ID: 1104505502

View in Genome Browser
Species Human (GRCh38)
Location 12:129328078-129328100
Sequence GCTCCAGGAAGGGCCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 383}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104505502_1104505506 8 Left 1104505502 12:129328078-129328100 CCAGGCTGGGCCCTTCCTGGAGC 0: 1
1: 0
2: 5
3: 57
4: 383
Right 1104505506 12:129328109-129328131 AGCTCAAATGTCATCTCTGCAGG 0: 1
1: 0
2: 8
3: 65
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104505502 Original CRISPR GCTCCAGGAAGGGCCCAGCC TGG (reversed) Intronic
900331191 1:2135438-2135460 GCGCCAAAAAGAGCCCAGCCTGG - Intronic
900366986 1:2315373-2315395 CCTCCCGGAAGGTCCCAGCCTGG + Intergenic
900509132 1:3050132-3050154 AGTCCAGGAAGGACCCAGCCAGG + Intergenic
900639565 1:3682219-3682241 GCTCCAGGGATGCCCCAGGCAGG + Intronic
900694780 1:4002904-4002926 GATGGAGGAAGGGCCGAGCCGGG + Intergenic
900695444 1:4006633-4006655 TCTTCAAGAAGGGCCCTGCCTGG + Intergenic
900842647 1:5066964-5066986 GTTCCAGGCATGGACCAGCCTGG - Intergenic
900981812 1:6050044-6050066 ACCCCAGGAAAGGCCCAGCCTGG + Intronic
901228643 1:7629795-7629817 GGACCAGAAAGGGCCCAGCCTGG - Intronic
901391600 1:8949657-8949679 GCTGCAGGAAGGGACCAGCAGGG - Intronic
901769383 1:11522705-11522727 GACCCAGCCAGGGCCCAGCCAGG + Intronic
901769388 1:11522716-11522738 GGCCCAGCCAGGGCCCAGCCAGG + Intronic
901769393 1:11522727-11522749 GGCCCAGCCAGGGCCCAGCCAGG + Intronic
901769456 1:11522914-11522936 GACCCAGCAAGGACCCAGCCAGG + Intronic
901830442 1:11888899-11888921 GGCCCAGGAAGGACCCACCCTGG - Intergenic
902626135 1:17677488-17677510 GCTCCAGCCAGTGCCCACCCTGG - Intronic
904352920 1:29920578-29920600 GCTCCAGGCTGGACCCAGCCAGG + Intergenic
904366102 1:30011838-30011860 TCAGCAGGAAGGTCCCAGCCTGG + Intergenic
905653716 1:39672652-39672674 GCTCAGTGAAGGGCCCAACCCGG + Intergenic
906526745 1:46497990-46498012 GCCCCAGGCCGGGCCCTGCCTGG - Intergenic
906690029 1:47786431-47786453 GCTCCAGCTAGGGACAAGCCAGG + Intronic
908473762 1:64469960-64469982 GCTCGGGGACCGGCCCAGCCCGG - Intergenic
911217273 1:95208740-95208762 GATCCAGGAAGGACCCAGCAGGG - Intronic
911539928 1:99146309-99146331 GCTCCATGAAGCGTGCAGCCTGG - Intergenic
912269303 1:108192935-108192957 ACTCCAGGAAGAGTCCAGTCGGG + Intronic
912382344 1:109254337-109254359 GCAGCAGGAATGCCCCAGCCTGG - Intronic
912498765 1:110107978-110108000 GCTCAAGGCAGGCCCCAGGCCGG + Intergenic
915290184 1:154878374-154878396 GCCCAAGGGAGGGCCCAGACCGG + Intergenic
919832732 1:201553214-201553236 ACACCAGGGAGGGCTCAGCCTGG + Intergenic
920263764 1:204707104-204707126 GCCCCTGGCAGTGCCCAGCCAGG + Intergenic
922472025 1:225882592-225882614 GCTCCAAGAAGGGATCCGCCGGG + Intergenic
922553959 1:226519047-226519069 GGTCCAGGATGGGCCCAGAGTGG + Intergenic
922654111 1:227365910-227365932 CCTCCAGAAAGGAACCAGCCTGG - Intergenic
1062982641 10:1737758-1737780 CCTCCAGGAGGGACCCTGCCCGG + Intergenic
1064209871 10:13352729-13352751 GGTACAGGCAGGGACCAGCCTGG - Intergenic
1066997605 10:42578216-42578238 GCTGCAGGAAAGACCCAGCGAGG + Intronic
1069719485 10:70540603-70540625 GCGCCAGGAGGGGCTCAGGCAGG - Intronic
1069832992 10:71292342-71292364 GCTCCAGGTAGTCCCCAGCCAGG - Intronic
1070318493 10:75336691-75336713 CCTCCAAGAAGATCCCAGCCTGG - Intergenic
1070835498 10:79444975-79444997 GCTCCAGCCCGGGCTCAGCCGGG + Intronic
1071420522 10:85492717-85492739 CCTCCAGGGCTGGCCCAGCCGGG - Intergenic
1072722953 10:97792065-97792087 GCTCCGGGGAGCTCCCAGCCTGG - Intergenic
1074976835 10:118587895-118587917 GCTCCTGGAAGGGCCTAGGAAGG + Intergenic
1075778930 10:125004749-125004771 GCTCCAGGCTGAGCCCAGCCTGG + Intronic
1076328173 10:129644577-129644599 GCCCGTGGAAGGGCCGAGCCTGG + Intronic
1076383143 10:130038673-130038695 GCCCCAGGCATGGCTCAGCCTGG - Intergenic
1076462160 10:130654983-130655005 GTTCCAGGCAGGGTCCAGTCGGG + Intergenic
1076576897 10:131475329-131475351 GCTCCAGGAAGCCCCCACGCGGG - Intergenic
1076835023 10:133016679-133016701 CATCCAGGGCGGGCCCAGCCAGG + Intergenic
1077269407 11:1668175-1668197 GCTCCAGGAAGGCGCCTGCGGGG - Intergenic
1077399450 11:2346721-2346743 GCTCCATGAAGGCCCCAGCGTGG + Intergenic
1077461903 11:2714962-2714984 CCTGCAGGAGGGGCCTAGCCAGG + Intronic
1077578944 11:3404713-3404735 GCTCCAGTCAGGTCCCATCCAGG - Intergenic
1079145989 11:17852385-17852407 GCTCTGGGAAGGACCCAGCAAGG + Intronic
1080583577 11:33662974-33662996 GCTCCAGGAAAGGCCCAATTAGG - Intronic
1081595735 11:44458164-44458186 GCCCCAGGCAGGGGCCAGCTGGG + Intergenic
1081596190 11:44461128-44461150 AATCCAGGAAGGGCTCTGCCGGG + Intergenic
1081847602 11:46251987-46252009 GTACCAGGCAGGGCCCAGACAGG - Intergenic
1083308355 11:61772277-61772299 GCTGCCGGGAGGGCCCAGCTTGG - Intronic
1083682819 11:64359146-64359168 GCACCAGGAAGCGCCCGCCCCGG + Intronic
1083822703 11:65181934-65181956 GCTCAGGGCAGGGCCCAACCAGG - Intronic
1083844208 11:65321555-65321577 GTCCCAGGTGGGGCCCAGCCAGG + Exonic
1083859439 11:65412015-65412037 ACCCCAGGTAGGGCCCTGCCTGG - Exonic
1083859472 11:65412195-65412217 GCTCCAGGGAGTGCCCACCAGGG - Exonic
1083861695 11:65423413-65423435 GGCCCAGGCCGGGCCCAGCCTGG + Intergenic
1084105396 11:66977149-66977171 GTGGCAGGAAAGGCCCAGCCTGG - Intergenic
1084235964 11:67788219-67788241 GCTTCTGGAAGGGCCCAGATGGG + Intergenic
1084730605 11:71070895-71070917 GCTCCAGGAGGGTCCCAAGCTGG - Intronic
1084731921 11:71079301-71079323 GCTCCAGGCAGGTCCCAGGCTGG + Intronic
1085038082 11:73311400-73311422 GCTCCAAGAAGCGCCCAGCTCGG + Exonic
1085472595 11:76767797-76767819 GCCCCAGGAGGGGCCCAGGAAGG - Intergenic
1087211184 11:95447371-95447393 GCTCCATGGAGCGCACAGCCCGG + Intergenic
1089095673 11:115918198-115918220 GCTCCAGCAAGGAGCCAGACTGG - Intergenic
1089100208 11:115956748-115956770 TCTTCCGGAAGGGGCCAGCCCGG + Intergenic
1089216371 11:116836984-116837006 GCTAAAGTAAGGACCCAGCCTGG - Exonic
1089861894 11:121597249-121597271 TCTCCAGGGAGAGCCCAGTCGGG - Intronic
1092180358 12:6442686-6442708 ACAAAAGGAAGGGCCCAGCCAGG + Intergenic
1092406875 12:8227595-8227617 GCTCCAGTCAGGCCCCATCCGGG - Exonic
1095687206 12:45050400-45050422 GCTCCAGGAAGTTCCCAAACCGG + Intronic
1096535448 12:52269715-52269737 GATCCAGGAAGGGCACACACAGG - Intronic
1097188915 12:57210285-57210307 GCTGCAGGAAGGGCCCGTCAAGG - Exonic
1100303873 12:93332843-93332865 GCTCAAGGAAGAACACAGCCAGG - Intergenic
1101848780 12:108385778-108385800 GCTCTGGGAAGGGCACAGTCAGG + Intergenic
1102019750 12:109674003-109674025 GCCCCCAGCAGGGCCCAGCCTGG - Intergenic
1102217386 12:111171007-111171029 GCGCCAGGTAGGGTCCAGCAAGG + Intronic
1102519723 12:113470858-113470880 GCTCCAGAGGGGGCCCAGCGAGG - Intronic
1102960802 12:117092213-117092235 GCTCAAAGAAGGACACAGCCTGG + Intronic
1103450918 12:121028314-121028336 GCTCCAGGATGGGCCCTGACTGG + Intronic
1103897992 12:124286529-124286551 GCTCCAGAAAGGGCAGAGTCTGG - Intronic
1104156420 12:126137040-126137062 GCTCCATGATGAGCCCAGACAGG + Intergenic
1104505502 12:129328078-129328100 GCTCCAGGAAGGGCCCAGCCTGG - Intronic
1104843763 12:131836728-131836750 GCTCCAGAAAGGTACAAGCCAGG - Intronic
1105883714 13:24624889-24624911 GCACCAGGCCTGGCCCAGCCAGG + Intergenic
1106138399 13:26991389-26991411 ACCCCAGGATGGGACCAGCCAGG - Intergenic
1106248669 13:27968326-27968348 GCGCCAGGAGGGGCACGGCCCGG - Intronic
1106555601 13:30805755-30805777 GCCCCAGGCTGGGCCCAGCCAGG - Intergenic
1107992889 13:45833862-45833884 CCTCCAGGAAGAGCTCAGCCAGG + Intronic
1108622415 13:52196783-52196805 GCTGCAGGATGGGCGCAACCAGG + Intergenic
1113292181 13:108919245-108919267 GGGGCAGGAAGGGCCCAGCCAGG - Intronic
1113437778 13:110306955-110306977 GCTCCACGAGGAGCACAGCCGGG - Exonic
1113976924 13:114234860-114234882 GCTCCAGGCAGGCCCCGCCCCGG - Intergenic
1115308082 14:31952322-31952344 GCTTCAGGAAGGGCGAAACCAGG + Intergenic
1116855032 14:49944642-49944664 GCTCCAAGAAGGCCACTGCCTGG + Intergenic
1117601503 14:57380736-57380758 GCTTCAGGCTGGGCCTAGCCAGG + Intergenic
1118374721 14:65166921-65166943 GCTCCAAGAAAGCCACAGCCAGG + Intergenic
1118535070 14:66753373-66753395 GCTCCAGGCTGGGCTCAGCTGGG - Intronic
1119406285 14:74401641-74401663 GCCCCAGGGAGGGGCCAGCCGGG + Intergenic
1121036161 14:90705422-90705444 GCTCTAGGAGGGGCTGAGCCAGG + Intronic
1121098535 14:91234100-91234122 GCTCCAGGACCGGCCGGGCCAGG - Exonic
1121298484 14:92850039-92850061 CCAACAGGAAGGGTCCAGCCAGG - Intergenic
1122791913 14:104187566-104187588 TCACCAGGGAGGCCCCAGCCTGG - Intergenic
1122851050 14:104531344-104531366 GTCCCAGGAAGGGCCCGTCCAGG + Intronic
1122855106 14:104556363-104556385 GCTCCAGCAAAGCCCAAGCCGGG - Intronic
1122887953 14:104718923-104718945 GCTCCAGGAGGGCCCCGGCTGGG - Exonic
1122974385 14:105165107-105165129 GCTCCAGAGATGGGCCAGCCAGG + Intronic
1124212092 15:27771464-27771486 TCTCCAGGCAGCGCCCAGCTGGG + Intronic
1125576642 15:40760318-40760340 GCTCCTGGAAGAACCCATCCAGG + Intergenic
1126211184 15:46103029-46103051 GCTCCAAGAAGGTCCCAGGATGG - Intergenic
1127260405 15:57323079-57323101 GCTCCTGCAGGGGTCCAGCCAGG + Intergenic
1129393805 15:75233681-75233703 GGTCCAGGTGGGGCCCTGCCTGG + Intergenic
1129691146 15:77714312-77714334 GCTGCAGGAAGGGCCAAGTAGGG - Intronic
1129876647 15:78979738-78979760 GCACCAGGACTGGCCCAGGCTGG - Intronic
1130087743 15:80792249-80792271 ATTCCAGGAAGGGCCCAGTTAGG + Intronic
1130320731 15:82838523-82838545 GCTACAGGGAGGGCCCAGGCAGG + Intronic
1130960120 15:88653531-88653553 GCTCCAGGAAAAGCCCAGCCTGG - Intronic
1130966512 15:88701286-88701308 GTCCCAGGAAGGAGCCAGCCAGG - Intergenic
1131187264 15:90285540-90285562 GCGACAGGATTGGCCCAGCCGGG + Intronic
1131360354 15:91785075-91785097 GCTCCAGGGAGGGCCAGGGCAGG + Intergenic
1131402011 15:92132804-92132826 GCTCCATTATGGGCCCAGGCAGG + Intronic
1131458995 15:92605373-92605395 GTTTCAGGATGGGCCCAGACCGG - Intergenic
1131553583 15:93378152-93378174 CCTCAAGGTAGGGCCCATCCAGG - Intergenic
1131837813 15:96408548-96408570 GCTCCAGGAAGGCAGCTGCCGGG + Intergenic
1131966459 15:97849154-97849176 TCTCTAGCAAGGGCTCAGCCTGG + Intergenic
1132666308 16:1082798-1082820 GCTCCAAGCAGGAACCAGCCAGG - Intergenic
1133347544 16:5080805-5080827 GCTCCAGTCAGGCCCCATCCGGG - Intronic
1134797729 16:17057022-17057044 GCTCCAGGCTTGCCCCAGCCTGG - Intergenic
1134807915 16:17141329-17141351 ACTCCAGGAAGAGCCGATCCAGG + Exonic
1135161909 16:20103986-20104008 GGTCCAGGAAGGGCCCATTCAGG + Intergenic
1137231521 16:46571452-46571474 GCACCAGCGAGGGCCCAGGCGGG + Intergenic
1137249690 16:46732558-46732580 GCTCCAGCAGCTGCCCAGCCAGG - Exonic
1137774269 16:51042442-51042464 GTCCCTGGATGGGCCCAGCCTGG + Intergenic
1137774271 16:51042445-51042467 GCACCAGGCTGGGCCCATCCAGG - Intergenic
1138440852 16:57034219-57034241 GCTCCAGGAAGGCCCTCACCTGG + Exonic
1139959347 16:70708832-70708854 TCTCCAGGCAGGGGCCAGACCGG - Intronic
1139963972 16:70735218-70735240 GGACCAGAAAGGGGCCAGCCTGG - Intronic
1140113631 16:72023535-72023557 GCACCAGGGAGGCCCCTGCCCGG - Exonic
1141163549 16:81645234-81645256 GAGCCAGGGAGGACCCAGCCCGG - Intronic
1141566121 16:84903224-84903246 GGTCCAGGAAGGGGCCAGGCTGG - Intronic
1141624191 16:85252905-85252927 GCTCCACGAAGGCCCCTGCAAGG - Intergenic
1142145865 16:88492731-88492753 GCTCCACCATGGGTCCAGCCAGG + Intronic
1142366718 16:89654044-89654066 GCTCCCCGAAGGCCCCAGGCAGG - Intronic
1142696050 17:1634580-1634602 GCTCCCGGAGGGGCCCAGGAAGG - Exonic
1143115571 17:4580150-4580172 GCTCCAAGACGTGCCCAGCATGG + Intergenic
1143348270 17:6266485-6266507 GCCCCAGGCAGGGCTGAGCCTGG + Intergenic
1145397231 17:22505814-22505836 GCTCCTGGGAGGACCTAGCCAGG + Intergenic
1145909627 17:28534949-28534971 GGTCCAGGAGGGGCCAGGCCTGG - Exonic
1146209415 17:30930457-30930479 GCCTCAGGAAGGACCAAGCCAGG + Intronic
1147034893 17:37672543-37672565 GCTCCAGCTAGGGCCCAGTGGGG - Intergenic
1147163690 17:38582168-38582190 GCTCCAGGAAGGAAGCAGCTGGG - Intronic
1147611427 17:41803820-41803842 TCACCAGCAAGGGCTCAGCCTGG - Intronic
1147630123 17:41924829-41924851 ACTCTGGGAAGGGGCCAGCCTGG - Intronic
1147769330 17:42856789-42856811 GCTCCAGGCTGGGCCATGCCTGG - Exonic
1147914801 17:43879880-43879902 GCTCCAGGTAGCGCCCAGCACGG + Exonic
1148197189 17:45722418-45722440 GGGCCAGGAAGAGCCCAGCTGGG - Intergenic
1148219938 17:45854102-45854124 ACTGCAGGCAGGGCCAAGCCTGG - Intergenic
1148389481 17:47260630-47260652 GCTCCAGCAAAGGCTCAACCTGG - Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1148849505 17:50547931-50547953 GCTCCAGGAAGGGCCGGGGGAGG + Intronic
1149328368 17:55556059-55556081 GCACCAGGAAGCTCTCAGCCAGG - Intergenic
1149532425 17:57406286-57406308 CCACCCGGAAGAGCCCAGCCTGG + Intronic
1149535219 17:57428435-57428457 ACTCCAGCATGGGTCCAGCCTGG - Intronic
1150281690 17:63932631-63932653 ACTCCCCGAAGGGCCGAGCCCGG + Intergenic
1151429512 17:74052961-74052983 GAACCAGGCAGGTCCCAGCCCGG - Intergenic
1151467690 17:74298200-74298222 GCTCCAAGAAGGGCCCCTCTAGG + Intronic
1151944779 17:77313565-77313587 CCTCCAGGCTGGCCCCAGCCTGG - Intronic
1152135151 17:78499346-78499368 ACTCCAGGAAGTCCCCATCCTGG - Intronic
1152299017 17:79484659-79484681 GCTCCAGGAAGGGGCTGGCCTGG + Intronic
1152368426 17:79870548-79870570 GCTCCAGCCAGGGGCCAACCTGG + Intergenic
1152570697 17:81120068-81120090 CCTCCAGGAAAGCCCCACCCGGG - Exonic
1152612454 17:81322515-81322537 GCCCCATGGTGGGCCCAGCCGGG + Intronic
1152722594 17:81930173-81930195 TCTCCAGGCAGGGCCCTCCCAGG + Intergenic
1154194390 18:12254881-12254903 CTTCCAGGAGGGGCCAAGCCTGG - Intronic
1154412267 18:14147915-14147937 GTGCCAGGAAGGGCCCGGCAGGG + Intergenic
1156494827 18:37518784-37518806 GCTCCAGGGATGGCCCAGTGTGG + Intronic
1157422605 18:47559196-47559218 CCTCCAGGAAGGTCCCAGGGAGG + Intergenic
1158441353 18:57476997-57477019 GCTCCAGGAAGGCCCCATTTGGG - Exonic
1158546828 18:58404341-58404363 GCTGCATGAACGGCCCAGCCTGG + Intergenic
1160597669 18:79988427-79988449 GCGCCAGGGAGGGCCCAGCGAGG + Exonic
1160917789 19:1506001-1506023 GCTCCTGCAGGGGCTCAGCCAGG + Exonic
1160988900 19:1852649-1852671 GCTCCAGACAGGCCCCTGCCAGG + Exonic
1161275306 19:3412995-3413017 GGGGCTGGAAGGGCCCAGCCTGG + Intronic
1161394031 19:4035290-4035312 GGTCCATGCAGGGCCCAGGCTGG - Intronic
1161661045 19:5546543-5546565 GCTCCAGAGAGGACTCAGCCTGG + Intergenic
1161666174 19:5578345-5578367 GCGGCAGGAGGGGCCCAACCGGG + Intergenic
1161824366 19:6552204-6552226 GCTGCAGGGAGGGCCCAGGGAGG - Intergenic
1162056327 19:8066173-8066195 GCTCCAGGATGCGCTCGGCCCGG + Exonic
1162779336 19:12998507-12998529 GCTCCAGGAACCGCCCCACCCGG - Intronic
1163550919 19:17966238-17966260 GCTCCAGGAAGCCCCCAGGCTGG + Intronic
1163737093 19:18988201-18988223 GTTCCCTGAGGGGCCCAGCCAGG - Intergenic
1163795428 19:19335157-19335179 GCTCCAGGAAGGGCTGACACAGG - Intronic
1164393871 19:27847250-27847272 GCTACTGGAGGGGCCCAGTCAGG - Intergenic
1164586159 19:29477451-29477473 GCTCCAGTAAGGGTCCAGGGAGG - Intergenic
1164775981 19:30854157-30854179 GTTCGAGGCAGGGCCCAGGCAGG + Intergenic
1165448185 19:35868354-35868376 GCCCCATGAAGGGCCCAGCCAGG - Intronic
1166111902 19:40627709-40627731 GCTCCTCGTAGGGCTCAGCCAGG - Exonic
1166231250 19:41426863-41426885 CCTCCAGAGAGGGCCCAGCCAGG + Intronic
1166283645 19:41810642-41810664 GGTGCAGGGTGGGCCCAGCCAGG + Intronic
1166410691 19:42554054-42554076 GGTGCAGGGTGGGCCCAGCCAGG - Intronic
1166716967 19:44974700-44974722 GCCCAGGGAAGGGCCAAGCCTGG - Intronic
1167032924 19:46975403-46975425 GCACCAGGGAGGGCCCAGCCTGG + Intronic
1167503565 19:49860288-49860310 ACTCCTGGAGGGGCCCAGCCCGG - Exonic
1168407716 19:56119690-56119712 GCACCAGGGAGGGGCCAGGCCGG + Intronic
925586127 2:5466065-5466087 TCTCCAGAAAGGGCCAAGCCAGG - Intergenic
925839525 2:7978694-7978716 ACTTCAGGCAGGGCCCAGGCAGG + Intergenic
926268078 2:11344338-11344360 GCTCCCGGCAGGGCCGGGCCGGG - Exonic
927442393 2:23128410-23128432 GTGTCAGGAAGGACCCAGCCTGG - Intergenic
928164382 2:28959106-28959128 GGTCCAGGGAGGGTACAGCCAGG - Intronic
928986975 2:37191445-37191467 GCTCCACGGCTGGCCCAGCCTGG + Intronic
929121029 2:38484246-38484268 GCCCCATGAAGGCCTCAGCCAGG - Intergenic
930543184 2:52733256-52733278 GTTATAGCAAGGGCCCAGCCAGG - Intergenic
930713549 2:54571939-54571961 ACTCCAGGAAGGGCTTAGGCTGG + Intronic
931093919 2:58918427-58918449 TTTCCAGGAAAGGACCAGCCTGG + Intergenic
932321735 2:70827457-70827479 GCTCCAGGTAGCCCCCAGCAGGG - Intergenic
932421861 2:71605939-71605961 GCTCCAGGCAGGGGGCAGCCAGG - Intronic
932887228 2:75559391-75559413 GGTACAGGAAGGCCCCAGCCAGG + Intronic
933771774 2:85749197-85749219 GCTCCAGAAAGGGCCAACCAGGG - Intergenic
934515636 2:94984869-94984891 GCTCCATGAAGGGCACACACGGG - Intergenic
934619602 2:95796141-95796163 TCTCCAGGCAGAACCCAGCCTGG - Intergenic
934641286 2:96028416-96028438 TCTCCAGGCAGAACCCAGCCTGG + Intronic
936623092 2:114120410-114120432 AATCAAGGAAGTGCCCAGCCAGG - Intergenic
937343947 2:121111263-121111285 GCATCAGGATGGGCCCAGACTGG - Intergenic
937418546 2:121736811-121736833 GCGACAGGATTGGCCCAGCCGGG + Exonic
938092772 2:128444200-128444222 GCCCCAGGAACAGCCCAGCGAGG - Intergenic
938602479 2:132856166-132856188 GTCCCAGCAAGGGGCCAGCCAGG - Intronic
942571148 2:177315712-177315734 GGTCTAGGAAGAGCCCAGCTGGG - Intronic
946016330 2:216606892-216606914 GCGACAGGAAGGGCTCAGCGAGG - Intergenic
946175821 2:217921445-217921467 GCTGGAGGAAGGGCTCAGCTAGG - Intronic
946365345 2:219245571-219245593 ACTCCTGGCAGGGCCCACCCCGG - Intronic
946875537 2:224126120-224126142 GTTCCCAGAAAGGCCCAGCCTGG + Intergenic
947348711 2:229220567-229220589 GCAGCAGGCAGGGCCCAGCCTGG + Intronic
947389872 2:229628057-229628079 GGTCCAGGAAGGCCCTCGCCTGG + Intronic
947399097 2:229714532-229714554 GCTGCAGGAGGCGCCCGGCCCGG - Exonic
947722856 2:232380073-232380095 GCTGTGGGAATGGCCCAGCCTGG - Intronic
947727204 2:232408154-232408176 GCTGTGGGAATGGCCCAGCCTGG - Intronic
947753141 2:232543138-232543160 TCCCCAGGCAGGGCCCACCCCGG - Intronic
947968370 2:234301469-234301491 GCTCTCAGCAGGGCCCAGCCGGG + Intergenic
947987554 2:234462192-234462214 TCCCCAGGTAGGGCCCAGCCTGG + Intergenic
948207342 2:236168976-236168998 GCTCACGGGAGGGCCCAGCCCGG - Intergenic
948465598 2:238150289-238150311 GCTTCAGGAAGAGCCCGGGCGGG - Intronic
948765167 2:240215771-240215793 GGGCCAGGGAGGCCCCAGCCAGG - Intergenic
1168863009 20:1059663-1059685 GCCCCAGGAAGGGCATGGCCTGG + Intergenic
1170665741 20:18384649-18384671 GGACCAGGAGGGGCCCAGCCTGG - Intronic
1171412918 20:24958624-24958646 GCTGCAGGGCGGGCCCAGCAGGG + Intronic
1171457578 20:25280683-25280705 GCCCAGGAAAGGGCCCAGCCCGG - Intronic
1173168942 20:40706794-40706816 GCACCAGGAATGGTCCAGGCAGG - Intergenic
1173501725 20:43558861-43558883 CCCCCAGGCAGGGCCCATCCAGG + Intronic
1173501728 20:43558864-43558886 GCTCCTGGATGGGCCCTGCCTGG - Intronic
1173670327 20:44794328-44794350 GCCCCAGAAAAGGCCCAGGCTGG - Intronic
1173837379 20:46134823-46134845 GCTCCAGGAGAAGCCCAGCAAGG + Intergenic
1174404828 20:50296326-50296348 GGTCCAGGCTGGACCCAGCCTGG - Intergenic
1174884426 20:54316491-54316513 GCTCCAGGATGGTCCCAAGCTGG - Intergenic
1175262484 20:57683462-57683484 GCTCCAGGAAGCTCCCAAGCAGG - Intronic
1175735878 20:61386601-61386623 TCTCTAGGAAGGGCAGAGCCAGG - Intronic
1175895303 20:62333328-62333350 GGTCCAGGAAGCCCCCACCCCGG + Intronic
1176087222 20:63303686-63303708 GCGCCAGGGAGTGACCAGCCAGG - Intronic
1176168860 20:63688197-63688219 GATCCAGGATGGGCACAGCTGGG - Intronic
1176860741 21:14010342-14010364 GTGCCAGGAAGGGCCCGGCAGGG - Intergenic
1178111810 21:29376574-29376596 ACTCCAAGAAGGAACCAGCCTGG - Intronic
1178270628 21:31186393-31186415 GCTCCAGGAAGAACCCCCCCAGG + Intronic
1178351292 21:31874198-31874220 GCTCGTGGAAGGGCGCCGCCTGG + Intronic
1178891304 21:36523077-36523099 GGATCAGGAAGGGTCCAGCCAGG - Intronic
1179301869 21:40119032-40119054 ACTCCAGGAAGGACCCAGGCAGG - Intronic
1180183754 21:46129511-46129533 GTGGCAGGGAGGGCCCAGCCCGG - Intronic
1180226704 21:46397752-46397774 GCTGCAGCACAGGCCCAGCCCGG - Intronic
1181050737 22:20237213-20237235 ACTCCAGGCATGGCCCAGCAAGG + Intergenic
1181169090 22:20998291-20998313 TCCCCTGGAAGGGGCCAGCCTGG - Exonic
1181281958 22:21726726-21726748 GGTGCAGGAAGGGGCCAGCAAGG - Intronic
1181559319 22:23690884-23690906 GTCCCAGGAGGGGCCCAGGCAGG - Exonic
1181845899 22:25708356-25708378 GCTCCTGCACAGGCCCAGCCAGG - Intronic
1182261098 22:29073372-29073394 GTCCCAGGAAGGGACCATCCCGG - Intronic
1182428697 22:30288144-30288166 GCCCCAGGGAGGGCCCAGGCTGG + Intronic
1183107927 22:35627942-35627964 GCTCCAGGGAGGGCCCCCCAGGG + Intronic
1183343336 22:37294120-37294142 GCTCCAGAAAGACACCAGCCGGG + Intronic
1184229601 22:43151567-43151589 GCTCCGGGAAGGGCACTGCCTGG - Intronic
1184466259 22:44670174-44670196 GGACCAAGAAGGGCCCATCCTGG + Intronic
1184467639 22:44678165-44678187 GGTGCAACAAGGGCCCAGCCAGG - Intronic
1184479609 22:44738821-44738843 GCCCCAGGCAGGGCTCAGCTGGG + Intronic
1184511320 22:44934919-44934941 GCTCCTGGAAGGTCTCAGCGAGG - Intronic
1184689552 22:46111225-46111247 ACTCCAGGCAGGCCCCAGGCTGG - Intronic
1184691503 22:46119400-46119422 AGTCCAGGAAGGGCCCAGCCAGG + Intergenic
1185046545 22:48531351-48531373 GCTCCAGGAAGGGGACAGGCAGG - Intronic
1185231761 22:49687789-49687811 GCTCCAGGAGCAGCCCAGGCTGG - Intergenic
1185253338 22:49817166-49817188 GCTCCAGGAATGGCTCAGAAGGG + Intronic
1185339835 22:50286339-50286361 GCCCCAGGGGAGGCCCAGCCTGG - Intronic
1185376321 22:50484131-50484153 GGTCCTGGAAGCGCCCACCCAGG + Exonic
949134086 3:541507-541529 GTGCCAGGATGGGCCCAACCAGG - Intergenic
950584568 3:13883109-13883131 GCTCCAGGAGGGGCAGAGACTGG - Intergenic
950858949 3:16130558-16130580 GCTGCAGGAAGTGCCCAACATGG - Intergenic
950904357 3:16524395-16524417 GATTCAGGAAGGGCTCAGCTGGG + Intergenic
953251261 3:41247303-41247325 GCTCCAGGCAGGAGCCAGGCAGG - Intronic
953427309 3:42805475-42805497 GCTCCAGGAAGGATCCCGCGGGG - Intronic
953432025 3:42847785-42847807 GTTCCAGGAAGGGCTGAGCCTGG - Intronic
953476779 3:43212006-43212028 GCTCCAAGATGGGACAAGCCTGG + Intergenic
953919339 3:46941164-46941186 GCACCTGGCAGGGCCCAGCTTGG + Intronic
954135806 3:48581604-48581626 TCTCCAGGAAGAACCAAGCCGGG + Exonic
954136114 3:48582955-48582977 GAACCAGAAAGGGCACAGCCAGG + Intronic
954306326 3:49727394-49727416 GGTCCAGGCAGGACTCAGCCCGG + Exonic
954410102 3:50366781-50366803 ACTCCAGGAAGGGCACTGCTGGG + Intronic
954445126 3:50542275-50542297 GCTCCAGGAAGGGTCCTCTCTGG + Intergenic
954881487 3:53838664-53838686 GCTCCATGATGGGCTCTGCCAGG - Intronic
956158038 3:66318450-66318472 GCTGGAGCAAGGGCCCACCCGGG - Intronic
957051929 3:75418017-75418039 GCTCCTGGAAGGGCCCAGATAGG + Intergenic
958562172 3:95760172-95760194 GCAGCAGGAAAGGCACAGCCAGG - Intergenic
960147552 3:114219045-114219067 TCTCCACGAAGGGGACAGCCAGG - Intergenic
965803946 3:172523348-172523370 GGTCCAGGGGGGACCCAGCCTGG - Exonic
968589044 4:1448673-1448695 GCCCCAGGCAGGGCCCACACAGG - Intergenic
968601798 4:1513112-1513134 GCCCCAGGAGGGTCCCAGCACGG + Intergenic
968649348 4:1754250-1754272 GCACCCGGGAGAGCCCAGCCAGG + Intergenic
968760709 4:2441754-2441776 GCTCCAGGAAGAGGCCAGCCTGG + Intronic
968994730 4:3938392-3938414 GCTTCTGGAAGGGCCCAGATGGG + Intergenic
969243766 4:5919191-5919213 GCTCCGGAAATGGCACAGCCAGG - Intronic
969333740 4:6494756-6494778 ACTCCAGGAAGGGCCAAGTATGG - Intronic
969418003 4:7073680-7073702 GCTCCAGGAACATCCCAGACAGG + Intergenic
969579167 4:8054053-8054075 GCTGCAGGATGGGGGCAGCCAGG - Intronic
969759268 4:9170402-9170424 GCTTCTGGAAGGGCCCAGATGGG - Exonic
971503270 4:27339613-27339635 ATTCCAGGAAGTGCCAAGCCGGG - Intergenic
972716918 4:41655817-41655839 GCTGCAGGAAGGGCCAGGCATGG - Intronic
973741123 4:53920361-53920383 GCCCCAGGAAAGGGCCAACCCGG + Intronic
975831383 4:78372794-78372816 GCTCCACGCAGGCCCCATCCTGG - Exonic
983348938 4:166562151-166562173 GGTCCAGGATGGTCCTAGCCTGG + Intergenic
985995119 5:3593463-3593485 TCTCCAGGTGGGGCCCAGCCAGG + Intergenic
986353467 5:6902316-6902338 GCCACAAGAAGGGCCCAGCCAGG - Intergenic
986462199 5:7983642-7983664 GCGCTACGCAGGGCCCAGCCTGG + Intergenic
992086839 5:73285100-73285122 ACCCCAGGAAGAGCCCAGTCAGG + Intergenic
993587208 5:89746239-89746261 TCTCCAGCAAGGGCACAGACTGG - Intergenic
996416533 5:123216832-123216854 GATCCATGAAGGGCCAGGCCAGG + Intergenic
996738258 5:126776889-126776911 GGTCCGGGAACCGCCCAGCCGGG + Intronic
996967283 5:129321128-129321150 TCTCCATGAAGGCCCCACCCTGG + Intergenic
997890725 5:137673854-137673876 GCTCTGGGAGGGGCCCAGGCAGG + Intronic
998163194 5:139825164-139825186 GCTCCATGAAGGGCACACACAGG + Intronic
998292173 5:140926361-140926383 GCGGCAGGAAGAGCCCAGCTGGG + Intronic
1001396749 5:171423389-171423411 GCTGCGTGAAAGGCCCAGCCCGG - Intronic
1001406783 5:171482303-171482325 GCTCCTTAAAGGGGCCAGCCAGG + Intergenic
1001528842 5:172448176-172448198 GCAGCAGCATGGGCCCAGCCTGG + Intronic
1001598601 5:172914586-172914608 GCTCCTGGAGGTCCCCAGCCCGG + Intronic
1001846146 5:174923107-174923129 GCAACAGGATTGGCCCAGCCGGG - Intergenic
1002102126 5:176862860-176862882 GCGCCAGGCAGGGCCAATCCGGG + Intronic
1002272245 5:178080208-178080230 TCTCCAGGAGGGGCCAGGCCTGG - Intergenic
1003235556 6:4292567-4292589 CCACCATGAAGGTCCCAGCCAGG + Intergenic
1007406365 6:41638316-41638338 GCTCCTGGCTGGGCCAAGCCCGG + Intronic
1008369426 6:50715559-50715581 ACTCCTGCCAGGGCCCAGCCTGG + Exonic
1008490833 6:52085474-52085496 CATCCAGGAAGGGACCAGCAGGG - Intronic
1012490778 6:99780437-99780459 GCTCTTCCAAGGGCCCAGCCTGG - Intergenic
1016415303 6:143826521-143826543 TCTCCAGGAAGATCCCAGGCAGG + Intronic
1017033808 6:150249094-150249116 ACTCAAGGAAGGGCCACGCCAGG + Exonic
1018632926 6:165835821-165835843 GACCCAGGAAGGGCAAAGCCAGG + Intronic
1018724309 6:166598944-166598966 TGCCCAGGCAGGGCCCAGCCCGG + Intronic
1019073942 6:169371619-169371641 GCACCAGGAAGGGCCCTGAGGGG + Intergenic
1019292064 7:255750-255772 GCACCAGGCAGAGCCCGGCCCGG + Intronic
1019302962 7:318181-318203 GCCCCAGGCCAGGCCCAGCCAGG + Intergenic
1019523328 7:1470132-1470154 GCCCAAGGGAGAGCCCAGCCTGG + Intergenic
1019729448 7:2622336-2622358 GCCCCCGGAAGGGGACAGCCTGG + Intergenic
1020319002 7:6926728-6926750 GCTCCAGTCAGGCCCCATCCGGG - Intergenic
1022467058 7:30659124-30659146 GCTTCTGGAAGGGCTCAGCTTGG + Intronic
1023548500 7:41344166-41344188 GTTCCAGGAAGGGCACAGAGAGG + Intergenic
1023805783 7:43872041-43872063 GCTCCAGGAAGGGTGCAGATGGG - Intronic
1023839474 7:44088295-44088317 GCAGCGGAAAGGGCCCAGCCTGG - Intergenic
1024512166 7:50212865-50212887 GCTTAAGGCAGAGCCCAGCCGGG + Intergenic
1026533977 7:71224776-71224798 GCCCCAGGTGGAGCCCAGCCTGG + Intronic
1029420554 7:100469683-100469705 GCTCCAAGGGGGGCCCAGCTGGG - Intronic
1029737695 7:102473762-102473784 CCTCCAGGAAGGGCCTGGCGGGG - Intronic
1032020548 7:128405338-128405360 GCCCCAGGAGAGGCCCAGCCAGG - Intronic
1032470751 7:132177307-132177329 GGCCCATGAAGGGCCCAGCTGGG + Intronic
1033227023 7:139570486-139570508 GCTCCATGCTGGGCACAGCCGGG - Exonic
1033457011 7:141511848-141511870 GCTCCAGGAAAGGAGCGGCCAGG + Intergenic
1034406176 7:150903745-150903767 GCTCCAGCCAGGGCCCAGGGTGG + Intergenic
1034451050 7:151137490-151137512 TCTCCAGCAGGGGCTCAGCCAGG + Intronic
1034503394 7:151466623-151466645 GCTTCAGGAAGGCCCCAGGTTGG - Exonic
1034957590 7:155344544-155344566 GCCCCAGGAAGGCCCCAGGAAGG - Intergenic
1034964374 7:155382487-155382509 GCTGCAGGACGGGGCCAGCCAGG - Intronic
1035024542 7:155817250-155817272 GCTCCATGCCAGGCCCAGCCGGG - Intergenic
1035171453 7:157019534-157019556 GCTGCAGGAAGGGCCCTCCCAGG + Intergenic
1035374087 7:158395870-158395892 GCGCCATGGAGGGCCCAGCCTGG + Intronic
1035542845 8:455277-455299 GTGCCAGGCAGGGACCAGCCAGG + Intronic
1036381412 8:8238432-8238454 GCTTCTGGAAGGGCCCAGATGGG - Intergenic
1036441948 8:8789456-8789478 GCTGAAGGGAGGGTCCAGCCTGG + Intronic
1037835752 8:22213901-22213923 GGTCCAGGGTAGGCCCAGCCAGG + Intergenic
1037882613 8:22580307-22580329 GCTCCAGCAAGCCCCCTGCCTGG + Intronic
1037885721 8:22595145-22595167 GCTGCCGGCAGGGACCAGCCAGG - Intronic
1038236702 8:25765730-25765752 GCTCCTGAAAAGGCACAGCCAGG - Intergenic
1039483990 8:37897717-37897739 GCTCCGTCAAGGGCCCACCCGGG + Intronic
1039888486 8:41669012-41669034 GCTCCTGGAAGGTGCTAGCCTGG + Intronic
1039912553 8:41836461-41836483 TGTCAAGGAAGGGCCCAGCACGG - Intronic
1039958043 8:42222114-42222136 GCTCCAGGTGGGTCTCAGCCAGG - Intergenic
1040609033 8:48964227-48964249 GCACCATGAGGGGCCCATCCGGG + Intergenic
1048302239 8:133260245-133260267 GGGCCAGGAGGAGCCCAGCCAGG + Intronic
1048994940 8:139788459-139788481 GCACCAGGAAGGGCCAGGCTGGG - Intronic
1049098468 8:140562677-140562699 GCCCCAGGGAGGACGCAGCCTGG + Intronic
1049203087 8:141351290-141351312 CCTCCAGGAGAGGCCCAGCTGGG + Intergenic
1049211572 8:141389021-141389043 CCTACAGGAGGGGCCCAGGCTGG - Intergenic
1049214362 8:141400989-141401011 GCACCAGGAAGGGGCAAGCCGGG + Intronic
1049250831 8:141588189-141588211 GCCCCAGGAGGGTGCCAGCCTGG + Intergenic
1049317427 8:141976805-141976827 GCTCCAGGGAGGATCCACCCTGG - Intergenic
1049496962 8:142940035-142940057 GGTCCAGCAAGGACCAAGCCTGG - Intergenic
1052295431 9:26892379-26892401 GCTCCAGGAAGCGGCCAGAGGGG + Intronic
1053206572 9:36191146-36191168 GCGCCAAGAAGGCCGCAGCCGGG - Exonic
1056380457 9:86052857-86052879 CCTCCAGGAAAGGGCCAGCCAGG + Intronic
1056538571 9:87552118-87552140 ACCCCAGGCAGGGCCCTGCCTGG - Intronic
1056767515 9:89454159-89454181 CATCCAGGAAGATCCCAGCCTGG + Intronic
1057266880 9:93623038-93623060 GCTGCAGTGAGGGCACAGCCTGG + Intronic
1057269078 9:93636981-93637003 GCCACAGGAAGGACACAGCCGGG + Intronic
1057793726 9:98141263-98141285 GCTCCAGGTACCGCCCTGCCAGG - Intronic
1057818823 9:98315727-98315749 GCCACATGAAGGGTCCAGCCTGG + Intronic
1057826611 9:98376926-98376948 CCTTCAGAAAGGGCCCAGACGGG - Intronic
1059330244 9:113530529-113530551 GCTGGAGGAAGAGCCTAGCCTGG - Intronic
1059656810 9:116365106-116365128 CCTCAGGGAAGGGCTCAGCCTGG - Intronic
1060535572 9:124384402-124384424 GCCCAAGGAAGGGCACAGCTGGG + Intronic
1060742852 9:126111013-126111035 GCTCCAGGCAGGCCTCAGCATGG - Intergenic
1060796578 9:126516121-126516143 GCCCTTGGAAGGCCCCAGCCTGG - Intergenic
1060831828 9:126722362-126722384 TCTCCAGGCAGGTGCCAGCCCGG + Intergenic
1061053541 9:128209737-128209759 GCTCCAGAAAGGACCCACCTTGG + Intronic
1061904772 9:133690987-133691009 GCCCCAGGCAGGCCCCAGCCAGG + Intronic
1061962532 9:133995318-133995340 GCACCAGGCAGGGCACACCCGGG + Intergenic
1062064626 9:134519642-134519664 GCCACAGTCAGGGCCCAGCCTGG + Intergenic
1062189819 9:135242244-135242266 GCTTCAGGGAGGGTCCTGCCTGG - Intergenic
1062259713 9:135655501-135655523 TCTCCAGGGAGGGCAGAGCCGGG + Intergenic
1062389378 9:136327897-136327919 CCTCCAGGCCGAGCCCAGCCCGG + Intronic
1062449263 9:136608684-136608706 GCGCCGGGTGGGGCCCAGCCTGG + Intergenic
1062524758 9:136973681-136973703 GCTTCAGGAAGCGCCCAGCTCGG - Intergenic
1062562082 9:137146201-137146223 GCTCCCTGGAGGCCCCAGCCGGG + Intronic
1062618129 9:137407273-137407295 GCTGCAGGCAGAGCCCAGCCCGG + Intronic
1062624288 9:137435916-137435938 GGCCCAGGAGGGGCCCAGGCTGG - Intronic
1185647104 X:1623684-1623706 GCTCAAGGAATCCCCCAGCCTGG - Intronic
1185750838 X:2608962-2608984 GCTCCAGGTAGGGGCCGCCCTGG + Intergenic
1187143818 X:16619560-16619582 GCTCCAGGCATGGCACAACCAGG - Intronic
1188996877 X:36897480-36897502 GCTCCAGGAAAGGCTCAGACAGG + Intergenic
1191846254 X:65550214-65550236 ACCCCAGGTAGGGCCCTGCCTGG + Intergenic
1192169060 X:68843236-68843258 GCTCCAGGAGCACCCCAGCCAGG - Intergenic
1195615255 X:106906737-106906759 GCTGGAGGAAGGGCCCAGGAAGG - Intronic
1198261505 X:134969072-134969094 GGTTCAGGAAGGGCAGAGCCTGG + Intergenic
1198302250 X:135344150-135344172 GCTCCAGGACGGGACCAGCGAGG + Intergenic
1199490891 X:148399224-148399246 ACTCCAGGAAAGGCCCAGCTGGG - Intergenic
1199563264 X:149186847-149186869 GCTCCAGGAAGGTCTCTGTCAGG + Intergenic
1200055506 X:153457894-153457916 GCTCCAGAAAGCCCCCAGCCAGG + Intronic
1200152456 X:153957941-153957963 GCTCCAGGAGAGTCTCAGCCAGG - Intronic
1200157549 X:153985346-153985368 GCTCCAGGCAGGCCCCGGCCTGG + Intergenic