517-25370539 AGGAAAACTAACAAACAGGAAGG + Intergenic
1202537462 Y:25891869-25891891 AGGAAAACTAACAAACAGGAGGG + Intergenic