ID: 1104509173

View in Genome Browser
Species Human (GRCh38)
Location 12:129360583-129360605
Sequence CTGGGTGATCAGATGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 310}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104509173_1104509180 -10 Left 1104509173 12:129360583-129360605 CCACCTTCCATCTGATCACCCAG 0: 1
1: 0
2: 2
3: 21
4: 310
Right 1104509180 12:129360596-129360618 GATCACCCAGCTGGGGGCTCTGG 0: 1
1: 0
2: 5
3: 25
4: 266
1104509173_1104509187 15 Left 1104509173 12:129360583-129360605 CCACCTTCCATCTGATCACCCAG 0: 1
1: 0
2: 2
3: 21
4: 310
Right 1104509187 12:129360621-129360643 AGGGATCTGATCACCCACCTGGG 0: 1
1: 0
2: 2
3: 7
4: 114
1104509173_1104509186 14 Left 1104509173 12:129360583-129360605 CCACCTTCCATCTGATCACCCAG 0: 1
1: 0
2: 2
3: 21
4: 310
Right 1104509186 12:129360620-129360642 CAGGGATCTGATCACCCACCTGG 0: 1
1: 0
2: 0
3: 16
4: 178
1104509173_1104509194 29 Left 1104509173 12:129360583-129360605 CCACCTTCCATCTGATCACCCAG 0: 1
1: 0
2: 2
3: 21
4: 310
Right 1104509194 12:129360635-129360657 CCACCTGGGGACTCTGGCCGGGG 0: 1
1: 0
2: 3
3: 26
4: 207
1104509173_1104509192 28 Left 1104509173 12:129360583-129360605 CCACCTTCCATCTGATCACCCAG 0: 1
1: 0
2: 2
3: 21
4: 310
Right 1104509192 12:129360634-129360656 CCCACCTGGGGACTCTGGCCGGG 0: 1
1: 0
2: 2
3: 27
4: 376
1104509173_1104509188 16 Left 1104509173 12:129360583-129360605 CCACCTTCCATCTGATCACCCAG 0: 1
1: 0
2: 2
3: 21
4: 310
Right 1104509188 12:129360622-129360644 GGGATCTGATCACCCACCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 104
1104509173_1104509189 23 Left 1104509173 12:129360583-129360605 CCACCTTCCATCTGATCACCCAG 0: 1
1: 0
2: 2
3: 21
4: 310
Right 1104509189 12:129360629-129360651 GATCACCCACCTGGGGACTCTGG 0: 1
1: 0
2: 1
3: 12
4: 143
1104509173_1104509190 27 Left 1104509173 12:129360583-129360605 CCACCTTCCATCTGATCACCCAG 0: 1
1: 0
2: 2
3: 21
4: 310
Right 1104509190 12:129360633-129360655 ACCCACCTGGGGACTCTGGCCGG 0: 1
1: 0
2: 1
3: 19
4: 246
1104509173_1104509184 -4 Left 1104509173 12:129360583-129360605 CCACCTTCCATCTGATCACCCAG 0: 1
1: 0
2: 2
3: 21
4: 310
Right 1104509184 12:129360602-129360624 CCAGCTGGGGGCTCTGGCCAGGG 0: 1
1: 0
2: 8
3: 38
4: 544
1104509173_1104509182 -5 Left 1104509173 12:129360583-129360605 CCACCTTCCATCTGATCACCCAG 0: 1
1: 0
2: 2
3: 21
4: 310
Right 1104509182 12:129360601-129360623 CCCAGCTGGGGGCTCTGGCCAGG 0: 1
1: 1
2: 5
3: 67
4: 699

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104509173 Original CRISPR CTGGGTGATCAGATGGAAGG TGG (reversed) Intronic
900485707 1:2921692-2921714 CTGGATGGACAGATGGACGGAGG - Intergenic
900485716 1:2921734-2921756 CTGGATGGACAGATGGACGGAGG - Intergenic
900485725 1:2921776-2921798 CTGGATGGACAGATGGACGGAGG - Intergenic
900485735 1:2921818-2921840 CTGGATGGACAGATGGACGGAGG - Intergenic
900485744 1:2921860-2921882 CTGGATGGACAGATGGACGGAGG - Intergenic
900498218 1:2986368-2986390 ATGGGTGAATAGATGGAAAGAGG - Intergenic
901775951 1:11560568-11560590 CTGTGTGCTCAGATAGAAGTAGG - Intergenic
902367083 1:15983037-15983059 CAGCCTGGTCAGATGGAAGGAGG - Intergenic
902392075 1:16112666-16112688 TTGGGGGGTCAGAGGGAAGGGGG + Intergenic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903012601 1:20342318-20342340 GTGGGGGAGCAGAAGGAAGGAGG + Intronic
903221632 1:21872761-21872783 CTGGGTAGACGGATGGAAGGAGG + Intronic
903330042 1:22592659-22592681 CGGGGTGAGCAGAGGGGAGGAGG + Intronic
903360000 1:22771114-22771136 CTGGGTGATCAGGAGTAAGGTGG + Intronic
905294330 1:36944675-36944697 TTGGGAGATCACAGGGAAGGGGG - Intronic
905545058 1:38791164-38791186 CTGGATGATCAGATTGTAAGGGG - Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
907336713 1:53704517-53704539 CTGGGTGAGCAGATGAACAGTGG + Intronic
909358442 1:74734327-74734349 CTGGGTTATCAGATCGACTGTGG + Intronic
910464126 1:87478301-87478323 CTGGCTGCTGAGATGGAAAGAGG + Intergenic
912432984 1:109639285-109639307 CTGGGTGGACAGATGCAAGATGG + Intergenic
912438596 1:109680575-109680597 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912441117 1:109699020-109699042 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912744865 1:112237747-112237769 CTGAGTAATCAGAGGGTAGGAGG - Intergenic
912848907 1:113104252-113104274 GTGGGTGGACAGATGGATGGAGG - Intronic
914356283 1:146887242-146887264 CTGGGTGGGGAGATGAAAGGAGG + Intergenic
915218038 1:154352932-154352954 CTGGGAGCACAGATGGAAGCGGG - Intergenic
921286957 1:213617395-213617417 CTGGTTGTGGAGATGGAAGGAGG + Intergenic
921681597 1:218039488-218039510 CTGAGGGATCAGATGGAGGTTGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922741487 1:228016532-228016554 TTGGGTCATCAGCTGCAAGGAGG + Intronic
922792938 1:228320371-228320393 ATGGATGACTAGATGGAAGGAGG - Intronic
1063033679 10:2262898-2262920 CTGGGTGATAAGATGGCCAGAGG + Intergenic
1063360538 10:5452504-5452526 CAGGGAGATCAGACGGCAGGAGG + Exonic
1063655192 10:7981258-7981280 GTGGGTGAATAGATGGAAGAGGG - Intronic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1065156296 10:22873398-22873420 CTTGGTGATCAAATGGAAATTGG - Intergenic
1065804734 10:29384073-29384095 CAGGGTGATCAGAGAGCAGGAGG + Intergenic
1067250006 10:44578161-44578183 CAGGGTGATCAGATGTAACCTGG + Intergenic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1068659658 10:59611115-59611137 CTGTGTCCTCAGATGGCAGGGGG - Intergenic
1068701501 10:60024710-60024732 CTGGGAGAGCACCTGGAAGGTGG + Intergenic
1069611534 10:69775839-69775861 CTGGGGGATCAGCTGGGAGTAGG + Intergenic
1071515284 10:86292916-86292938 CTGTGTGAAGAGATGGATGGGGG + Intronic
1072600550 10:96923551-96923573 TTGGGTGATAAGATTAAAGGAGG - Intronic
1072693518 10:97586850-97586872 GTGAGTGATCAGATGGGAGCTGG - Intronic
1073054013 10:100687459-100687481 CTGGGTGAGGACAGGGAAGGAGG + Intergenic
1073303637 10:102486150-102486172 TTGGATGATCTGATGGGAGGTGG - Intronic
1073659096 10:105452845-105452867 CTGGGTGCTCACATGGTAAGAGG + Intergenic
1074934343 10:118163017-118163039 ATGGCTGATCTGATGGGAGGTGG - Intergenic
1075233924 10:120709602-120709624 CTGCGGGATCAGCTGGAGGGAGG + Intergenic
1075256865 10:120932281-120932303 CTGTGTGTTCAGATGGGAGCTGG - Intergenic
1075260463 10:120959016-120959038 CTGGGTGAACAGAAGACAGGTGG - Intergenic
1075702075 10:124476316-124476338 CTGGCCGGTCAGCTGGAAGGAGG + Intronic
1075806306 10:125191332-125191354 CTTGCTGTGCAGATGGAAGGAGG + Intergenic
1075962843 10:126584362-126584384 ATGGATGGACAGATGGAAGGTGG - Intronic
1075962854 10:126584417-126584439 ATGGATGGACAGATGGAAGGTGG - Intronic
1078053063 11:7984216-7984238 CTCGGTGATCAGCTGGCATGAGG - Intronic
1078433576 11:11306315-11306337 CTTGGTGATCAGAAGGATGTAGG + Intronic
1079136541 11:17778858-17778880 CTGAGTGATTAGATGGGGGGTGG + Intronic
1079837248 11:25350345-25350367 CTGGGGGCTCACAAGGAAGGAGG + Intergenic
1081569315 11:44279660-44279682 CTTGGAGGTCAGCTGGAAGGAGG - Intronic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1084041539 11:66545809-66545831 CAGGTTGAGCAGCTGGAAGGCGG + Exonic
1085382726 11:76134960-76134982 ATGGCTGATCTGATGGGAGGCGG - Intronic
1085798355 11:79564446-79564468 CTGGCTGAGCAGATGGCAGTAGG + Intergenic
1085862858 11:80255148-80255170 CAGGTTGATCAGAGGAAAGGTGG + Intergenic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1086925418 11:92634942-92634964 GTGGGTGCTCAGAGGGAAAGAGG - Intronic
1086949531 11:92877353-92877375 CTGGTTGTGCAGAGGGAAGGTGG - Intronic
1088720697 11:112589526-112589548 CTGGGTGGGCAGATGGAAAGGGG + Intergenic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089191820 11:116659322-116659344 CTGGGTGACGAGGTGGAGGGTGG - Intergenic
1089235674 11:117022886-117022908 CTGTGTGGTAAGATGGAAGTGGG - Intronic
1089715859 11:120358442-120358464 CTGACTGATAAGATGGAAGATGG + Intronic
1090586785 11:128221779-128221801 CTGGGAAATGAGATTGAAGGTGG - Intergenic
1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG + Intronic
1090948384 11:131451487-131451509 CTGGGGGTGCAGCTGGAAGGGGG + Intronic
1091156332 11:133377549-133377571 CTGGGAGTTCAAAGGGAAGGTGG - Intronic
1092264291 12:6969462-6969484 CTTGGTAATCACATGGCAGGTGG - Intronic
1092540847 12:9419069-9419091 CTGGGTGGACAGATGGGAGCTGG - Intergenic
1098722172 12:73914031-73914053 CAGGGTGACTAGATGGAAGCAGG + Intergenic
1098730641 12:74033529-74033551 CTGCTTGATCTTATGGAAGGGGG - Intergenic
1099347424 12:81520074-81520096 CTATGTGATAAGATGGAATGAGG + Intronic
1100289117 12:93197261-93197283 CTGAGTGATCAGATTCAAAGAGG + Intergenic
1101059303 12:100954453-100954475 ATGGGTGCTCAGATGGAAGGTGG - Intronic
1101331438 12:103761029-103761051 ATGAGTGATCAGAAGGAAAGTGG - Intronic
1101485571 12:105155227-105155249 CTGGGTAAGGAGATGTAAGGGGG + Intronic
1103596767 12:122029018-122029040 CTGGGTGAAAAGGTGCAAGGAGG + Intronic
1103721533 12:122978070-122978092 GTGGCTCATCAGATGAAAGGAGG + Intronic
1103931131 12:124451688-124451710 GTGAGTGATCAGATGGAACAGGG + Intronic
1104211416 12:126692218-126692240 CTGGGTCTTCAGATGGTGGGGGG - Intergenic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1106369360 13:29116706-29116728 CTCAGTGATCAGATGGACTGTGG - Intronic
1106451769 13:29888821-29888843 GTGAGTTATCAGAAGGAAGGAGG + Intergenic
1106679601 13:31996654-31996676 CTGGAAGAGCAGATGGAAAGTGG + Intergenic
1106682966 13:32027427-32027449 CTGGGTGGTCAATGGGAAGGAGG - Intergenic
1109494580 13:63151226-63151248 CTGGCTGAGAAGATGTAAGGGGG + Intergenic
1110717338 13:78721233-78721255 CTGGCTGATCTGACAGAAGGCGG - Intergenic
1112769172 13:102776775-102776797 CTGGCTGAGAAGATGGAAGAGGG + Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114543050 14:23477580-23477602 TTAGGTGATCAGGTGCAAGGTGG + Intronic
1117095787 14:52296044-52296066 CTGGGTGACCAGATGGCAAAAGG - Intergenic
1117162400 14:53002231-53002253 CTGGGAGATGAGAAGGAGGGAGG - Intergenic
1117785337 14:59278181-59278203 CTGTGTGATCAGATGAAGTGAGG + Intronic
1118470117 14:66067596-66067618 CAGGGAAATCAAATGGAAGGGGG - Intergenic
1119165314 14:72487614-72487636 CTGGCTTTGCAGATGGAAGGGGG + Intronic
1120787464 14:88550528-88550550 CTGGGTGAGCAGCTGGAGGCCGG - Exonic
1120946613 14:90003649-90003671 GTGGGTGGTCAGAAGCAAGGTGG + Intronic
1121321695 14:92995266-92995288 GTGGGTGAGCAGAGGGCAGGGGG - Intronic
1123072259 14:105647595-105647617 CTGAGTGCACAGATGGGAGGAGG - Intergenic
1127382493 15:58442118-58442140 CTGAGAGATCAGAGGTAAGGAGG - Intronic
1128713726 15:69891721-69891743 CTGGGTGATCACATGAAAGTAGG - Intergenic
1129462523 15:75706754-75706776 CTGGCTGATCAGATAGAACTAGG - Intronic
1129722340 15:77884660-77884682 CTGGCTGATCAGATAGAACTAGG + Intergenic
1130884461 15:88081641-88081663 CTGGGGGCTCAGAAGGAAGGGGG - Intronic
1131753789 15:95538570-95538592 TTGGGTGATTAGATGGGGGGTGG + Intergenic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1133257413 16:4525670-4525692 CTGGGTGATGAGCAGGAAAGAGG + Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1134275876 16:12775694-12775716 CTGGCTGGTCAGACAGAAGGTGG - Intronic
1134346082 16:13393127-13393149 CTGTGTGATCAGTTTGAAGCAGG - Intergenic
1135110117 16:19684116-19684138 CTGGGTGCTCTGGAGGAAGGAGG + Intronic
1135129770 16:19843735-19843757 CTGGGTCATCACATGGGAGAGGG + Intronic
1135903853 16:26492211-26492233 CTGGGTGCTTAGAATGAAGGAGG - Intergenic
1137385912 16:48042470-48042492 CTGGGTGGAAAGAAGGAAGGAGG - Intergenic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1138695551 16:58809607-58809629 CCTGGAGAACAGATGGAAGGAGG - Intergenic
1139484914 16:67249951-67249973 CTGGCTGCTCAGAAGGGAGGAGG - Intronic
1139923065 16:70471562-70471584 CTGGCAGAGCAGATGCAAGGAGG - Intronic
1139977733 16:70828221-70828243 CTGGGTGGGGAGATGAAAGGAGG - Intronic
1141316233 16:82964967-82964989 CTGGGAGCTAAGAAGGAAGGTGG + Intronic
1141319501 16:82994080-82994102 ATGGGTAATTAGATGGAGGGTGG - Intronic
1141557197 16:84844022-84844044 CTGGGTGTGCAGAGGGCAGGAGG + Intronic
1142152351 16:88518250-88518272 GTGGGTGAGTAGATGGATGGTGG + Intronic
1142411452 16:89919114-89919136 GGGGGTGCCCAGATGGAAGGAGG + Exonic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1143564196 17:7711785-7711807 GTGGCTGATCAGAAGGAAGTAGG + Intergenic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1145203217 17:20966041-20966063 CTGAGTTAACATATGGAAGGGGG - Intergenic
1146297139 17:31659114-31659136 CTGTGTGCTCACATGGAATGGGG + Intergenic
1146626877 17:34441706-34441728 CTGGATGGACAGATGGATGGAGG + Intergenic
1148479300 17:47949666-47949688 CTGGGTGGCCAGATGGATGTGGG - Intergenic
1148957310 17:51364520-51364542 CTGATTGTTCAGATGGAAAGTGG + Intergenic
1149247279 17:54725266-54725288 ATGTGTTGTCAGATGGAAGGAGG + Intergenic
1151358196 17:73572490-73572512 CTGGGTGATAAGAGGGAGGCTGG - Intronic
1151460955 17:74253655-74253677 ATGGGTGAGCACATGGGAGGTGG - Intronic
1152311292 17:79551547-79551569 ATGGATGGGCAGATGGAAGGTGG + Intergenic
1152472352 17:80496989-80497011 CTAGGTGATGAAGTGGAAGGAGG + Intergenic
1153443826 18:5150619-5150641 CTGGGTGATCATAGAGAAGCAGG - Intronic
1154120661 18:11649548-11649570 CTGGACAATCAGATGGAATGAGG - Intergenic
1154144172 18:11852421-11852443 CAGAATGATCAGATTGAAGGTGG + Exonic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1156284657 18:35679957-35679979 CATGGTGAACAGATGGGAGGGGG - Intronic
1157198685 18:45640951-45640973 CTGGGTGAGAAGAGGCAAGGAGG - Intronic
1157783220 18:50458408-50458430 CTGGATGATCAGCTCAAAGGAGG - Intergenic
1158003542 18:52646517-52646539 CTGGGTGATCAGAAGTACAGGGG - Intronic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1159644661 18:70903287-70903309 CAGGGTAGTCAGATAGAAGGAGG + Intergenic
1159921367 18:74230191-74230213 CTGGCCGGTCAGAAGGAAGGAGG + Intergenic
1160322052 18:77905501-77905523 CTGGATGGACAGGTGGAAGGTGG + Intergenic
1160956813 19:1697388-1697410 CTGGGAGATGGGATGGATGGTGG + Intergenic
1161817637 19:6509635-6509657 CTGGGTGGGGAGGTGGAAGGAGG - Intergenic
1161857888 19:6776197-6776219 ATGGATGAGCAGATGGATGGAGG - Intronic
1163019451 19:14474662-14474684 CTGGGTGTAAAAATGGAAGGTGG - Intronic
1163479009 19:17543476-17543498 CTGGGTGCTCAGATGGTTGCTGG + Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1165949255 19:39464772-39464794 CAGGGTGAGCCGGTGGAAGGAGG - Intronic
1166965696 19:46528376-46528398 CTGGGTGATGGGGTGGAAGGTGG - Intronic
1166996245 19:46720953-46720975 CTGGGGGATGAGATGGACTGTGG - Intronic
1167172734 19:47843978-47844000 CTGGATGCTGAGAGGGAAGGCGG - Intergenic
1167618605 19:50549361-50549383 CTGCGTGATCACCTGGGAGGTGG + Intronic
925169736 2:1743628-1743650 CTGGGGGAGGAGAAGGAAGGGGG + Intronic
925462681 2:4077313-4077335 GTGGGTGATAAGAGGGGAGGTGG - Intergenic
926988181 2:18646890-18646912 CTGGGTCTTCAGTTGGAATGTGG + Intergenic
927195366 2:20542844-20542866 CTGGGGGCACAGATGGGAGGTGG + Intergenic
928203724 2:29269191-29269213 CCCTGTGTTCAGATGGAAGGAGG + Intronic
928681643 2:33708741-33708763 CCGAGTGATCAGATGCAAGAGGG + Intergenic
929848240 2:45555445-45555467 CTGAGTGAAGAGATGGGAGGAGG - Intronic
931830727 2:66048448-66048470 CTGGGTCTTCAGAAAGAAGGAGG - Intergenic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
933249784 2:80016355-80016377 CAGGCTGCTCAGAAGGAAGGAGG + Intronic
935222908 2:101029976-101029998 CTGCTTGATCAGCTGGAAAGTGG + Intronic
935348791 2:102135593-102135615 CTGGTTGATCAAAAGGAAAGAGG + Intronic
936018240 2:108975506-108975528 CTTGGTGACCAGATGGATGCCGG + Intronic
936376547 2:111946065-111946087 CAGGGAGCACAGATGGAAGGAGG + Intronic
938651893 2:133391570-133391592 TTGGGTGACCAGATGGACTGTGG - Intronic
939953991 2:148509656-148509678 CTGTGTGATCAGAGGAAGGGCGG - Intronic
940572408 2:155455147-155455169 CTGGGTGATAAGATTGAGGGTGG + Intergenic
942059540 2:172215513-172215535 CTGGGTGATGAGAGAGTAGGAGG + Intergenic
942299180 2:174545983-174546005 CTGGCTGAGCAGGTGGAAGAAGG + Intergenic
942814945 2:180042032-180042054 CTGGGTCCTCACATGGAAGAAGG - Intergenic
946229298 2:218281910-218281932 CTGGAAGGGCAGATGGAAGGTGG - Intronic
948181220 2:235982427-235982449 CTAGGAGGTCAGAAGGAAGGGGG + Intronic
1170873452 20:20229573-20229595 CTGGGTAAGCAAATGGATGGAGG + Intronic
1171303005 20:24080100-24080122 CTGGCTGGTCAGAGGGAAAGTGG + Intergenic
1172016196 20:31874858-31874880 CTGGGTTTGCAGATCGAAGGGGG + Intronic
1172431053 20:34892211-34892233 CTAGGTGGTCAGATGGGAGCAGG + Intronic
1173355398 20:42282888-42282910 ATGAGTGAGCAGATGGAAGGAGG + Intronic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1173552315 20:43941147-43941169 CAGGGTGATGTGAGGGAAGGGGG + Intronic
1174263485 20:49314506-49314528 CTGGGTGGGGAGAAGGAAGGAGG - Intergenic
1174339832 20:49888768-49888790 GAGGGAGATCAGATGGCAGGAGG - Exonic
1175142537 20:56871824-56871846 ATGGGTGATCAAAAGGAAGGCGG - Intergenic
1175978504 20:62725510-62725532 CTGGGGGATAAGGTGGAAAGAGG + Intronic
1178554126 21:33571927-33571949 CAAGGTGCTCTGATGGAAGGAGG - Intronic
1179136538 21:38684702-38684724 CTTGGTGTTCAGCTGGAACGTGG - Intergenic
1180167306 21:46036767-46036789 CTGGGTGAGCAGCTGGAGCGAGG + Intergenic
1180717586 22:17882278-17882300 CTAGGTCATCATATGGAAGAGGG - Intronic
1181311347 22:21946526-21946548 CGTGGTGACCAGATGGCAGGAGG + Intronic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1183283525 22:36947621-36947643 CTGAGTGACGAGATGGGAGGAGG - Intergenic
1184290994 22:43498168-43498190 CAGGGTGGTCAGAGGGAATGCGG - Intronic
1184410463 22:44323195-44323217 ATGGGTGGACAGATGGATGGTGG - Intergenic
1184744623 22:46449129-46449151 CTGGGTGAGTGGATGGAAGCTGG - Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
952317731 3:32246244-32246266 GTGGGACATCAGATGGCAGGGGG - Intronic
953036516 3:39216409-39216431 CTAGGGGAGCAGATGGAATGGGG - Intergenic
954966350 3:54614586-54614608 CTGGGGAATGAGAAGGAAGGAGG - Intronic
955307166 3:57845334-57845356 ATGGGTGCTCAGAAGGGAGGTGG + Intronic
959190517 3:103104582-103104604 CTGGGTTTAAAGATGGAAGGAGG + Intergenic
959885808 3:111498054-111498076 CTGATTCTTCAGATGGAAGGTGG - Intronic
960221418 3:115113859-115113881 CTGGTTGAGCAAATAGAAGGTGG - Intronic
960978692 3:123201839-123201861 CTGGGTGAGCTGAGGGAACGGGG + Intronic
961105168 3:124234723-124234745 CTGGGTGATCAGACAGAAATAGG - Intronic
961390619 3:126550492-126550514 CTGGGAGATGGGCTGGAAGGAGG - Intronic
961689227 3:128656416-128656438 CTGGGTGTTCATATGGAAGAAGG + Intronic
962423569 3:135249458-135249480 CTGGGTGACCAGCTGGAGGGAGG - Exonic
962433591 3:135344474-135344496 CTTGGTTGCCAGATGGAAGGGGG - Intergenic
963085368 3:141430849-141430871 CTGGCTGATTGAATGGAAGGTGG - Intronic
964276151 3:155010950-155010972 GTGTGTAAGCAGATGGAAGGAGG - Intergenic
966228324 3:177622491-177622513 CTAGGTGATGACATGGAAGTAGG + Intergenic
966505521 3:180696948-180696970 TTGGGTGATGAGGTGGTAGGTGG + Intronic
968507981 4:980769-980791 CTGGCTGATAAGAGGGAAGGAGG - Intronic
969102905 4:4783324-4783346 CTGCGTGATGAGATGAAGGGAGG - Intergenic
969471466 4:7391818-7391840 CTGGGTGAGGGGCTGGAAGGAGG - Intronic
970490209 4:16564406-16564428 ATGGGTGGTTAAATGGAAGGAGG - Intronic
970889869 4:21031072-21031094 CTTGGAGACCAGATGGAAGATGG - Intronic
973223478 4:47755312-47755334 CTGGGCCATGAGATGGAAGGGGG - Intronic
975126579 4:70789027-70789049 CTGGAGGATCAGATGGGAGGAGG - Intronic
975950661 4:79766644-79766666 TTGGGTGATGAGAAGGAAAGAGG + Intergenic
980903296 4:138925458-138925480 CTGGGAGATCAGATGGATTAAGG + Intergenic
982765953 4:159348435-159348457 CTTGCTGATCAGATGGAATGAGG - Intronic
983998429 4:174213511-174213533 CAGGGGGCTCAGTTGGAAGGTGG + Intergenic
986122407 5:4853706-4853728 ATGGCTGATCAGACGGGAGGTGG + Intergenic
990091261 5:52052700-52052722 CTGTGTTCTCACATGGAAGGAGG + Intronic
990785501 5:59414314-59414336 TTGGGTGGCCTGATGGAAGGAGG - Intronic
993064497 5:83080690-83080712 CTTGGTTATCAGATTGATGGAGG + Intronic
995254927 5:110035210-110035232 CTGGGTGCTCAGAAGGCTGGTGG + Intergenic
995970467 5:117964154-117964176 AAGGCTCATCAGATGGAAGGTGG - Intergenic
998674556 5:144392502-144392524 CTGTGTGACCAGATGAGAGGTGG + Intronic
999627473 5:153535775-153535797 CTGGGTGATTAGGTGGATTGTGG - Intronic
999836067 5:155374355-155374377 TTGGGTGGTAGGATGGAAGGAGG - Intergenic
1000578725 5:163009418-163009440 CTGGGTGATCTATTAGAAGGAGG - Intergenic
1001812374 5:174638815-174638837 CTTGGTGGTCAGCTGAAAGGAGG - Intergenic
1001815875 5:174669089-174669111 CCAGGTGACCAGATGGATGGTGG + Intergenic
1002058583 5:176612726-176612748 CTGGATGCTCAGGTGGAAGGTGG + Intergenic
1002424955 5:179169484-179169506 CTGGGTGAGGAGGTGGATGGAGG + Intronic
1002944172 6:1745096-1745118 CTGCGGGATTAGATGTAAGGGGG + Intronic
1004484958 6:16057711-16057733 CTGTTTGACGAGATGGAAGGAGG - Intergenic
1005875097 6:30005300-30005322 CTGAGTGATAAGAGGGACGGAGG + Intergenic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1007590767 6:43019494-43019516 GTGGGAAATGAGATGGAAGGAGG + Intronic
1012451469 6:99356556-99356578 CTGGGTGATCAGATGCCACATGG + Intergenic
1013182863 6:107732683-107732705 CTGCGAGATCATATGGAGGGTGG - Intronic
1014735000 6:125083036-125083058 CTGGGAGATGAGATGGTAGAAGG - Exonic
1014987594 6:128030672-128030694 CTGGCTGATCAGATAGCAGCTGG + Intronic
1015321550 6:131880942-131880964 CTGGGTGCTCTGGTAGAAGGAGG + Intronic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1016286429 6:142478280-142478302 CTGTGTCATCACATGGCAGGAGG - Intergenic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1017713881 6:157194017-157194039 TTGGCCAATCAGATGGAAGGGGG + Intronic
1019400953 7:853541-853563 CGGGTGGACCAGATGGAAGGCGG + Exonic
1019513274 7:1429052-1429074 CTGGGGCATCAGGTGGGAGGTGG - Intronic
1019844159 7:3480237-3480259 CTGGCTGTGAAGATGGAAGGGGG + Intronic
1019920043 7:4157540-4157562 GTGGGTGGGCAGATGGAAGCGGG + Intronic
1022322856 7:29303475-29303497 CTGGGAAATAAGAGGGAAGGGGG - Intronic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1023267299 7:38420630-38420652 CTTTGTGATAAGATGAAAGGCGG + Intronic
1024255868 7:47539644-47539666 CTGGGAGGTCAGATGGGGGGCGG - Intronic
1024723258 7:52162564-52162586 CTGGCTGATCAGCCGGAAGATGG - Intergenic
1027153325 7:75748694-75748716 TTTGGTTATAAGATGGAAGGAGG + Intergenic
1028318981 7:89437173-89437195 GTGGGTGCCAAGATGGAAGGGGG - Intergenic
1029534024 7:101145311-101145333 CTGGGTTATCAGGAGGGAGGAGG - Intergenic
1030116868 7:106068668-106068690 CTGGGAGAGCAGGTGGGAGGTGG - Intergenic
1030129632 7:106187732-106187754 CTGGGTTAGCAGATTGAATGCGG - Intergenic
1030292928 7:107890132-107890154 CTTTGTAATCAGATGGAATGAGG + Intergenic
1032499972 7:132392914-132392936 CTGGGTGCTCAGATGGACACAGG - Intronic
1032506986 7:132442999-132443021 AGGGGTGTTCAGATGGAAGCTGG - Intronic
1034071154 7:148186984-148187006 CAGGGTGATAAGATAGAAAGAGG - Intronic
1035094586 7:156343144-156343166 GTGGGAGCTCAGATGGCAGGTGG + Intergenic
1035242175 7:157539458-157539480 CAAGATGATCACATGGAAGGCGG - Exonic
1035705086 8:1669253-1669275 CTGGGGGCCCAGATGGACGGCGG - Intronic
1036532992 8:9614022-9614044 CTGAGTGATCACATGCAAAGGGG - Intronic
1036917644 8:12820203-12820225 CTGGGTCTTCACATGGCAGGAGG + Intergenic
1036945718 8:13092635-13092657 CAGGGTGTTGAGATGGAAGAGGG + Exonic
1037769605 8:21790624-21790646 CTGGGGGAGAAGATGGAGGGAGG - Intronic
1040425527 8:47281261-47281283 CTGACTGATCAGATGGTTGGTGG + Intronic
1041097718 8:54365950-54365972 CTGGGTGCTCAGAGGTAAAGGGG + Intergenic
1041714249 8:60919825-60919847 CTGCATCATCACATGGAAGGGGG + Intergenic
1044457368 8:92403828-92403850 CTGGGGGATCTGAGTGAAGGGGG - Intergenic
1045314984 8:101035806-101035828 CTGGGAGATTAGAAGGCAGGAGG - Intergenic
1045385526 8:101667960-101667982 CTGGGCCACCAGATGGAAAGGGG + Exonic
1048979783 8:139697083-139697105 GTGGGTGAACAGATGGATGGTGG + Intronic
1048979801 8:139697168-139697190 GTGGGTGGACAGATGGATGGTGG + Intronic
1049210432 8:141384038-141384060 TTGGGTGATCTGCAGGAAGGAGG + Intergenic
1049294816 8:141826850-141826872 CTCGGAGATGAGAGGGAAGGGGG + Intergenic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1050704726 9:8384244-8384266 CTGGGCAACCACATGGAAGGAGG - Intronic
1051347420 9:16164786-16164808 CTGGGGGCTCTGAGGGAAGGAGG - Intergenic
1052538326 9:29776308-29776330 CTGAATGCTAAGATGGAAGGAGG - Intergenic
1052865696 9:33463528-33463550 GAGGGTGGTCAGATGGAAGGAGG - Intronic
1052969699 9:34369930-34369952 CTGGATGATCTGGAGGAAGGGGG - Exonic
1053168772 9:35863505-35863527 CTGGGACATCAGATAGAAGCTGG + Intergenic
1053260963 9:36663521-36663543 AAGGGTGAGGAGATGGAAGGGGG - Intronic
1058445791 9:105053776-105053798 CTGAGTGAGGAGATGGGAGGAGG - Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1062465406 9:136678599-136678621 CTGGGGGATCAAATGGTGGGGGG - Intronic
1188686299 X:33074683-33074705 CTGGGGCATCACATGGCAGGAGG - Intronic
1189288981 X:39871927-39871949 GTGGGTGGGCTGATGGAAGGAGG + Intergenic
1191223610 X:58016810-58016832 TTTGGTGATCAGATGGAGGCAGG - Intergenic
1192221047 X:69197581-69197603 ATGGGTGCTCGGGTGGAAGGCGG - Intergenic
1194106014 X:89768045-89768067 GTGGATGATAAGCTGGAAGGGGG - Intergenic
1195330953 X:103799867-103799889 CTTGGTGTTCAGATGGATGCGGG + Intergenic
1195446417 X:104957455-104957477 CTGGGGGTTCAGAGGGAGGGAGG + Intronic
1195756752 X:108206216-108206238 ATGGGTGAGGAAATGGAAGGTGG + Intronic
1196251056 X:113460465-113460487 GTGAGGGCTCAGATGGAAGGGGG - Intergenic
1198911825 X:141623511-141623533 CTGTGTCTTCACATGGAAGGTGG - Intronic
1199205256 X:145141124-145141146 CTGGGAGATCACACGCAAGGAGG - Intergenic
1200457970 Y:3415904-3415926 GTGGATGATAAGCTGGAAGGGGG - Intergenic
1201900896 Y:19045473-19045495 ATGGGAGAACAGATGGATGGAGG + Intergenic