ID: 1104510010

View in Genome Browser
Species Human (GRCh38)
Location 12:129368711-129368733
Sequence CTGTTGGTAAGGAGGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 1, 2: 4, 3: 59, 4: 447}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104510010 Original CRISPR CTGTTGGTAAGGAGGAAAGA GGG (reversed) Intronic
900526652 1:3132578-3132600 CCCTCGGTAAGGAGGAAGGAAGG - Intronic
900526845 1:3133556-3133578 ATCTTGGTAAGGAGGAGGGAAGG - Intronic
900650747 1:3729053-3729075 CTGTTGGTAGGGGAGGAAGAGGG + Intronic
901421121 1:9151836-9151858 CTGTTGATAAGAAGGAAATGTGG + Intergenic
901943901 1:12685306-12685328 CTGTTTGAAAGGTGGAAGGAGGG - Intergenic
902046410 1:13528019-13528041 ACGTTGGTAAGCAGGAGAGAGGG - Intergenic
902689507 1:18101366-18101388 CGGTTGGAAGGGAGGAAGGAAGG - Intergenic
903651494 1:24925250-24925272 CGGTTGGCAGGGAGGAAGGAGGG - Intronic
904336480 1:29801511-29801533 GTATTTGTAAGGAAGAAAGAGGG - Intergenic
904493451 1:30874098-30874120 ATATTGGGAAGGAGGAAAGTTGG + Intronic
905045793 1:34999794-34999816 CTGTTGGTAGGGATAAAAGTTGG + Intronic
905102200 1:35534046-35534068 CTTTTGAAAAGGAGGAGAGAGGG - Intronic
905307559 1:37030058-37030080 CAGTTGAGAAGGAGGAAAGCTGG + Intronic
905655790 1:39685089-39685111 CTATTTGTATAGAGGAAAGAGGG - Intronic
905866512 1:41379779-41379801 CTGGTGGGAAGGAGGCAGGAGGG + Intronic
906065600 1:42978258-42978280 CTGTTGGGAAGAAGGAAGGAAGG - Intergenic
906066572 1:42985251-42985273 GTCTTGGGAAGGAGGAAAGCCGG - Intergenic
907392777 1:54169096-54169118 CTGTTGGGGAGGGAGAAAGAAGG + Intronic
907661460 1:56396593-56396615 CTGTTGGTGTGTAGGAGAGAAGG - Intergenic
907711731 1:56889330-56889352 CTGTTTGTCAAAAGGAAAGAAGG - Intronic
908177382 1:61569230-61569252 CTGTTAACAAGGAGGAAAGTCGG + Intergenic
908815100 1:68023630-68023652 CTGTAAGGAAGGAGGAACGAAGG + Intergenic
909261429 1:73494142-73494164 CTCTTGGTTAGAAGAAAAGATGG - Intergenic
909488533 1:76200852-76200874 GTGGTGGTAAGGAGGCAGGATGG + Intronic
909867425 1:80690964-80690986 CAGGTGGTTAGGAGGGAAGAAGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910560501 1:88584848-88584870 TTATTGATAAGAAGGAAAGAAGG - Intergenic
910738056 1:90484011-90484033 CTGTTGGTAGGGATGTAAAATGG + Intergenic
910847899 1:91621415-91621437 GTGGTGGAAAGGAGGAAGGAGGG - Intergenic
913970031 1:143407837-143407859 TTGTTGGTAATGAGCAAAAAAGG - Intergenic
914064405 1:144233434-144233456 TTGTTGGTAATGAGCAAAAAAGG - Intergenic
914114745 1:144732920-144732942 TTGTTGGTAATGAGCAAAAAAGG + Intergenic
915184056 1:154089227-154089249 CTGTTGGTAAGAATGTAAAATGG + Intronic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915646826 1:157278543-157278565 CTGTTAGGAAGGAGGAAAATCGG + Intergenic
916962509 1:169903582-169903604 CTGGGGGTAAGGAGGAATGGGGG + Intergenic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
917511645 1:175674046-175674068 CTGGTGGCAAAGAGGAAACAAGG + Intronic
917624543 1:176832303-176832325 TTGTTGGTAAGGAGCAGAGCTGG + Intronic
917926692 1:179795051-179795073 CTCTTGGCAAGGTGGTAAGAAGG + Intronic
917962917 1:180158577-180158599 CTGTCAGCAAGGAGGAAGGAAGG + Intronic
918337078 1:183527138-183527160 CCATTGGTAAGAAAGAAAGAAGG - Intronic
918429454 1:184443872-184443894 CTGCTGGGGAGGAGGTAAGAAGG + Intronic
919935669 1:202248944-202248966 CAGTTGGGAAAGAGGAGAGAAGG + Intronic
920264963 1:204714985-204715007 CTGTTGGGAGGTGGGAAAGAGGG - Intergenic
920502024 1:206491488-206491510 CTCTGGGAAAGGAGGAAGGACGG - Exonic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
920880552 1:209876462-209876484 ATGGTGGTAAAGAGTAAAGAAGG + Intergenic
921691677 1:218158094-218158116 CTGTAGGTAAGGTAGAAAGAAGG + Intergenic
922519788 1:226239763-226239785 TTGTTGGTAAGGAGCATATATGG - Intronic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923002926 1:230022704-230022726 CAGTTGGTAAGCAGGAGGGAGGG - Intergenic
923099495 1:230801057-230801079 CTGTTGGGAAGGAGGAGGCAGGG + Intronic
923367104 1:233273497-233273519 CAGTTGGATAGAAGGAAAGAAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923909217 1:238421181-238421203 CTGTTGGAAGGAAGGAAGGAAGG + Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
1063001764 10:1931278-1931300 CTGTTGCTAAGGTGGAAAGCGGG - Intergenic
1063914515 10:10867939-10867961 CATTTGGTAAGAAAGAAAGAAGG - Intergenic
1063929009 10:11010395-11010417 CAGTTGGAAAGGAAGAGAGAAGG - Intronic
1064161335 10:12949165-12949187 CTTTTACTAAGGAGGAAACAAGG - Intronic
1064630521 10:17306210-17306232 CTGTCGGGAAGGAGGAAGGGAGG - Intergenic
1065062121 10:21913151-21913173 CTGTTAGTAATGAGAAAAGATGG + Intronic
1065941073 10:30564309-30564331 CTGGTGGTATTGTGGAAAGAGGG + Intergenic
1065990709 10:31006880-31006902 CATTTGGTAAGGCGGAATGAAGG + Intronic
1066641308 10:37556999-37557021 CCGTTGGTAAGGAGGTAACTGGG - Intergenic
1066651811 10:37663349-37663371 CTGTTGGCAAGGAAGACAGCAGG - Intergenic
1067035567 10:42913664-42913686 CTGTTGGCAAGGAAGACAGCAGG - Intergenic
1067300689 10:45006060-45006082 GTGTGTGGAAGGAGGAAAGAGGG + Intergenic
1067464953 10:46490906-46490928 CTGGTGGTGGGGAGGAAAGATGG - Intergenic
1067622236 10:47893695-47893717 CTGGTGGTGGGGAGGAAAGATGG + Intergenic
1068496099 10:57786948-57786970 ATGTGGGTAAGAAGGAAAGGAGG - Intergenic
1068636465 10:59353475-59353497 CTTTTGGTAAGGAAGCATGAGGG - Intronic
1068668582 10:59701423-59701445 CTGTGGGTAATGAGGAACCATGG - Intronic
1071138161 10:82476249-82476271 CTGCTGGTAAGGATGTAAAATGG + Intronic
1071508524 10:86247095-86247117 CTGATGGTCAGAAGGACAGATGG + Intronic
1073113959 10:101080484-101080506 CTGGTGGTTAGCAGGAAGGAAGG - Intergenic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1074924464 10:118053253-118053275 CTGTTGGAAGGAAGGAAGGAAGG - Intergenic
1075219328 10:120570940-120570962 CTGTCTGTGAGTAGGAAAGATGG - Intronic
1076319119 10:129565061-129565083 GTCTTGGGAAGGGGGAAAGAGGG + Intronic
1076454345 10:130579044-130579066 CTGGAGGGAAGCAGGAAAGAGGG - Intergenic
1076823459 10:132954209-132954231 CTGTTGGTAATTAAGAAAAATGG + Intergenic
1078922959 11:15847661-15847683 CTGTTGTTAAGTGAGAAAGAAGG - Intergenic
1079329581 11:19522498-19522520 CGGCTGGTGAGGAGGGAAGAAGG - Intronic
1080252059 11:30244524-30244546 CTGTTGCTAAGGAGGCAAGGTGG - Intergenic
1080444457 11:32325224-32325246 CCGCTGGGAAAGAGGAAAGAAGG + Intergenic
1080703288 11:34664390-34664412 GGGATGGTAGGGAGGAAAGAGGG - Intergenic
1080892610 11:36422422-36422444 CTGTTGGGAAAGGTGAAAGATGG + Intronic
1081430408 11:42970480-42970502 CTCTTGAAAGGGAGGAAAGAAGG - Intergenic
1081688706 11:45060419-45060441 ATGGTGGAAAGGAGGAAGGAAGG + Intergenic
1081949103 11:47027450-47027472 CTGCTGCTAAGGAAGAAAGACGG - Intronic
1082189964 11:49231193-49231215 ATGGTGGGAGGGAGGAAAGAAGG + Intergenic
1082799741 11:57405880-57405902 CTGTTGGTAGGAGGTAAAGAGGG + Intronic
1082988702 11:59189060-59189082 CTGCTGGAAAGGAGGAGAGTAGG + Intronic
1083413876 11:62512849-62512871 CTGTTAGGAAGAAGGAAGGAAGG + Intronic
1083958288 11:65999251-65999273 CCCTATGTAAGGAGGAAAGAAGG + Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1086582485 11:88415076-88415098 CTGGTGGCAAGGAGAAAAAAGGG + Intergenic
1086676564 11:89615349-89615371 ATGGTGGGAGGGAGGAAAGAAGG - Intergenic
1087075654 11:94125196-94125218 CTGCTGGATAGGAGCAAAGAAGG - Intergenic
1087466411 11:98512250-98512272 CTATTGGTGAGGAGGTAAAATGG - Intergenic
1088541955 11:110921925-110921947 CTCCTGGTTAGGAGGAAGGAGGG - Intergenic
1088634039 11:111802114-111802136 AAGTTGGTAAGGAGGGAAGTTGG - Intronic
1089777967 11:120852231-120852253 CTGCTGCTGAGGAGGTAAGAGGG + Intronic
1090432944 11:126661990-126662012 GTTTGGGTAAAGAGGAAAGAAGG + Intronic
1091541412 12:1465919-1465941 CTGGTGCCAAGTAGGAAAGATGG + Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093288036 12:17290036-17290058 CTGTCTGTAAGGCAGAAAGAGGG - Intergenic
1093428618 12:19057752-19057774 CTGATGGTGACAAGGAAAGAAGG - Intergenic
1094008471 12:25781571-25781593 ATGTTGGGAAGGAGGGAGGAGGG - Intergenic
1094812449 12:34151689-34151711 ATGTTGGGAAGGAGGGCAGAGGG - Intergenic
1096272035 12:50173063-50173085 CTGTTGGTAAAGCAGAAAAAGGG - Intergenic
1096908136 12:54955033-54955055 CTGTTGGTAAGAATGTAACATGG - Intronic
1099270430 12:80502174-80502196 AGCTTGGAAAGGAGGAAAGAGGG + Intronic
1100666649 12:96761064-96761086 CTGCTGGTAAGGATGTAAAATGG - Intronic
1101220779 12:102637580-102637602 CTATAGGTAGGGAGGAAGGAGGG - Intergenic
1101348527 12:103907058-103907080 CTGTTGGAAGGGAGGAAGGAAGG + Intergenic
1102188514 12:110968158-110968180 CTCATGCTAAGGATGAAAGAAGG - Intergenic
1102531571 12:113550455-113550477 CTGATGGTAAGGTGGAAGGATGG - Intergenic
1102620644 12:114191906-114191928 CTGTTGGTAAGAAAAAAAAAAGG + Intergenic
1102970458 12:117162071-117162093 CTCTTGGGGAGGAGGAAAGGTGG + Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1107858535 13:44638834-44638856 CTATTAGTAAGGAGGAAGAAGGG + Intergenic
1107914065 13:45131424-45131446 TTGTTGTTAAGTATGAAAGATGG + Intronic
1108602614 13:52007728-52007750 CAGTTGGTCAGGAGTACAGATGG - Intronic
1108980660 13:56508820-56508842 CTGCAGGTAGGCAGGAAAGAAGG + Intergenic
1110152582 13:72273273-72273295 CTGTTGAAAAGAAGGAAAGGAGG + Intergenic
1110215658 13:73021832-73021854 TTTTTTGAAAGGAGGAAAGAGGG + Intergenic
1110560127 13:76902288-76902310 CTGATGGTCAAGAGGAAAGCGGG + Intergenic
1110598018 13:77340316-77340338 CAGTTGGTATAGAGAAAAGAGGG + Intergenic
1111331450 13:86764656-86764678 TTGTTGGGGAGGAGGAAAGCGGG + Intergenic
1111371103 13:87318831-87318853 GTGTTGGAAAGAAGGAAGGATGG + Intergenic
1111681904 13:91452425-91452447 CTGTTTGCAAGGAGGAATGTTGG + Intronic
1111809826 13:93085983-93086005 TTGTTGGTAGGGATGTAAGATGG + Intergenic
1112300738 13:98227517-98227539 CTGTTGGTGAGAATGTAAGATGG + Intronic
1114039815 14:18667328-18667350 CTGTTGGTAAGCAGTCAAGATGG - Intergenic
1114044856 14:18865878-18865900 CTGTTGGTAAGCAGTCAAGATGG - Intergenic
1114119367 14:19653644-19653666 CTGTTGGTAAGCAGTCAAGATGG + Intergenic
1114154378 14:20084265-20084287 CTGTTGGTAGGGATGTAAGTTGG + Intergenic
1115221640 14:31063996-31064018 CTGGTGGTCATGATGAAAGAAGG + Intronic
1115629803 14:35232971-35232993 CTGTTGTAAAAGAGGAAGGAGGG - Intronic
1115710215 14:36042244-36042266 CTGTTGGTCAGAAGGAAGAATGG - Intergenic
1115834026 14:37377274-37377296 CAGTAGGGGAGGAGGAAAGAGGG + Intronic
1117025567 14:51616547-51616569 CTGCTGCTGAGGAGGAAAAAAGG - Intronic
1117091850 14:52259124-52259146 GTGTTGATAAGGAAGAAAGGGGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117485717 14:56194792-56194814 CTGGTGGAAAGGAGGCTAGAAGG - Intronic
1117990584 14:61429118-61429140 CTGTTGGTCTGGAGAATAGAAGG + Intronic
1120216526 14:81686567-81686589 CTGTTAGTAAGGAAAACAGAAGG + Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1122061106 14:99137247-99137269 CTGTAGCCCAGGAGGAAAGACGG - Intergenic
1123539312 15:21272242-21272264 ATGCTGGAAAGGAGGAAGGAAGG - Intergenic
1123702223 15:22923508-22923530 CTGCTGGTAAGAAGGAGAAATGG + Intronic
1124103761 15:26718661-26718683 CTGCTGCTAAGGAGGAAAGGTGG - Intronic
1125499661 15:40231567-40231589 TTGTTGGGAAGGAGAAAGGAAGG + Intergenic
1125698450 15:41659537-41659559 CAGCTGGTAAGGAGTAGAGAAGG + Intronic
1125895604 15:43299370-43299392 GTGTTGGTAAGAGGAAAAGAAGG + Intronic
1126069231 15:44851253-44851275 CTGTTGACAATGAGGAAAGAAGG - Intergenic
1126089582 15:45039519-45039541 CCGTTGACAATGAGGAAAGAAGG + Intronic
1126376324 15:48000535-48000557 CTGCTGGGGAGGAGGAGAGAAGG - Intergenic
1126463991 15:48943957-48943979 CTGTTAGTAAGGTAGAAAGAGGG + Intronic
1126464033 15:48944284-48944306 CTGTTAGTAAGGAAGAATGAGGG - Intronic
1127608475 15:60614290-60614312 CTGCTGGGGAGGAGGAAGGAAGG + Intronic
1128530860 15:68446603-68446625 CTGTTGGGAAGGAAGAAAGAAGG + Intergenic
1128538824 15:68510900-68510922 GTGATGGGAAGGAGGAATGAGGG - Intergenic
1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG + Intergenic
1128890546 15:71328021-71328043 CTATTGTAATGGAGGAAAGAAGG - Intronic
1128932671 15:71719500-71719522 ATTTTGGTCAGAAGGAAAGAAGG + Intronic
1129766868 15:78175153-78175175 CTGTTGGACAGAAGGAAAGAAGG - Intronic
1130198699 15:81805425-81805447 ATGGTGATAAAGAGGAAAGATGG + Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1132279694 15:100602441-100602463 CCGGGGGTAAGGAGGAGAGAAGG + Intronic
1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG + Intronic
1133556493 16:6910898-6910920 CTGTTAGTAAAGAGGAAGGAGGG + Intronic
1134185198 16:12079532-12079554 TTGTTGCTAAGGAAGGAAGAAGG + Intronic
1135166817 16:20146464-20146486 TTCTTGGGAAGAAGGAAAGAAGG + Intergenic
1138661343 16:58519888-58519910 CTGGTGGTGAGGAGGAAAAGTGG - Intronic
1138870897 16:60883224-60883246 CTGTTGATCAGGGGGAGAGAAGG + Intergenic
1139014551 16:62674409-62674431 CTGTTGGTAAGAATGCAAGCTGG - Intergenic
1139029828 16:62866522-62866544 CTGTTAATAGGGAAGAAAGAAGG + Intergenic
1139327233 16:66161863-66161885 TAGTTGGTAAGGGGAAAAGAAGG + Intergenic
1139715341 16:68808976-68808998 CTGTTGCTAAGGAGAAGTGATGG + Intronic
1141024925 16:80537484-80537506 ATGCAGGGAAGGAGGAAAGATGG + Intergenic
1142612436 17:1116666-1116688 CAGTTGGGAAGGAGGTAAGTCGG - Intronic
1143847218 17:9781595-9781617 CTGTGGGGAAGAAGGAAACAGGG + Intronic
1145931583 17:28689829-28689851 CTGTTAGAAAGGAGGAAAGGGGG - Intronic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1147770876 17:42867125-42867147 CTGCTGGTCAAGAGGAATGATGG - Intergenic
1148386096 17:47236290-47236312 CAGTTGGGAAGGTGGAATGAGGG + Intergenic
1148846274 17:50532024-50532046 CTGTTTTTAAGGCAGAAAGATGG - Intergenic
1149232602 17:54553190-54553212 ATGCTGATAAGGAGGAAAGAGGG - Intergenic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150544988 17:66147110-66147132 CTGTTGGTAAGAATGTAAAATGG - Intronic
1150615450 17:66767349-66767371 CTGCTGGTACGGAGTGAAGACGG + Intronic
1150821181 17:68435713-68435735 CTGTTGGTGAAAAGGAAAAATGG + Intronic
1151212153 17:72552743-72552765 CACTCAGTAAGGAGGAAAGAAGG - Intergenic
1151240783 17:72756091-72756113 CTGTTGGTAGGAATGAAAAATGG + Intronic
1151489092 17:74421684-74421706 ATTTTGGGAAGGGGGAAAGAGGG + Intergenic
1153479810 18:5535856-5535878 CTGTTGTTGAGGACGAAGGAAGG + Intronic
1154284020 18:13034863-13034885 CTGTCGGCAAGGAGGAAGGCAGG - Intronic
1155385752 18:25275645-25275667 CTGATGGGGAGAAGGAAAGAGGG - Intronic
1156612806 18:38747391-38747413 CTGGTGGTAAGGATGTAAAATGG + Intergenic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157347941 18:46857122-46857144 CTCTTGGTAAGGAGAACAGTGGG - Intronic
1157564786 18:48672640-48672662 CTGGAGGCAAGAAGGAAAGAGGG + Intronic
1157747290 18:50147033-50147055 CTGTCTGTAAGGAGACAAGATGG - Intronic
1158522610 18:58184179-58184201 CTGTTGGTAGGAGGGAATGAGGG + Intronic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1159991419 18:74913368-74913390 CTGTTAAAAAGGAGAAAAGAAGG + Intronic
1160191837 18:76721338-76721360 CTGTTTGTGGGGAGGAAAGGAGG - Intergenic
1160306796 18:77747565-77747587 CTGCGGGAAAGAAGGAAAGAGGG - Intergenic
1162827102 19:13259721-13259743 CTGTTAGTAAATGGGAAAGAGGG + Intronic
1163128032 19:15254968-15254990 CTTTGGGGAAGGAGGAAAGGCGG - Intronic
1163428379 19:17251705-17251727 CTGTTGCGAAGGAGAAGAGAGGG + Intronic
1163667347 19:18609623-18609645 CTGTTGGTAAGAACAAGAGAGGG - Intronic
1164588751 19:29494674-29494696 CGGGTGGTAAGGAGGGAAGAAGG + Intergenic
1164730966 19:30504298-30504320 CTGGTGGGAGGGAGGAAGGAAGG - Intronic
1164739401 19:30565324-30565346 ATGTTGCAGAGGAGGAAAGATGG + Intronic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1166316168 19:41991447-41991469 CTGTAGGGCAGTAGGAAAGATGG - Intronic
1167239666 19:48336037-48336059 ATATTGGTAAGGAGAAATGAGGG + Intronic
1167277992 19:48550407-48550429 CTGATGGTAAGCAGAAAAGGAGG - Intergenic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167894676 19:52571293-52571315 CTGGTGGCAAGGAGAACAGAGGG + Intronic
1167903152 19:52637342-52637364 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167909326 19:52689446-52689468 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167925848 19:52820593-52820615 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167930034 19:52856582-52856604 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167934169 19:52892814-52892836 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167937845 19:52922371-52922393 CTGGTGGCAAGGAGAACAGAGGG - Intergenic
1167995221 19:53396172-53396194 CTGGTGGCAAGGAGAACAGAGGG + Intronic
1167999479 19:53432968-53432990 CTGGTGGCAAGGAGAACAGAGGG + Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
925705439 2:6680566-6680588 GAGGTGGTAAGGAGGAGAGATGG + Intergenic
926918927 2:17919908-17919930 AGGTTGGTAAGGAGGAGACATGG + Intronic
927299852 2:21499725-21499747 CTGTTGGTAAGAATGTAAAATGG + Intergenic
927486338 2:23490913-23490935 CTGATGTAAAGAAGGAAAGAGGG - Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928419171 2:31124207-31124229 CAGTTGGCAAGCAGGAAAGATGG - Intronic
929920378 2:46167395-46167417 CTGTTGGTGAGGAGGACAACAGG + Intronic
931618905 2:64190255-64190277 CAGTTGGTAAGGAACTAAGAAGG - Intergenic
931632670 2:64315520-64315542 GAGTTGGCCAGGAGGAAAGATGG + Intergenic
932239840 2:70147965-70147987 CTATCTTTAAGGAGGAAAGAAGG - Intergenic
932745777 2:74332395-74332417 CAGTTGAAAAGCAGGAAAGAAGG - Intronic
934174720 2:89568742-89568764 TTGTTGGTAATGAGCAAAAAAGG - Intergenic
934285037 2:91643094-91643116 TTGTTGGTAATGAGCAAAAAAGG - Intergenic
934563317 2:95324102-95324124 CTGTGGGGAATGAGGAGAGATGG + Intronic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
935224573 2:101042173-101042195 ATGTTGATGAGGAGGAAAGAAGG + Intronic
935848486 2:107193016-107193038 CTGAGGGAAAGGAGGAAACAAGG + Intergenic
935980887 2:108625686-108625708 CTGCAGGAAAGGAGGAAAGGAGG - Intronic
936797849 2:116228572-116228594 CTTTTGGTAAGGTGGTAAAAGGG + Intergenic
936937357 2:117851207-117851229 CAGTGGGTGAGGAAGAAAGATGG + Intergenic
937599781 2:123717373-123717395 CTTTTGGTAAGAAGGCAAAATGG - Intergenic
937997999 2:127709571-127709593 CTGTTGTGTAGGAGGAAGGAAGG - Exonic
938003910 2:127771771-127771793 CTGTTGGAAAGAAGGAAGGAGGG + Intronic
938052182 2:128184514-128184536 CTTTTGTTAGGGAGGAAGGATGG - Intronic
938270736 2:129968279-129968301 CTGTTGGTAAGCAGTCAAGATGG + Intergenic
938607962 2:132915785-132915807 CTGTTGGGAGTGGGGAAAGATGG + Intronic
939739529 2:145888167-145888189 CTGTTGTTCAGGAGAAAAGGTGG + Intergenic
940683032 2:156810036-156810058 CTGTGGATAAGGAGGACATACGG - Intergenic
941173416 2:162167477-162167499 CTGTTTGTAAAGAAGAAAGGAGG - Intergenic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941492028 2:166154248-166154270 CTCTTGGTAAGGAAGAAGGAAGG + Intergenic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
941772504 2:169360686-169360708 GTGTTGGTAACGCAGAAAGAGGG - Intronic
942290793 2:174468109-174468131 CAGTTGGCAATGAGGAAAGAAGG - Intronic
942364508 2:175209379-175209401 CAGGAGTTAAGGAGGAAAGAGGG - Intergenic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
943524767 2:189002971-189002993 CTGGTGGTAAAGGAGAAAGAGGG + Exonic
943548255 2:189308253-189308275 ATGATGGGAAGGAGGAAGGAGGG + Intergenic
944130004 2:196337432-196337454 CTGTTCATAAGCAGGAGAGATGG + Intronic
944319110 2:198315541-198315563 CTGTTGGTGAGGAGAAAAACTGG + Intronic
944443774 2:199769168-199769190 CTGTGGGAAAGGATGAAAAATGG - Intronic
944678476 2:202054252-202054274 CTGTTTGTTAGGGGGAAAGAAGG + Intergenic
945281634 2:208040923-208040945 ATGTTGCTAGGGAGGAAAAAAGG - Intergenic
947264931 2:228267940-228267962 CTGTTGGACAAAAGGAAAGAAGG + Intergenic
947368466 2:229420811-229420833 CTGTTGGTAGGAAGGTAAAATGG + Intronic
947389580 2:229625376-229625398 ATGTTGGTAAGGATGTGAGAAGG - Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1170346477 20:15392564-15392586 CTGTTGGTAAAGAGGCATGATGG - Intronic
1170463631 20:16602297-16602319 TAGTTGGAAAGGAGGAGAGATGG + Intergenic
1170621609 20:18001122-18001144 GTGTTAGTGAGGAGAAAAGATGG - Intronic
1170857867 20:20074092-20074114 TTGTGAGTAAGGAGGACAGAAGG + Intronic
1172987334 20:39002412-39002434 CTATTGGTTAGGAGGGAAAATGG + Intronic
1174096558 20:48094127-48094149 CTGTTGGTGAGGATGTAAAAAGG + Intergenic
1174863410 20:54113702-54113724 CTCTTAGAAAGGAGTAAAGAAGG - Intergenic
1176949722 21:15030726-15030748 TAGGTGGTAAGGAGGGAAGAAGG + Intronic
1177518173 21:22181707-22181729 CTGTTGGTGAGAAGGCAACATGG - Intergenic
1178232798 21:30806155-30806177 CGATGGGTGAGGAGGAAAGAAGG + Intergenic
1178260017 21:31090134-31090156 CTGTTGGTAGGAAGGTAAAATGG - Intergenic
1178267033 21:31152994-31153016 TTGTTGGTAAAGAGGAAAAATGG - Intronic
1179232299 21:39515776-39515798 ATGATGGTAAGGAGGGATGATGG + Intergenic
1179474314 21:41633495-41633517 CTGCTGGGGAAGAGGAAAGAGGG + Intergenic
1179602700 21:42490860-42490882 CTTTTGGTAAAGAAGAAGGAAGG + Intronic
1180463379 22:15588438-15588460 CTGTTGGTAAGCAGTCAAGATGG - Intergenic
1181161164 22:20960748-20960770 GTGTGGGCAAGGAGGTAAGATGG - Intergenic
1181897177 22:26120528-26120550 CTATGGGCAAGGGGGAAAGAAGG + Intergenic
1182803672 22:33052461-33052483 CTGTTTGGGAGGAGGAAAGGAGG + Intronic
1184162350 22:42704541-42704563 CTGTTTGTAAGAAGGGCAGAAGG + Intronic
1184704222 22:46199234-46199256 CTGTTGGTAAGAGGGAAGGATGG + Intronic
949491628 3:4594819-4594841 CGATTGGTAAGGAAGAAAGGTGG + Intronic
951095672 3:18626987-18627009 CTGTTGGTTGGGAGGTAAAATGG + Intergenic
951844065 3:27066436-27066458 CTGTTAGCAAAGAAGAAAGAAGG + Intergenic
951844723 3:27073049-27073071 CTATTGGAAAGCAGGAAAGCAGG + Intergenic
953060214 3:39421728-39421750 CTGTTAGTATGGAAGAAAGGAGG - Intergenic
953196353 3:40738026-40738048 CTGGTGGTCAGGAGAAGAGAAGG + Intergenic
953228369 3:41041878-41041900 CTGTTGGAAAGGAGGAGGAAGGG + Intergenic
954049358 3:47960384-47960406 CTGTTGATGAGGAAGACAGAGGG - Intronic
954512843 3:51142808-51142830 CTGTTGGTAAGAATGCAAAATGG - Intronic
954515859 3:51175751-51175773 CTTTTGGTACAGAGAAAAGAAGG + Intronic
956403415 3:68903904-68903926 GGGATGGAAAGGAGGAAAGAGGG - Intronic
957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG + Intronic
959010994 3:101076189-101076211 CTGTTGGAAAGTAGAAAAGAAGG - Intergenic
960183627 3:114612115-114612137 CTTTTGGAAAGAAGCAAAGATGG - Intronic
960410804 3:117321964-117321986 CTGTTGGTAAGTATGTAAAATGG + Intergenic
960421969 3:117457627-117457649 CAGTGTGTAAGGAGGAATGAAGG + Intergenic
961756954 3:129133835-129133857 CTGTCTTTAAGAAGGAAAGAAGG + Intronic
963694161 3:148543657-148543679 CTGCTGGTAAGGATGTAAAATGG - Intergenic
963819873 3:149878294-149878316 GTCTAGGTAAGGAGGAAAGATGG + Intronic
963873371 3:150444507-150444529 CTGTTGGCAAGAAAGGAAGAAGG + Intronic
965475028 3:169146588-169146610 CTGCGGGCGAGGAGGAAAGAAGG + Intronic
967236899 3:187393789-187393811 ATGCTGGTAAGAAGGGAAGAAGG - Intergenic
969387905 4:6868430-6868452 CTGTTGGAAAGGAGGATCGCTGG + Intronic
969828565 4:9777632-9777654 TTGTTGGTAATGAGCAAAAAGGG - Intronic
970396642 4:15674587-15674609 GAGTTGATAAGGAGAAAAGAAGG - Intronic
970613959 4:17750786-17750808 TTGTTGGCAAGGAAGAAGGAAGG - Intronic
970923160 4:21418636-21418658 CTTTTGGGAGGGAAGAAAGAAGG + Intronic
972734071 4:41823220-41823242 CTGAAGGTAAGGAGGAAAAAAGG + Intergenic
973016284 4:45142821-45142843 CAGTTGGAAGGAAGGAAAGAAGG - Intergenic
973016298 4:45142884-45142906 CAGTTGGAAGGAAGGAAAGAAGG - Intergenic
973758227 4:54095356-54095378 CTGTGGGTCAAGATGAAAGAGGG - Intronic
975004882 4:69271874-69271896 CTGCTGGTTAGGGGCAAAGAAGG - Intergenic
975013305 4:69380854-69380876 CTGCTGGTTAGGGGCAAAGAAGG - Intronic
975555994 4:75665203-75665225 TTGTTGGAAAGGAAGAAACAAGG - Intronic
975877699 4:78863613-78863635 GTGATGGCAAGGAGAAAAGAAGG + Intronic
976089944 4:81446750-81446772 CTTTTGGAAGGAAGGAAAGAGGG - Intronic
976756672 4:88506009-88506031 CTAGTGATAAGCAGGAAAGAGGG + Exonic
976991110 4:91367561-91367583 CTACTGGTAAAGAGCAAAGAGGG - Intronic
977516278 4:98024164-98024186 AAGTTGGTAAGGAGCCAAGATGG - Intronic
978821760 4:112974884-112974906 CTGCTTGAAAGTAGGAAAGAAGG + Intronic
979582821 4:122379825-122379847 CTGCTACAAAGGAGGAAAGAAGG - Intronic
979669643 4:123348599-123348621 CTATTGGGAAGGAAGAAAGAAGG + Intergenic
979916499 4:126441318-126441340 CTGTTACTAAGGAGGAGAGCTGG - Intergenic
980467900 4:133209299-133209321 CTGTTGGTAAGAAAGAATGTGGG - Intergenic
980727558 4:136784693-136784715 CAGATGGTAAGAAGAAAAGATGG + Intergenic
982660627 4:158202068-158202090 CTGTGGTTGAGGTGGAAAGAAGG - Intronic
982689551 4:158532480-158532502 CTGTTGGTCAGAAGGGGAGAAGG - Intronic
984343268 4:178486809-178486831 CTCTTAGTAAGGCAGAAAGATGG + Intergenic
984521724 4:180810138-180810160 CTGTTTGGAAGGATGAAAAAGGG + Intergenic
985208468 4:187566396-187566418 CTTATTGAAAGGAGGAAAGAAGG - Intergenic
986223849 5:5794747-5794769 CCGTTGGAAATGAGGAAAGAGGG + Intergenic
986318849 5:6611069-6611091 CTGCAGGTAATGACGAAAGATGG - Exonic
986749811 5:10776821-10776843 CTGGTGGGAATGAGGAAGGAGGG - Intergenic
988678391 5:33458065-33458087 ATGTTGGCAAGGAGGTAGGAGGG + Intronic
989171292 5:38472266-38472288 CTGTTGTCAAAGAGGTAAGAAGG + Intergenic
989209701 5:38846533-38846555 GTGTTGGGAGAGAGGAAAGAGGG - Intronic
990805458 5:59655669-59655691 CTGTTGATAAGTGGAAAAGAGGG + Intronic
991154656 5:63417521-63417543 CTGATGTTAAAGAGGCAAGAGGG - Intergenic
991362605 5:65836551-65836573 CTGTTAGGAAGGAGGAAAAAGGG - Intronic
991741948 5:69688955-69688977 CTTTTGGGAAGGTAGAAAGATGG + Intergenic
991755745 5:69866253-69866275 CTTTTGGGAAGGTAGAAAGATGG - Intergenic
991793522 5:70268695-70268717 CTTTTGGGAAGGTAGAAAGATGG + Intergenic
991821334 5:70564258-70564280 CTTTTGGGAAGGTAGAAAGATGG + Intergenic
991835072 5:70741401-70741423 CTTTTGGGAAGGTAGAAAGATGG - Intergenic
991885899 5:71268227-71268249 CTTTTGGGAAGGTAGAAAGATGG + Intergenic
992176559 5:74154945-74154967 CTGTAGGTGGGGAGCAAAGAGGG + Intergenic
993843621 5:92911481-92911503 ATGTAGATAAGCAGGAAAGAAGG - Intergenic
994070552 5:95597523-95597545 CAGTTGGTAACGAGTAAAGAGGG - Intronic
996188350 5:120507953-120507975 CTGATGTTAAGGAAGAAGGAGGG - Intronic
996682610 5:126244267-126244289 CTGTTGAAAATGAGAAAAGATGG - Intergenic
997383048 5:133450998-133451020 ATGATGGGAGGGAGGAAAGAAGG + Intronic
997406976 5:133656948-133656970 CTGTTGGTAAGAATTAATGATGG + Intergenic
997768330 5:136527282-136527304 CTATTGAAAAGGAGGAAAAAGGG - Intergenic
998426822 5:142035944-142035966 CTGTTGGTAAGAATGTAAAATGG + Intergenic
1000476800 5:161718577-161718599 CTGTTGGTAGGAATGAAAAATGG - Intergenic
1000724248 5:164749317-164749339 CTCTGAGTAAGGAGGAGAGAAGG - Intergenic
1001050427 5:168409588-168409610 CAGTTGGTGAGGAGGAAACAGGG - Intronic
1001568845 5:172717251-172717273 CTATTTGTAAGAAGGAAGGAAGG - Intergenic
1001720779 5:173855361-173855383 CTGTTGGCCAGGAGGGAAAAAGG - Intergenic
1001820624 5:174707391-174707413 TTGTTGGTAATGAGGAATGTTGG + Intergenic
1002297872 5:178241406-178241428 CTTCTGGGAAGGAGGAAGGAAGG + Intronic
1002309077 5:178303729-178303751 TTGATGGGAAGGAGGAGAGAAGG - Intronic
1002653038 5:180717777-180717799 CTGGTAGAAAAGAGGAAAGAGGG - Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1004129010 6:12901431-12901453 TTGGAGGAAAGGAGGAAAGAGGG + Intronic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005552351 6:26934958-26934980 CTTTTGGGAAGGTAGAAAGATGG + Intergenic
1007977291 6:46114450-46114472 ATGCTGATAAGGAGGAAAGAGGG - Intergenic
1010350638 6:74870219-74870241 CTGGGGGAAAGGAGGAAATAAGG - Intergenic
1010944864 6:81961887-81961909 CTGCTGGTAAGGATGTAAAATGG + Intergenic
1011011842 6:82711921-82711943 CTGTTAGGAAGGAAGAAGGAGGG - Intergenic
1011382973 6:86762493-86762515 AGGTGGGCAAGGAGGAAAGAGGG - Intergenic
1012397130 6:98811414-98811436 CTTCTGGTAAGGAGGAAGGGTGG - Intergenic
1013309668 6:108881321-108881343 CTGTTGGAAGGAAGGAAGGAAGG - Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1014997321 6:128165332-128165354 CTGTATGTAAAGAGGAAAAAGGG - Intronic
1015709130 6:136120542-136120564 CAGGTGGGAAGAAGGAAAGAAGG + Intronic
1015780066 6:136855807-136855829 CAGTTGGCAAAGTGGAAAGAGGG + Intronic
1016541223 6:145167941-145167963 CTGATGAAAAGGAAGAAAGACGG + Intergenic
1016848252 6:148590657-148590679 CTGGTGGGGAGGAGGAAATAAGG + Intergenic
1017307595 6:152937207-152937229 ATTTTGGTAAGGATAAAAGAAGG - Intergenic
1018453062 6:163926826-163926848 CTGTTGGCTGGGAGGAAACATGG + Intergenic
1019143066 6:169960487-169960509 CCGTTGGTAATTAGGAAACATGG + Intergenic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1019530820 7:1502474-1502496 CTGTTGGTAACCAGGAGGGAAGG + Intronic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020456865 7:8383870-8383892 CTGAGGGAAAGGGGGAAAGAAGG + Intergenic
1020883293 7:13791364-13791386 CTGTAGGCAGGCAGGAAAGAGGG - Intergenic
1022120468 7:27303178-27303200 CTCCTGGTAAGGAAGAAACAGGG + Intergenic
1023145036 7:37142561-37142583 CTGGTGGTAAGGAAAAAAGTAGG - Intronic
1023927528 7:44680789-44680811 CTGTTGGTCAGGAAGCAAGGAGG + Intronic
1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG + Intergenic
1026223366 7:68419582-68419604 CTGTTGGCAAGGAAGAAAGGAGG - Intergenic
1026345873 7:69473708-69473730 CTGTTTGTAAGGAGGAAGAGAGG + Intergenic
1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG + Intergenic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1030749696 7:113216291-113216313 CTGGAGGTAAGGAGGCAAGTTGG - Intergenic
1031133140 7:117856256-117856278 CATATGGTAAGGGGGAAAGATGG - Intronic
1032817380 7:135490586-135490608 GTGTTAGTGAGGAGAAAAGAGGG + Intronic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1033519347 7:142145348-142145370 GGGAGGGTAAGGAGGAAAGAAGG - Intronic
1033653896 7:143361267-143361289 CTGGGGGAAAAGAGGAAAGATGG + Intronic
1033840236 7:145364397-145364419 ATGGTGGTGAGGAGTAAAGAGGG + Intergenic
1034746956 7:153531380-153531402 ATGTGGGCAAGGATGAAAGAGGG - Intergenic
1034750462 7:153563538-153563560 TTATTATTAAGGAGGAAAGAGGG + Intergenic
1035012418 7:155731216-155731238 CTGATGGAAGGTAGGAAAGAAGG + Intronic
1037086208 8:14853892-14853914 GTATTGGCAAGGAGGAAGGAAGG - Intronic
1037458622 8:19086916-19086938 CTGTACCTGAGGAGGAAAGAAGG + Intergenic
1037870096 8:22486216-22486238 TTGTTTGTAAGGAAGACAGAGGG - Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038431591 8:27504691-27504713 CTGTTGTCAAGGAGGAAGGAGGG + Intronic
1038432779 8:27513339-27513361 CTGGTGGTAAAGAGGAGTGAGGG + Intronic
1038452801 8:27650730-27650752 TTGTTGGCATGGAGGAAAGAGGG - Intronic
1038770596 8:30475725-30475747 GTGTTGGGGAGGAGGAAGGAGGG + Intronic
1039679703 8:39718109-39718131 CTGTTGGTAAGGATATAAAATGG + Intronic
1040856142 8:51949958-51949980 CTGTTGGCAAGAAGGTAAAATGG + Intergenic
1041333487 8:56753487-56753509 TTGTTCTAAAGGAGGAAAGAGGG + Intergenic
1042356725 8:67836538-67836560 ATGGAGGTAGGGAGGAAAGAAGG - Intergenic
1042708765 8:71691504-71691526 CTAGTGGTAAGCAGAAAAGAGGG - Intergenic
1043292497 8:78620451-78620473 TTGTTGGTAAGAAGGCAAAACGG - Intergenic
1043388757 8:79771068-79771090 TTGTTGGTAAGGAAAAACGAGGG + Intergenic
1044450374 8:92329335-92329357 ATGGTGGTAAGGAGGACAGATGG - Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1044826505 8:96203463-96203485 GGGTTGGTAGGGAAGAAAGATGG - Intergenic
1045449712 8:102310254-102310276 CTTTTGGAAATGAGGAAGGAGGG - Intronic
1045928506 8:107598167-107598189 CTGCTGGTTAGGGGCAAAGAAGG + Intergenic
1046816954 8:118595792-118595814 CTGTGGGGAAGGAGGAAAAGAGG - Intronic
1046895272 8:119464615-119464637 TTGTTGTTTTGGAGGAAAGAAGG - Intergenic
1047495215 8:125404253-125404275 TTGTTGATAAGAAGGAAGGAAGG - Intergenic
1047645459 8:126865415-126865437 CTTTTGGTATCTAGGAAAGAAGG - Intergenic
1048192724 8:132304944-132304966 CTGAAGGAAAGGAGGAAGGAAGG + Intronic
1048761937 8:137804902-137804924 CTGAAGGAAAGGAGGAAGGAAGG + Intergenic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1052844250 9:33321152-33321174 CTGTTGGTGATGAGAGAAGAAGG + Intronic
1053380401 9:37644632-37644654 CTATTGTTGGGGAGGAAAGATGG - Intronic
1053418768 9:37963614-37963636 GTGTTGGTGAGGGGGAAAGGTGG + Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054254169 9:62748066-62748088 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054568234 9:66782236-66782258 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054743925 9:68835294-68835316 CTGCTGGTGAGGAAGGAAGACGG - Intronic
1054756084 9:68959456-68959478 CCTTTGGTGAGGAGGAAATAGGG - Intronic
1055416171 9:76085898-76085920 CACTTGGAAAGGAGGATAGAGGG - Intronic
1056524762 9:87432954-87432976 CTGTTGGAAGGAAGGAAGGAAGG + Intergenic
1056571411 9:87819592-87819614 CTGTTTGTAAGAAGGAAGGAAGG - Intergenic
1057217763 9:93238859-93238881 CTGTTGGTCAGGTGGAAGGCTGG + Intronic
1058609457 9:106759275-106759297 CTGTTGGTAAGAATGTAAAATGG + Intergenic
1059226444 9:112677474-112677496 CTGTTGGTAGGGATGTAAAATGG - Intergenic
1059326657 9:113507797-113507819 TTCTTGGTAGGGAGGACAGATGG + Intronic
1059828071 9:118056085-118056107 CTGTTGGTAGGAAGGAAAATTGG - Intergenic
1060138709 9:121184501-121184523 CTGTTTGGAAGGGGGAAAAAGGG - Intronic
1061284332 9:129613590-129613612 CTGTTGGACTGCAGGAAAGAGGG + Exonic
1061375292 9:130220411-130220433 CTGCAGGCAAGGAGGAGAGAGGG + Intronic
1061642839 9:131973205-131973227 TTGTTCATAAGGAGGAAAGAGGG - Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1186623454 X:11266111-11266133 GAGTTGGGGAGGAGGAAAGAGGG + Intronic
1186665646 X:11714185-11714207 CTGTTGTTCAGGAGGAGAGTTGG + Intergenic
1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG + Intronic
1188366056 X:29316357-29316379 CCTTTGGCAATGAGGAAAGAGGG - Intronic
1189373495 X:40448347-40448369 AAGGTGGTATGGAGGAAAGATGG - Intergenic
1190607454 X:52159851-52159873 CTGTTGGTAAGGATGTAAACTGG + Intergenic
1190623566 X:52313644-52313666 CTGTTGATCAGCAGGAAACATGG - Intergenic
1191131839 X:57022253-57022275 CTGTAGGCAAGGAGGAGGGAAGG - Intergenic
1191880824 X:65842443-65842465 CTGATAGGAAGGAGGAAGGAGGG - Intergenic
1192212314 X:69135779-69135801 CAGTTGGTAAGGGGCAGAGATGG - Intergenic
1192330271 X:70169816-70169838 CTGTTGGTAAGCTGGAGGGACGG + Intergenic
1192428470 X:71096992-71097014 GTGTTGGGAAGAAGGTAAGAGGG - Intronic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1193273600 X:79557796-79557818 ATGAAGGTAGGGAGGAAAGAAGG + Intergenic
1193609333 X:83610138-83610160 TTGTGTGTAAGGAGTAAAGAAGG + Intergenic
1194536258 X:95108532-95108554 CTGATGATGAGGAGGAAGGAGGG - Intergenic
1195509885 X:105702857-105702879 CTGGTTGTAAGGATCAAAGAAGG + Intronic
1195777701 X:108425957-108425979 CTGTTGATAATGAAGAAAAATGG - Intronic
1196733247 X:118962582-118962604 CTTGTGGTAAGGAGGAAGGAAGG + Intergenic
1197404118 X:126029103-126029125 GTGGTTGTATGGAGGAAAGAAGG + Intergenic
1197444987 X:126542426-126542448 CTGTTGGTAGGGATGTAAAATGG + Intergenic
1199411541 X:147529313-147529335 CTGGTGGGAAGGAGGGTAGAAGG - Intergenic
1199882843 X:151988636-151988658 CTCTTAGAAAGCAGGAAAGATGG + Intergenic
1200040742 X:153365421-153365443 ATATTGGTCAGGAGAAAAGAAGG - Intergenic
1200184168 X:154170849-154170871 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200189821 X:154207977-154207999 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200195574 X:154245786-154245808 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200201227 X:154282907-154282929 TCGTGGGTCAGGAGGAAAGAAGG - Intronic
1200410698 Y:2857984-2858006 CTGTTGGTAAGAATGTAAAATGG - Intronic
1201337199 Y:12893780-12893802 GTTTTGGGAAGGGGGAAAGAAGG - Intergenic
1201743587 Y:17348156-17348178 CTGCTGGACAGGAGCAAAGAAGG + Intergenic