ID: 1104509160

View in Genome Browser
Species Human (GRCh38)
Location 12:129360486-129360508
Sequence TGGGTTCTTAAAAGAGACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104509158_1104509160 -9 Left 1104509158 12:129360472-129360494 CCTTGAGGAATGGATGGGTTCTT 0: 1
1: 0
2: 0
3: 12
4: 213
Right 1104509160 12:129360486-129360508 TGGGTTCTTAAAAGAGACGAGGG 0: 1
1: 0
2: 2
3: 8
4: 165
1104509153_1104509160 6 Left 1104509153 12:129360457-129360479 CCAGGTGGGGAGTCTCCTTGAGG 0: 1
1: 0
2: 1
3: 13
4: 249
Right 1104509160 12:129360486-129360508 TGGGTTCTTAAAAGAGACGAGGG 0: 1
1: 0
2: 2
3: 8
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104509160 Original CRISPR TGGGTTCTTAAAAGAGACGA GGG Intronic
903433670 1:23329474-23329496 TTGGTTCTGAAAAGGGAGGAGGG - Intronic
905608358 1:39325526-39325548 TGTTTTCTTAAAAGATACAATGG + Intronic
906882565 1:49608125-49608147 TAGGTTCTTAAAAGAGCAGTAGG + Intronic
907474661 1:54697827-54697849 TGGGTTCTTGCAGGAGAGGAGGG + Intronic
908524844 1:64977603-64977625 TGTGTTTTTAATAGAGACGGGGG + Intergenic
909573295 1:77142707-77142729 TGGGTTCTTATAAGATCTGATGG - Intronic
911191487 1:94953157-94953179 TGGGAACTTAACAGAGAAGAAGG + Intergenic
912079663 1:105919532-105919554 TGGCTTCTTCAAAAAGAGGAAGG - Intergenic
914834917 1:151198899-151198921 CGGGTTCTGTAAAGAGACGTTGG + Exonic
915529543 1:156495462-156495484 TGGGTTCTCAAAAGGGAGGAAGG - Intronic
921267965 1:213441336-213441358 TCAGTTTTTAAAAGAGACTAAGG - Intergenic
921815907 1:219563216-219563238 TGGTTTTTAAAAAGAGACAAGGG + Intergenic
1064688040 10:17884631-17884653 TGAGTTCTTACAAGAGCTGATGG - Intronic
1064992024 10:21264516-21264538 TGAGTTCTTACAAGATATGAGGG + Intergenic
1066090571 10:32014949-32014971 TGTGTTTTTAGTAGAGACGAGGG - Intronic
1071286576 10:84154087-84154109 TGGGTTCTAAAAGGTGACTAAGG - Intergenic
1071927747 10:90430296-90430318 TGAGTTCTTACAAGATATGATGG + Intergenic
1072290647 10:93961576-93961598 TGGGTTCTATAAAGAGACATTGG - Intergenic
1073833244 10:107411088-107411110 TGGGTTCTCACAAGAGCTGATGG + Intergenic
1078712628 11:13809540-13809562 AGGTTTCTAAAAAGAGACAAAGG - Intergenic
1080794989 11:35554814-35554836 AGTCTTCTTAAAAGAGACAAGGG - Intergenic
1082847705 11:57739948-57739970 TGGGTACCTAAAAAAGAGGAAGG + Intronic
1084922757 11:72484638-72484660 TGGTTACTTCAAAGAGAAGAGGG + Intergenic
1085723048 11:78930016-78930038 TGGGTGCTTTACAGAGAGGATGG + Intronic
1087993488 11:104774975-104774997 TGGGATCTTAACAGAGCTGAAGG + Intergenic
1088011148 11:105002331-105002353 TGGGCTCTTGAGAGAGAGGAAGG - Intronic
1089526223 11:119098594-119098616 TGAGTTCTTAAAAGTGACTTGGG - Intronic
1091287497 11:134415842-134415864 TGGCTTCTGAGAAGAGAGGAGGG - Intergenic
1096239397 12:49951565-49951587 AGGGTTCTCAAGAGAGAAGAGGG + Intronic
1099160562 12:79236335-79236357 TGAGTACTTAAAAGAGAGGCTGG - Intronic
1099391810 12:82090257-82090279 TGGGTTCTGAAAAGACATGAAGG - Intergenic
1102128565 12:110506056-110506078 TGTGTTTTTAATAGAGATGAGGG + Intronic
1104509160 12:129360486-129360508 TGGGTTCTTAAAAGAGACGAGGG + Intronic
1104590109 12:130077576-130077598 TGAGTTCTTAAGAGAGTTGATGG - Intergenic
1105043285 12:132978790-132978812 TGCATTTTTAACAGAGACGAGGG - Intergenic
1105308127 13:19183128-19183150 TGGGTTTTTAAAGGAAAAGAAGG + Intronic
1105332963 13:19435121-19435143 TAGATTCTTAAAAGAGACTTAGG + Intronic
1105878736 13:24584673-24584695 TAGATTCTTAAAAGAGACTTAGG - Intergenic
1106543380 13:30710107-30710129 TGTATTCTTAAAATAGAAGAGGG + Intergenic
1107089633 13:36463629-36463651 TGTGTCCTTAAAAGAGACATGGG + Intergenic
1108347451 13:49560199-49560221 TGGTTACTTAATAGAGAGGAGGG - Intronic
1109837025 13:67873525-67873547 TGGCTTCTTAACAGAAACAATGG + Intergenic
1110240072 13:73257081-73257103 AGGTTTCTTCAAAGAGACTATGG - Intergenic
1111221156 13:85207117-85207139 TGAGTTCTCAAAAGAGTTGATGG + Intergenic
1114041071 14:18678932-18678954 TGTGTTTTTAGAAGAAACGAGGG - Intergenic
1116714034 14:48406163-48406185 TGAGTTCTCAAAAGATATGATGG - Intergenic
1117266483 14:54093276-54093298 TGGGTGCTTGAGAGAGAGGAAGG - Intergenic
1119620147 14:76125760-76125782 GGGGTGATTAAAAGAGAGGAAGG + Intergenic
1126600571 15:50423781-50423803 TGTATTCTTAATAGAGACGGGGG + Intergenic
1129188326 15:73923737-73923759 TGGGGTCCTAAAAGAGACCTGGG - Intergenic
1133636125 16:7667487-7667509 TTCGTTTTTAAAAGAGATGATGG + Intronic
1136076175 16:27818947-27818969 TGGGTTTTAAAAAGAGACCTCGG + Intronic
1137689109 16:50407974-50407996 TGGATTCTGGAAAGAGAGGAGGG + Intergenic
1139374197 16:66486693-66486715 TGGGTTCTGCAAAGAAAAGAGGG + Intronic
1139571792 16:67817452-67817474 TGCGTTTTTAGTAGAGACGAGGG + Intronic
1140306268 16:73806110-73806132 TGAGTTCTTACAAGAGCTGATGG - Intergenic
1141736717 16:85859060-85859082 AGGGTCCTTAAAAGAGAGGCAGG - Intergenic
1141821095 16:86446472-86446494 TGAGTTGTTAAAAGAGAAGAGGG - Intergenic
1146024163 17:29305314-29305336 TGTGTTTTTAATAGAGACGGGGG - Intergenic
1146230394 17:31103017-31103039 TGTATTTTTAAAAGAGACAAGGG + Intronic
1148830906 17:50430365-50430387 TGGGTTTTTAAAAGAAAAGAAGG + Intronic
1149026566 17:52034486-52034508 TTATTTCTTAAAAGAGAAGAGGG + Intronic
1153384913 18:4481582-4481604 TGGGTACTTAAAAGATGCTAAGG + Intergenic
1154035558 18:10798394-10798416 TGGGCTCTGCAATGAGACGATGG + Intronic
1155288614 18:24318268-24318290 TGTGTTTTTAGTAGAGACGAGGG - Intronic
1156208623 18:34913722-34913744 TGACTTCTTAAAAGAGGTGAAGG - Intergenic
1156547044 18:37973894-37973916 TGTGTACTTGAAAGAGAAGATGG - Intergenic
1162189232 19:8931773-8931795 TGTGTTTTTAGTAGAGACGACGG - Intronic
1163010380 19:14421592-14421614 TGTGTTTTTAGTAGAGACGAGGG - Intergenic
1164890441 19:31819334-31819356 TGGGTTTTTAATAGAGACGGGGG - Intergenic
1165957152 19:39508108-39508130 TAGGTTTTTCAAAGAGAAGATGG - Exonic
1167456424 19:49598645-49598667 TGTGTTTTTAATAGAGACCAGGG - Intronic
1168519597 19:57038069-57038091 TGTGTTTTTAAAAGAGGAGAAGG + Intergenic
925047853 2:788268-788290 TGAGTTCTTATAAGAGCTGATGG - Intergenic
926536235 2:14116283-14116305 TGTGTTGTGAAAAGAGAAGAGGG + Intergenic
926665103 2:15512952-15512974 TGGGTTGTCAAATGAGAAGAGGG - Intronic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
929712246 2:44277278-44277300 TGTATTTTTAATAGAGACGAGGG + Intronic
933465301 2:82643243-82643265 GGGGTACATAAAAGAGATGAGGG + Intergenic
935341359 2:102062365-102062387 TGGGTTCAGAGAAGAGACCATGG + Intergenic
943027062 2:182642773-182642795 AGGGTTCTAAAATGAGATGATGG - Intergenic
943631358 2:190256073-190256095 TGAGTTCTTACAAGAGCTGATGG - Intronic
945202690 2:207298873-207298895 TGTGTTCTTAACAGAAACAATGG + Intergenic
945262037 2:207852683-207852705 TGGGTACTCAAAAGAGGGGAGGG + Intronic
945613298 2:212033294-212033316 TGGGATCTCAAAAGAGAAGCTGG + Intronic
945741848 2:213673113-213673135 TGGGTTCTTGAAGGAAAGGAAGG - Intronic
947190600 2:227500965-227500987 TGTGTTTTTAGTAGAGACGAGGG + Intronic
1169314046 20:4573273-4573295 TGGGTTCTTAAAAGTGAAGAGGG - Intergenic
1169552239 20:6713059-6713081 TGTATTCTTAATAGAGACGGAGG + Intergenic
1173280141 20:41619611-41619633 TGGGTGCTTAGAAAACACGATGG - Intergenic
1173433166 20:43009534-43009556 TGCATTCTTCAAAGAGAAGAAGG + Intronic
1174535232 20:51246373-51246395 GGGGTCCTTAAAAGAGAGGTCGG + Intergenic
1174976582 20:55342561-55342583 TGGGGTAATAAAAGAGATGAAGG - Intergenic
1176740064 21:10593445-10593467 TAGATTCTTAAAAGAGACTTAGG - Intronic
1177733354 21:25057982-25058004 TGAGTTCTCACAAGAGCCGATGG + Intergenic
1182154314 22:28054720-28054742 TGGGTTGTCTAAAGAGAGGATGG - Intronic
1183274889 22:36888267-36888289 TGGGTTCTTAGGAAAGACTATGG + Intergenic
1183924469 22:41196345-41196367 TGTGTTTTTAATAGAGACGGGGG - Intergenic
951532670 3:23712411-23712433 TAGGTTCCCAAAAGGGACGATGG - Intergenic
953092924 3:39747555-39747577 TGAGTTGTTAAAAGAGGAGAAGG + Intergenic
957777261 3:84769298-84769320 TGAGTTCTCACAAGAGATGATGG + Intergenic
958698457 3:97556526-97556548 TGAGTTCTTAAAAGATCTGATGG - Intronic
959768659 3:110066207-110066229 TTGGTTCTTAAAGGAGAAAAAGG - Intergenic
966179658 3:177176638-177176660 TGTGTTTTTAATAGAGATGAGGG - Intronic
966518592 3:180847456-180847478 TGTATTTTTAGAAGAGACGAGGG - Intronic
967292501 3:187935016-187935038 TGGGTCCTTAAAACAGTCAATGG - Intergenic
972118629 4:35671426-35671448 TGGGTCCTTACAAGTGAAGAAGG - Intergenic
972454879 4:39244344-39244366 AGGGTCCTTAAAAGAGACTGTGG + Exonic
974915924 4:68178412-68178434 TGAGTTCTTATGAGAGCCGACGG - Intergenic
975052427 4:69882794-69882816 TGAGTTCTTACAAGACATGATGG - Intergenic
975234280 4:71973045-71973067 TGGATTCTTAGAAAAGACTATGG + Intergenic
975234286 4:71973209-71973231 TGGGATCCTAGAAGAGAAGAAGG - Intergenic
977186409 4:93943400-93943422 TGGGTTATTAAAATGAACGATGG - Intergenic
979901956 4:126231978-126232000 TGGTTTATTAAAAGAGAAGTAGG - Intergenic
979984256 4:127295241-127295263 TGAGTTCTTACAAGAGCTGATGG - Intergenic
983344330 4:166507220-166507242 TGAGTTCTTAAAAGATCTGATGG - Intergenic
989230695 5:39083238-39083260 TGAGTTCTCAAAAGATATGATGG - Intergenic
991621996 5:68554887-68554909 TGGGTGCTTAAAGGAAACTATGG - Intergenic
992682630 5:79167946-79167968 TTTGTTCTTAAAAGAGATAAAGG + Intronic
993381298 5:87211565-87211587 TGGCTACTTAGAAGAGACCAAGG + Intergenic
993543558 5:89182710-89182732 TGGGTTCTTAAAGCAGGGGAGGG - Intergenic
994315437 5:98327391-98327413 TGAGTTCTCAAAAGATCCGATGG + Intergenic
994400416 5:99272877-99272899 TGGTTTCCTTAAAGAGACAATGG - Intergenic
996407111 5:123116536-123116558 GGTGTTCTTAAAAGATATGACGG - Intronic
997133740 5:131302486-131302508 TGTGTTTTTAATAGAGACGGGGG + Intronic
998182224 5:139953658-139953680 TGGGGTCTCAAAAGATAAGAAGG + Intronic
998491501 5:142551088-142551110 TAGGTACTTAATAGATACGAAGG + Intergenic
998529996 5:142875572-142875594 TGGGTGCTTAAAAATGAAGAGGG - Intronic
999701586 5:154233512-154233534 TGGCTTCTGAAAAGAGACCAAGG + Intronic
1001473562 5:172033160-172033182 TGAGTTCTTAAGAGATCCGATGG - Intergenic
1002983891 6:2169432-2169454 TGTGTTCTGAGTAGAGACGAGGG - Intronic
1003579752 6:7329104-7329126 TGTATTTTTAATAGAGACGAGGG + Intronic
1005105313 6:22218465-22218487 TGGGTTCTTAAAAGTGAAAGAGG + Intergenic
1006593752 6:35177648-35177670 TGGGACCTTAAAAGAGATCAAGG - Intergenic
1008378862 6:50820782-50820804 TGGGTTCTAAAAAGTAACCAGGG + Intronic
1014219021 6:118781427-118781449 TGTGTTTTTAATAGAGACGGGGG + Intergenic
1016361834 6:143275652-143275674 TGGGTTTTTAAATGTGACTAGGG - Intronic
1018157206 6:160996621-160996643 TGGTTTCTTTAAAGAGAAAATGG + Intronic
1018161993 6:161053764-161053786 TGTGTTTTTAATAGAGACGGGGG + Intronic
1018943559 6:168328716-168328738 TGGGTTCTCACAAGAGCTGATGG + Intergenic
1019423010 7:959825-959847 TGTATTTTTAACAGAGACGAGGG + Intronic
1021386520 7:20037597-20037619 AGGGTTCTTAAAGGAGAGAAAGG + Intergenic
1027459307 7:78433198-78433220 TGGGTTATTAAGAGAAAAGAAGG - Intronic
1029715246 7:102321992-102322014 GGGGTGCTGAAAAGAGAGGAGGG + Intergenic
1031746188 7:125501104-125501126 TGGGTTCTTATGAGAGCTGATGG - Intergenic
1033260025 7:139835445-139835467 TGGTTTCATAACAGAGATGAAGG + Intronic
1033483854 7:141768624-141768646 TGGGTTCAGAAAACAGAGGAGGG - Intronic
1035628949 8:1093857-1093879 TGGGGTCTCAAAGGTGACGATGG + Intergenic
1039450827 8:37673832-37673854 TGGGTCCTGATAAGAGAAGAAGG + Intergenic
1040576413 8:48655378-48655400 TGGGTTCTTAATAGATTCTATGG - Intergenic
1040730592 8:50442411-50442433 AGGGTTCTAATAAGAGAGGAAGG - Intronic
1043158326 8:76814803-76814825 TGGTTTCTTCAAAAAGACAATGG - Intronic
1045690960 8:104759397-104759419 TGGCTCCTTAAAAGGGACCAGGG - Intronic
1046499036 8:115052120-115052142 TGGGTTCTTACAAGAGCTGATGG - Intergenic
1048319936 8:133390809-133390831 AAGTTTCTTAAAAGAGAGGAAGG - Intergenic
1051100347 9:13513961-13513983 TGTGTTCTTGAAAGAGAGGTGGG - Intergenic
1051857008 9:21579857-21579879 AGGGTTCTTAAAACACACCATGG + Intergenic
1054694646 9:68348089-68348111 CGGGTTTTAAAAAGAGACAAGGG - Intronic
1055001899 9:71460584-71460606 TGAGTTCTTACAAGAGCCAATGG - Intergenic
1055306052 9:74930066-74930088 TGGGTTCTCAAAAGATCTGATGG + Intergenic
1057749273 9:97778678-97778700 TGAGTTCTTACAAGAGCTGATGG + Intergenic
1058230958 9:102424214-102424236 TGGGTTATTAAAAGACACCTTGG - Intergenic
1059819207 9:117953148-117953170 TGGGTTTTTAAGAGAGAAGAGGG + Intergenic
1060356649 9:122914439-122914461 CGGGTTCTTTAAAGATACGTTGG - Intergenic
1185782205 X:2858507-2858529 TGGGTTCCTAAAAGGGTCAAGGG + Intronic
1185852057 X:3498399-3498421 CGGGTTCTTGGAAGAGATGAGGG + Intergenic
1186988701 X:15044605-15044627 TTGTTTCTTAACAGAGACCAAGG - Intergenic
1187254916 X:17633929-17633951 TGGGTTCTTAAAAGCAATCATGG - Intronic
1187999408 X:24965898-24965920 TCGGTTCTTAAAATAAACAAAGG + Intronic
1189363900 X:40373604-40373626 TGGGTCCTTGAAGGAGACGTGGG + Intergenic
1189553233 X:42114677-42114699 TGAGTTCTCACAAGAGCCGATGG - Intergenic
1190464035 X:50708058-50708080 TGGGTTCCTAAAAGAGAGGAGGG - Intronic
1194307516 X:92266916-92266938 TGTATTTTTAATAGAGACGAGGG + Intronic
1195723916 X:107894011-107894033 TGGCTTCTTAAAGGAGGTGAAGG - Intronic
1196840777 X:119857120-119857142 TGGCTACTTTAAAGAGACCAGGG - Intergenic
1200800160 Y:7379464-7379486 TGTGTTTTTAATAGAGACAAGGG - Intergenic