ID: 1104510536

View in Genome Browser
Species Human (GRCh38)
Location 12:129373690-129373712
Sequence GCAGGAAGCATGTTTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104510536 Original CRISPR GCAGGAAGCATGTTTAAAGC AGG Intronic
901761781 1:11476737-11476759 GCAGGAAGCGTGTTTACTACAGG - Intergenic
904066980 1:27760451-27760473 GCAAGAAGGATGTTTCAAACAGG - Intronic
905415629 1:37801962-37801984 GCAGGAACCCTGATTAAAGCAGG + Intergenic
907742993 1:57185110-57185132 GGGGGAAGCATGTTTGGAGCAGG - Intronic
908425157 1:64000169-64000191 GGGGGAAGCATGTTTAAGGAAGG + Intronic
908607093 1:65810066-65810088 GAAGGATGCTTGTTGAAAGCTGG + Intronic
914375992 1:147074216-147074238 GTGGGAAGAATGTTCAAAGCAGG - Intergenic
914940575 1:152019467-152019489 GGAGGTAGCATGTGTAGAGCAGG + Intergenic
917463738 1:175255804-175255826 GCAGGAAGCTGGTTTGAACCAGG + Intergenic
919608893 1:199720631-199720653 AGAGGAAACATGTTTAAAGTGGG + Intergenic
1063640551 10:7826051-7826073 TCAGGAAGTATGTTTAAATTTGG + Intronic
1067511909 10:46903233-46903255 GCAGGAAGAATGGTGAGAGCTGG + Intergenic
1067571222 10:47372597-47372619 GGTGGAAGAAGGTTTAAAGCTGG - Intronic
1071254759 10:83861784-83861806 GCAGGAAGATTGCTTAAACCAGG + Intergenic
1071477031 10:86033838-86033860 GCAGCCAGCATGTTTAACACTGG - Intronic
1071908598 10:90203940-90203962 GCAGGAAACATGTTAATAGTGGG - Intergenic
1075790902 10:125083871-125083893 GCAGGAAAAATGCTTAAACCAGG - Intronic
1076348651 10:129799237-129799259 GCAGGAAGCATAAATGAAGCAGG + Intergenic
1077920669 11:6639819-6639841 GCAGGAAGCAAGTTCCAGGCTGG + Exonic
1080447404 11:32350411-32350433 GCAACAAGCATGATGAAAGCAGG + Intergenic
1081266981 11:41036643-41036665 GAAGGAAGCATTTTTTAAACAGG + Intronic
1082877529 11:58003180-58003202 GCAGGAAGAATGCCTAAGGCAGG + Intergenic
1083080802 11:60091055-60091077 GCAGGAGGCTTGTTTGAACCTGG + Intronic
1083607738 11:63988808-63988830 GCAGGAAGCAAGTCTGAAGCAGG - Intronic
1086443011 11:86847446-86847468 CCAGTAAGCATGGTTAAATCTGG + Intronic
1087291111 11:96321630-96321652 GCAGGAAGTATGTCTATAGAAGG + Intronic
1092061448 12:5554494-5554516 GCAGGTAGCATCATTAAAGTGGG - Intronic
1094606834 12:31956566-31956588 GCAGGAAAAATGGTTAAGGCGGG + Intergenic
1095537357 12:43266888-43266910 GCAGGAAGGATGATGAACGCAGG + Intergenic
1096218913 12:49815504-49815526 AAAGGAAGCATGTTGAAAGAAGG - Intronic
1097608044 12:61780143-61780165 GCAGGAAGCAGATTAAAATCAGG + Intronic
1098196418 12:68006676-68006698 GCTGGAAGCCTTTTTAAAGAGGG + Intergenic
1098899779 12:76101134-76101156 GCAGGAGGAATGTTTGAATCCGG - Intergenic
1099062891 12:77934314-77934336 ACAGGAAGGATGTATAGAGCTGG - Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1104510536 12:129373690-129373712 GCAGGAAGCATGTTTAAAGCAGG + Intronic
1109143483 13:58746893-58746915 CCAGGAAACATCTTTAAGGCAGG - Intergenic
1111213098 13:85106407-85106429 GCAGGAAGCTTGCTTGCAGCTGG + Intergenic
1113649611 13:112026552-112026574 GCAGGACTGATGTCTAAAGCTGG - Intergenic
1114325267 14:21582550-21582572 GCAGACATCATGTTTAAACCAGG + Intergenic
1114327777 14:21606564-21606586 GCAGGGAGCATGTTTGCAGAAGG + Intergenic
1115283970 14:31697195-31697217 GTAGGAAGCATGCAGAAAGCTGG + Intronic
1116106428 14:40513833-40513855 TAAGGCAGCATGTTTAAATCTGG - Intergenic
1116752921 14:48909676-48909698 GCAGGAAGATTTTTAAAAGCTGG + Intergenic
1116770704 14:49123895-49123917 GCAGGAAGATTGTTTGAAACCGG + Intergenic
1119783591 14:77296048-77296070 CTAGGAAGAATGTTTCAAGCAGG + Intronic
1120119093 14:80656380-80656402 GGAAGAAGAATGTTGAAAGCAGG - Intronic
1127626839 15:60788140-60788162 ACAGGAAGGATGCTGAAAGCAGG + Intronic
1127734046 15:61825334-61825356 GCAGGAAGCATGCTCACAGCTGG + Intergenic
1128948712 15:71851774-71851796 GCAAGAACTATGTGTAAAGCTGG - Intronic
1133572185 16:7052108-7052130 TCAGGAAGCATTTTACAAGCAGG - Intronic
1138321463 16:56116957-56116979 GCAGGAACAAAGTTTAAAACAGG + Intergenic
1139216905 16:65134810-65134832 GGAGGAAGCTTGTTTTAAGCAGG - Intergenic
1144736652 17:17559403-17559425 CCAGGCAGCCTGTTTAAAGCGGG + Intronic
1147386146 17:40083572-40083594 GCAGGAATGATGTCTAGAGCAGG - Intronic
1147815657 17:43208222-43208244 AGAGGAAGCATTTTTAAAGTTGG + Intronic
1151151693 17:72093667-72093689 GCAGAAAGCATATTGAAAGTGGG + Intergenic
1151956215 17:77381423-77381445 GCAGGAAGCTGGTTCCAAGCAGG + Intronic
1152607910 17:81302343-81302365 GCTGGAAGCCTGTTTAACCCTGG + Intergenic
1155532208 18:26778480-26778502 GCAGGAAGGATGCATGAAGCAGG - Intergenic
1155796619 18:30045579-30045601 GCAGGAGGATTATTTAAAGCTGG + Intergenic
1157754359 18:50204825-50204847 GCAGGATGCATGTTAGAAGTTGG + Intergenic
1162203267 19:9036618-9036640 GGAGGAAGCATGGTCAATGCTGG - Intergenic
1166955076 19:46458513-46458535 GCAGGAAAATTGTTTAAACCTGG - Intergenic
1168113403 19:54207684-54207706 GAAGGCTGCATGTTTAGAGCAGG - Intronic
925186525 2:1850280-1850302 GCAAGCAGTATGTTAAAAGCAGG + Intronic
925687684 2:6490298-6490320 GCAGGAAGTATGTTTCTGGCAGG - Intergenic
925959013 2:8997363-8997385 ATAGGAAGCATTTTTAAAGCAGG + Intronic
926553253 2:14326143-14326165 GCAGTAGCCATGTCTAAAGCTGG - Intergenic
927694373 2:25230305-25230327 GCAGGAAGCTAGTTTCCAGCAGG - Exonic
928100929 2:28437047-28437069 GCAGGCAGCTTGTTTCAGGCAGG + Intergenic
928337370 2:30409189-30409211 CCAGTAAGAATGTTTAAAACTGG - Intergenic
929607402 2:43243923-43243945 CCAGGAAACATGTTTACATCAGG - Intronic
930635419 2:53799462-53799484 ACTGCAAGCATGTTAAAAGCAGG + Intronic
930901865 2:56516816-56516838 GTAGTAAGCATGTATATAGCAGG + Intergenic
932094928 2:68839174-68839196 GCAGGAGGGAAGTTTAAAGCTGG - Intergenic
933445961 2:82379617-82379639 TGAGGAACCATGTTAAAAGCCGG - Intergenic
934514731 2:94979609-94979631 GCAGGAGGCAGGTGAAAAGCAGG + Intergenic
936278556 2:111120156-111120178 GCGGGAGGCATGTGCAAAGCAGG - Intronic
937412643 2:121689849-121689871 GCAGGAAGCCCGGTTAATGCAGG + Intergenic
938070958 2:128308150-128308172 GCAGGAAACATGTGAAACGCAGG + Intronic
939187394 2:138877348-138877370 GCAGGAAGCAAGGTAAAGGCTGG - Intergenic
940127859 2:150346917-150346939 TCATGATGGATGTTTAAAGCAGG - Intergenic
941503167 2:166307001-166307023 GGAGAAAGCATATATAAAGCAGG + Exonic
942136256 2:172928729-172928751 GGAGGGAGCATATTCAAAGCAGG - Intronic
944675441 2:202031942-202031964 GAATGAAACATTTTTAAAGCAGG + Intergenic
946741350 2:222805495-222805517 AAAGGAACCATGTTGAAAGCAGG + Intergenic
946899520 2:224358821-224358843 CCAGGAAACATTTTTAATGCAGG - Intergenic
1168931845 20:1630410-1630432 GCAGGATGCAGGTTCAAAGGTGG - Intronic
1171086960 20:22246579-22246601 CCAGGAAGTTTGTTAAAAGCAGG - Intergenic
1172820594 20:37730094-37730116 GCAGGAAACATGAATAAAGAGGG + Intronic
1174018791 20:47512084-47512106 GCAGGAGGACTGCTTAAAGCCGG + Intronic
1174206525 20:48844219-48844241 GCAAAAAGCATGTTTTAAGAAGG - Intergenic
1176428616 21:6563240-6563262 TCAGGAAGCATGTTCCAGGCTGG - Intergenic
1178199264 21:30385151-30385173 GGAGGAAGCATGTTTTGAGGTGG - Intronic
1179704106 21:43171556-43171578 TCAGGAAGCATGTTCCAGGCTGG - Intronic
1180890653 22:19285919-19285941 GGCAGAAGCATATTTAAAGCAGG + Intronic
1183091659 22:35526379-35526401 GCAGGAAGAATGTTCCAGGCGGG - Intergenic
949312880 3:2719987-2720009 GCAGAAAGAATGATAAAAGCTGG + Intronic
950050338 3:9983820-9983842 GCAGGAATCATGGTTGAAGAGGG + Intronic
950609140 3:14113834-14113856 GCAGGAAGCAAGGTTATAGATGG + Intronic
950849699 3:16051039-16051061 GCTGGAAGCAATTTTCAAGCCGG + Intergenic
950857567 3:16120021-16120043 GCAGGAAGAATGCTTTAAGCTGG - Intergenic
951040531 3:17984122-17984144 GGAGGAAGCAGGGTTTAAGCTGG - Intronic
951665813 3:25122507-25122529 GCAGAATGCATGGTTAAGGCTGG + Intergenic
955952816 3:64259410-64259432 GCAGCAAGGGTGTTTAAACCAGG - Intronic
956850933 3:73227760-73227782 GTAGGAGCCATGTTTAAACCGGG - Intergenic
957337257 3:78847381-78847403 GCAGAACGCATGTGCAAAGCTGG + Intronic
957480288 3:80783850-80783872 GCTATAAGCATGTTGAAAGCAGG - Intergenic
960038770 3:113128233-113128255 GTGGGAAGAATGTTTAAAGCTGG - Intergenic
960839690 3:121944570-121944592 GCAGGAAGATTCTTTGAAGCCGG + Intergenic
962088831 3:132221404-132221426 ACAGGAAGAATGTGTAAAGGAGG + Intronic
962940686 3:140122198-140122220 GCAAAAAGCATGCTGAAAGCTGG - Intronic
964917099 3:161852092-161852114 TCAGTAAGCATGGTTAAATCTGG - Intergenic
967141362 3:186563833-186563855 GCAGGAAGACTGCTTGAAGCCGG + Intronic
970587414 4:17527894-17527916 GAAGGAAGCAAGGTTAAAGAAGG + Intergenic
970930727 4:21508716-21508738 GCAGACAGCATGTTCAAGGCAGG - Intronic
976172868 4:82322740-82322762 GCAGGAAGAACATTTAAATCTGG - Intergenic
977459531 4:97308107-97308129 GCAGGAAGCTTATATAAAACTGG - Intronic
979842600 4:125463605-125463627 GCAGGAACCACCATTAAAGCAGG - Exonic
980707251 4:136515256-136515278 GCAGTAAGCATCATTAAAGTTGG + Intergenic
981391900 4:144200664-144200686 GCAGAAGAAATGTTTAAAGCTGG - Intergenic
983853438 4:172612165-172612187 GCAGGAAGAATTTTTAAAGTTGG + Intronic
983874279 4:172858123-172858145 GCAGGAAGCATGATGAAAAAGGG + Intronic
984567106 4:181344214-181344236 GAAGAAGGCATGTTGAAAGCTGG + Intergenic
984670876 4:182486040-182486062 GTAGGTAGCATGTCCAAAGCTGG + Intronic
986739457 5:10693353-10693375 GCAGGAAGCATGTACACAGAAGG + Intronic
988092315 5:26560011-26560033 ACAGGAAGCATGGATACAGCAGG + Intergenic
988239342 5:28589498-28589520 TCAGGAAGCATGTTTAAATGGGG + Intergenic
988409247 5:30864994-30865016 GAAAGAAGCATGTTTAAGGAGGG + Intergenic
993140265 5:84024562-84024584 GCAGGCAGCGTGGTAAAAGCTGG + Intronic
993590916 5:89794342-89794364 GCAAGCCCCATGTTTAAAGCTGG - Intergenic
993755129 5:91719805-91719827 GCAGGAAGAATGTTGAAAGTTGG + Intergenic
997579973 5:135011048-135011070 GCAGGAAGGATGTAAAAACCTGG + Intronic
997790606 5:136756692-136756714 GCACAAAGCATGGTGAAAGCAGG + Intergenic
997989739 5:138534355-138534377 CCAGGAAGCAGCTTTGAAGCTGG + Intronic
998517780 5:142771052-142771074 GCAGGAAGGATACGTAAAGCGGG + Intronic
999779946 5:154841190-154841212 GAAGGGAGCATGGGTAAAGCAGG - Intronic
1000091362 5:157932074-157932096 GCAGGAAGCCTTTTTAGAGGAGG + Intergenic
1001411343 5:171514653-171514675 GCATGAAGCAGGTTTCAAGAAGG + Intergenic
1001598433 5:172913586-172913608 GCTGGAAGCAATTTTAAAGAGGG - Intronic
1002878564 6:1232749-1232771 GCAGGCTGCATGTTTACAGTGGG - Intergenic
1004060845 6:12196613-12196635 GAAGGAAGGATTTTTGAAGCAGG - Intergenic
1006055662 6:31382538-31382560 GCAGGAAACATGAAGAAAGCAGG + Intergenic
1006876818 6:37304937-37304959 GCAGGAGGCAGGTTTTAAACCGG + Intronic
1007239821 6:40416892-40416914 GAAGGAAGCATTTTTAAACAGGG + Intronic
1007843290 6:44734141-44734163 TCTGGAAGCTTGTTTGAAGCTGG - Intergenic
1008091222 6:47295839-47295861 GCAGGGACCATTTTTAAAGCTGG + Intronic
1008903323 6:56648137-56648159 GCAGGAAGCATCTTTTGTGCAGG - Intronic
1009475292 6:64083628-64083650 GAAGGGAACATGTTTAAAACTGG + Intronic
1009671477 6:66757710-66757732 TCAGGATGCAGGTTTTAAGCAGG - Intergenic
1009948032 6:70362828-70362850 GCAGGAAGGATGGTTAAACTGGG + Intergenic
1010999380 6:82570655-82570677 CCAGGAAGCCTTCTTAAAGCAGG + Intergenic
1011001349 6:82591559-82591581 GCAGGTAGAGTGTTTAAAACTGG - Intergenic
1013974030 6:116056306-116056328 GCAGGAAGACTGCTTAAACCTGG - Intronic
1015012748 6:128371780-128371802 GCAGGAAGATTGCTTAAACCTGG + Intronic
1015571762 6:134629074-134629096 GCAGGAAGCAGGAATAAAACTGG + Intergenic
1018885186 6:167929487-167929509 GAGGGAAGCATGTTTAATTCAGG - Intronic
1022319736 7:29277414-29277436 GCAGGAGGCATCTGCAAAGCAGG + Intronic
1024472528 7:49777697-49777719 GCAGGAAGCATTTTGAGGGCAGG - Intronic
1026150245 7:67782251-67782273 GCTATAAGCATGTTTACAGCAGG - Intergenic
1030930976 7:115523157-115523179 GCTGCAAGCAAATTTAAAGCAGG - Intergenic
1034018561 7:147614123-147614145 TCAAGAATCATGATTAAAGCAGG - Intronic
1036151669 8:6304910-6304932 ACAGGATGCATGTTGAAAGCAGG + Intergenic
1036749249 8:11433537-11433559 TCTGGATGCATCTTTAAAGCTGG + Intronic
1037302461 8:17467140-17467162 GCGGGAAGCATATTTGAGGCAGG + Intergenic
1042011390 8:64249107-64249129 GCAGGAAGAATGCTGGAAGCTGG - Intergenic
1043774958 8:84254864-84254886 GCAGGAAGAATGATGAATGCAGG + Intronic
1051243616 9:15085823-15085845 GAAGGAAACATATTTAAAGGTGG + Intergenic
1053280435 9:36816911-36816933 GCAGGCATCCTGTTTAAAACAGG + Intergenic
1057119084 9:92554729-92554751 GCAGGAAACTTGCTTGAAGCCGG - Intronic
1061679631 9:132236586-132236608 GCTGGAAGCATGTTTAGAGAGGG + Intronic
1185979787 X:4765127-4765149 GCAGAGAGCATGGTCAAAGCAGG + Intergenic
1186059885 X:5693368-5693390 GCTGGAAGGATGTTTGAATCTGG - Intergenic
1193169778 X:78322095-78322117 GCAGAAAACATATTTAAAGAGGG + Intronic
1193775313 X:85634651-85634673 GCAGGATGCATTTTTAATCCAGG + Intergenic
1196426865 X:115578721-115578743 GTGGGAATAATGTTTAAAGCAGG + Intronic
1196647289 X:118131772-118131794 GCAGGAGGAATGTTTGAGGCTGG - Intergenic
1198095689 X:133377707-133377729 CCAGGATTCATGTTTAAAGGGGG - Intronic