ID: 1104512518

View in Genome Browser
Species Human (GRCh38)
Location 12:129393427-129393449
Sequence CTGTGATTCTGGAAAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 326}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104512518_1104512526 10 Left 1104512518 12:129393427-129393449 CCTGTTTCTTTCCAGAATCACAG 0: 1
1: 0
2: 3
3: 27
4: 326
Right 1104512526 12:129393460-129393482 TGGTGGCTGAGAGTGCGTTAAGG 0: 1
1: 0
2: 0
3: 9
4: 104
1104512518_1104512525 -7 Left 1104512518 12:129393427-129393449 CCTGTTTCTTTCCAGAATCACAG 0: 1
1: 0
2: 3
3: 27
4: 326
Right 1104512525 12:129393443-129393465 ATCACAGGGGCTGAAGGTGGTGG 0: 1
1: 0
2: 1
3: 38
4: 440
1104512518_1104512524 -10 Left 1104512518 12:129393427-129393449 CCTGTTTCTTTCCAGAATCACAG 0: 1
1: 0
2: 3
3: 27
4: 326
Right 1104512524 12:129393440-129393462 AGAATCACAGGGGCTGAAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 322
1104512518_1104512529 23 Left 1104512518 12:129393427-129393449 CCTGTTTCTTTCCAGAATCACAG 0: 1
1: 0
2: 3
3: 27
4: 326
Right 1104512529 12:129393473-129393495 TGCGTTAAGGGGTTTGCTGAAGG 0: 1
1: 0
2: 0
3: 8
4: 78
1104512518_1104512528 12 Left 1104512518 12:129393427-129393449 CCTGTTTCTTTCCAGAATCACAG 0: 1
1: 0
2: 3
3: 27
4: 326
Right 1104512528 12:129393462-129393484 GTGGCTGAGAGTGCGTTAAGGGG 0: 1
1: 0
2: 0
3: 2
4: 81
1104512518_1104512527 11 Left 1104512518 12:129393427-129393449 CCTGTTTCTTTCCAGAATCACAG 0: 1
1: 0
2: 3
3: 27
4: 326
Right 1104512527 12:129393461-129393483 GGTGGCTGAGAGTGCGTTAAGGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104512518 Original CRISPR CTGTGATTCTGGAAAGAAAC AGG (reversed) Intronic
900919664 1:5662291-5662313 CTAAGATTCTGAAAATAAACAGG - Intergenic
902043824 1:13511140-13511162 CTGTGATGTGGGGAAGAAACTGG - Intronic
904313749 1:29646492-29646514 CTGAGCTTCTGGAAAGGAGCAGG - Intergenic
906106758 1:43299410-43299432 CTTTGAATCTGGAATGAAAAAGG - Intergenic
908360527 1:63364738-63364760 CTCTGACTCTGAAAACAAACAGG - Intergenic
908506673 1:64809458-64809480 AGGTGATTCTGGAAACAAAAAGG - Intronic
909857925 1:80563279-80563301 CAGTGATTCAGGAAAGAAAATGG - Intergenic
910616170 1:89200726-89200748 CACTGATTTTGGAAGGAAACTGG + Intergenic
911217235 1:95208346-95208368 CATTGTTGCTGGAAAGAAACTGG + Intronic
911277599 1:95880477-95880499 CTATGATTTTGCAAAGAGACTGG - Intergenic
911479840 1:98424310-98424332 ATTTGATGCTGGGAAGAAACAGG - Intergenic
911497100 1:98644955-98644977 ATGTGATTATGGAGAGAGACAGG - Intergenic
911584827 1:99678817-99678839 CTGTGAGTCCCAAAAGAAACTGG + Intronic
912005610 1:104896387-104896409 CTGTGATACTGGAAAGAGAGTGG - Intergenic
912998739 1:114558193-114558215 CAGTGAGTTTGGAAGGAAACTGG + Intergenic
914175012 1:145270315-145270337 CTGGGATTCTGGACTGACACAGG + Intergenic
914251792 1:145927808-145927830 CTGGGATTTTTGAAAGAAAAGGG - Intergenic
916275981 1:162993783-162993805 CTTTTATTACGGAAAGAAACTGG - Intergenic
918121891 1:181547504-181547526 CGGGGACTCTGGAAAGAAGCTGG - Intronic
918293893 1:183136641-183136663 CTGAGGGTCTGGAAAGAAACTGG - Intronic
918900448 1:190409709-190409731 CCATCATTCTGGAAAGCAACAGG - Intronic
919048905 1:192488110-192488132 TTGTTATTCTGGAAAACAACTGG - Intergenic
921513180 1:216057353-216057375 ATGTAAATCTTGAAAGAAACTGG - Intronic
922570199 1:226630068-226630090 CAGTGGTCCTGGAAAGCAACTGG + Intergenic
924117002 1:240757682-240757704 CTCTGATTTAGGAAACAAACAGG + Intergenic
1063444817 10:6105252-6105274 CTGTGATTCTGAGATGTAACAGG - Intronic
1064848507 10:19683570-19683592 CTGTGATGCTGGAAAGAGAAAGG - Intronic
1068352115 10:55861536-55861558 CTATGCTTCTGAAAAGAGACTGG + Intergenic
1068904496 10:62307718-62307740 CTGTCATGCTGGAAAGAACTGGG - Intergenic
1069083092 10:64109177-64109199 CTGTGACTCTGAAAAGAAGAAGG + Intergenic
1070092322 10:73299984-73300006 CTGGGGTTTTGGAAAGAAATGGG + Intronic
1073069593 10:100784791-100784813 CTGTGACTCTGGGGAAAAACTGG + Intronic
1073328394 10:102655971-102655993 CTCTCATTCTGGACAGAAAGTGG - Intronic
1073419126 10:103409850-103409872 CTGTGATACTGGACAGCAAATGG - Intronic
1074127302 10:110539360-110539382 GTGAGAATCTGGAAAGAAAGTGG + Intergenic
1076447848 10:130530578-130530600 CTGTGATACTGGATAGCAATTGG + Intergenic
1079460209 11:20671724-20671746 CTGGGAATCTAGATAGAAACTGG + Intronic
1079625425 11:22611471-22611493 CTATGTTTTAGGAAAGAAACTGG - Intergenic
1080771355 11:35345147-35345169 ATGTGATACTGGCATGAAACAGG - Intronic
1080848826 11:36050087-36050109 ATGTGATTCAAGAAAGCAACAGG - Intronic
1080995394 11:37594274-37594296 CTGGTAAGCTGGAAAGAAACAGG + Intergenic
1081533184 11:43978503-43978525 CTGTGATCCTGGCAAGGTACAGG + Intergenic
1083361381 11:62111174-62111196 GTGTAATTCTGGAAAGAATGGGG + Intergenic
1084370278 11:68737419-68737441 CCGTGAATCTGGAAACACACTGG - Intronic
1084584189 11:70046763-70046785 ATGGGATCCTGGAAAGAAAAAGG + Intergenic
1084632273 11:70361060-70361082 CTCTGATTCTGTAAGGAGACGGG + Intronic
1085801309 11:79592522-79592544 CTGTGCTTCTGACAAGAGACTGG - Intergenic
1086071881 11:82808613-82808635 CTGTGATACTGGACTGAAATTGG + Intergenic
1086273702 11:85098326-85098348 CGCAGAATCTGGAAAGAAACTGG - Intronic
1086555294 11:88103461-88103483 CTTTGTTTCTGTAAACAAACGGG - Intergenic
1086570242 11:88275360-88275382 CTGTGATACTGAAAAGAATGAGG + Intergenic
1086596851 11:88582864-88582886 ATGTGATTGTGGAGAGAGACAGG + Intronic
1087045852 11:93843283-93843305 GTGTGTTGCTGGAGAGAAACAGG - Intronic
1087111790 11:94477863-94477885 CTGGGCTTTTGGAAAGAAGCGGG - Intronic
1087611399 11:100438356-100438378 CCTTGCTTCTGGAAAGAAAGAGG + Intergenic
1087776915 11:102264994-102265016 CTGTATTCATGGAAAGAAACTGG + Intergenic
1087812561 11:102623825-102623847 CTGTGATTCTGAAACTAAAGAGG - Intronic
1088610685 11:111573313-111573335 CTAAGACTCTGCAAAGAAACTGG + Intergenic
1088807578 11:113366288-113366310 CAGTGATTCTTGAGAGAGACAGG + Exonic
1088822528 11:113468887-113468909 CTGGGATCCTGGACAGACACAGG - Intronic
1090499764 11:127249989-127250011 TTGAGAATCTGGAAAGAAATCGG - Intergenic
1090781052 11:130006982-130007004 CTGTGGATCTGGAAAGACAGAGG + Intergenic
1091966534 12:4746955-4746977 CTGTGTGTCTGGAAAAATACTGG + Intronic
1093556101 12:20475785-20475807 TTGTGCATCTGGAAAGAAAATGG + Intronic
1094191491 12:27702678-27702700 TGGTGATTTTGCAAAGAAACTGG + Intergenic
1094415027 12:30207166-30207188 CTGTGATTATGGCAAGAGAGGGG + Intergenic
1095288317 12:40443435-40443457 CTGTTATTCTGGATCCAAACTGG + Exonic
1096911128 12:54984918-54984940 CTGTTTTTCTGGAAAGACAGAGG - Intergenic
1097405007 12:59178241-59178263 GTGTGATTATGGAAAGAACTAGG - Intergenic
1098181507 12:67851986-67852008 CTGTGACTCTGTAAAGACATTGG + Intergenic
1098613975 12:72499556-72499578 CTGTGATACTGGATGGGAACTGG - Exonic
1099443579 12:82726995-82727017 CTGTGGCTCAGGAAAGAAAAGGG - Intronic
1099667180 12:85646381-85646403 CTGTCATTCCTGAAAGATACAGG - Intergenic
1100390507 12:94142670-94142692 TTATGATTCTGGCAGGAAACAGG + Intergenic
1100651439 12:96594276-96594298 CTGGCAATCTGTAAAGAAACAGG - Exonic
1100866161 12:98859106-98859128 GTGTGATTCGGGAATCAAACTGG - Intronic
1101007953 12:100419889-100419911 CTTTGCTTCTGGGGAGAAACAGG + Exonic
1101604867 12:106240437-106240459 GTGACATTCTGGAAAAAAACAGG - Intronic
1102184502 12:110937162-110937184 CTGGGAATTTGGAAAGGAACAGG - Intergenic
1102621184 12:114195870-114195892 CTGAGATTCTGGGAAGCAAGAGG + Intergenic
1103214503 12:119191195-119191217 CTTTTTTTCTGCAAAGAAACAGG + Intronic
1104512518 12:129393427-129393449 CTGTGATTCTGGAAAGAAACAGG - Intronic
1104886308 12:132110999-132111021 GTGTGATTCTCCAAACAAACTGG + Intronic
1105248022 13:18670230-18670252 CAGAGGTTCTGGAAAGAAAGTGG + Intergenic
1106303524 13:28490593-28490615 CAGTGATCCTGGAAAGCATCTGG + Intronic
1106475979 13:30098530-30098552 CTGTTATTCTGAACAGCAACTGG - Intergenic
1106595984 13:31137964-31137986 ATGTGAGGCTGGAAGGAAACTGG - Intronic
1107659110 13:42621037-42621059 ATGTGGTTCTGGCAAGAAATTGG - Intergenic
1107846959 13:44524905-44524927 CTGTGCTTCTGGAAGGAGAAAGG + Intronic
1108542667 13:51458242-51458264 CTGTGATTCTAGAAAGATTCTGG + Intergenic
1108743600 13:53365523-53365545 TTGTGTTTCAGGAAAGAAAAGGG - Intergenic
1108840099 13:54602680-54602702 ATTTGTTTCTGGATAGAAACGGG - Intergenic
1110746027 13:79054358-79054380 CAGTGATTCTGGAACAAAAATGG - Intergenic
1110932100 13:81233140-81233162 TTTTAATTCTGAAAAGAAACAGG - Intergenic
1112059570 13:95724363-95724385 TTGGTATTCTTGAAAGAAACGGG + Intronic
1112757114 13:102648617-102648639 CTGTCGTTCTGGAAAGAATGAGG + Intronic
1114220453 14:20691876-20691898 CTGTGGATCTAGAAAGACACAGG - Intronic
1114350314 14:21843443-21843465 CTGGCATTCTGGAAAGAACCTGG + Intergenic
1114494774 14:23125202-23125224 ATGTCATTCTGGAAGGAACCTGG + Intergenic
1115245340 14:31288649-31288671 ATATGGTTCAGGAAAGAAACAGG + Intergenic
1115383535 14:32768626-32768648 TTCTAATTCTGGAATGAAACTGG - Intronic
1118462109 14:65996816-65996838 CTGTCATTTTGGGAAGAGACAGG - Intronic
1119924138 14:78475503-78475525 CTGAGATACTTGAAAGAAAGAGG - Intronic
1120712776 14:87809988-87810010 TTGTGATTATGGCAAGAACCTGG - Intergenic
1120718588 14:87866590-87866612 CTGTTATTTTGAAAAGACACAGG - Intronic
1120755099 14:88235534-88235556 ATGAAATTCAGGAAAGAAACAGG + Intronic
1121466866 14:94121422-94121444 CTGACACTCTGGGAAGAAACTGG + Intergenic
1123968137 15:25479483-25479505 CTGTGATGCTGAGCAGAAACAGG + Intergenic
1126491010 15:49235614-49235636 CTGTGTTTCAGGAAATAAAAAGG + Intronic
1126509625 15:49454325-49454347 ATGTGTTTCTGGAATTAAACTGG - Intronic
1128013316 15:64319232-64319254 CTGTGATGCTGGATAAAACCTGG + Intronic
1128720710 15:69946194-69946216 CTGAGATTCTGAAAAGAATCAGG + Intergenic
1129915427 15:79265926-79265948 CCATGATCCAGGAAAGAAACGGG - Intergenic
1131194375 15:90343617-90343639 CTTTACTTCTGGAAAGCAACAGG + Intergenic
1131225133 15:90618331-90618353 CAGTAATTCTGGACAGAAGCTGG - Intronic
1131329054 15:91479437-91479459 CTGATGTTCTGGAAATAAACAGG + Intergenic
1131409796 15:92197975-92197997 CTGTGCTTCAGGGCAGAAACAGG + Intergenic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1132604896 16:789532-789554 CTGAGACTCTGGAGAGAGACCGG - Exonic
1133173251 16:3994801-3994823 CTGTTATTAAGTAAAGAAACTGG + Intronic
1134683489 16:16142743-16142765 CTGTGTTCCTGGAAGAAAACAGG + Exonic
1137235547 16:46614113-46614135 TTTTGGTTCTGGACAGAAACCGG + Intronic
1137549118 16:49424705-49424727 CTGGGGTTCTGGAAGGAAAGGGG + Intergenic
1137864716 16:51881339-51881361 CTGAGATTCAATAAAGAAACTGG - Intergenic
1138173498 16:54875022-54875044 TTCTGGTTCTGGAAAGTAACAGG + Intergenic
1139495222 16:67311921-67311943 CTGTGATCTTGGAAAGGAAGAGG - Intronic
1139968696 16:70760428-70760450 ATGTGATTCTGGAAAGCAACCGG + Intronic
1141125980 16:81401433-81401455 CTGTGACTTTAGAAAGAAAGAGG + Intergenic
1203141894 16_KI270728v1_random:1772193-1772215 TAGGGATTCTGGAAAGAAAAAGG - Intergenic
1143042898 17:4052511-4052533 CTGTGATTCTGGAGTGAAAAAGG - Intronic
1143663565 17:8342686-8342708 GAGTGTCTCTGGAAAGAAACAGG - Intronic
1144303982 17:13950643-13950665 CTTTGATTCTGTGAAGAAAGGGG - Intergenic
1144810621 17:17996650-17996672 CTGACATTCTGGAAAGAATGAGG + Intronic
1146107455 17:30053011-30053033 GTGTGATTTTGGAAATAAATAGG - Intronic
1146367796 17:32242813-32242835 CTGTGTTACTGGAGAGCAACAGG + Intronic
1146786500 17:35726254-35726276 TTGAGACTCTGGAAAGAAATGGG + Intronic
1147027759 17:37603099-37603121 CTCTGAGCCTGGAAAGAAAAAGG + Intronic
1148024079 17:44573610-44573632 CTGGGAGACTGGAAAGCAACAGG - Intergenic
1148918600 17:51007043-51007065 CTGTGTTTCTACAAAAAAACAGG + Intronic
1149488959 17:57068241-57068263 CTTTGATTCTGGAGAAAAAGGGG + Intergenic
1149722057 17:58855145-58855167 CTGTGCTTCTGGAAGGGAAAGGG + Intronic
1153711584 18:7805350-7805372 CAATCATTCTGGAAAGAAATGGG - Intronic
1154440831 18:14388898-14388920 CAGAGGTTCTGGAAAGAAAGTGG - Intergenic
1155044166 18:22089002-22089024 CTGGGATTCTGCAAAGAAAATGG + Intronic
1157945942 18:51980989-51981011 CTGTGATTCTAGGAGGCAACAGG + Intergenic
1158607430 18:58908005-58908027 CTGTGATTCTTAAATGAAAAGGG + Intronic
1158822576 18:61178430-61178452 CTGTGATTTGGCAAAGACACTGG + Intergenic
1160218161 18:76952474-76952496 CTGTGCTTCTGGGAGGAAGCTGG + Intronic
1162650324 19:12083747-12083769 TTGTGATACTGCAAACAAACTGG - Intergenic
1163301426 19:16449547-16449569 CGGTGACTCTGGAAACAGACTGG + Intronic
1164239929 19:23377005-23377027 CTGTTATTCAGGACAGAAATGGG - Intronic
1165228215 19:34368929-34368951 CTACAATTCAGGAAAGAAACTGG - Intronic
1165589552 19:36955851-36955873 ATGTTTTTATGGAAAGAAACTGG + Intronic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166917366 19:46204493-46204515 CTGTGACCCTGGAAAGAGACAGG + Intergenic
1166919765 19:46221280-46221302 CTGTGACCCTGGAAAGAGATGGG + Intergenic
1168649275 19:58082977-58082999 GTGTGGTTCTGGTAAGAAAAAGG - Intronic
926559555 2:14401301-14401323 CTGTGCTTCTTTAAAGACACAGG - Intergenic
926916975 2:17901562-17901584 CTGTGAGTCTGGAATGCAAGAGG + Intronic
927249218 2:20982907-20982929 CTGTGAGTGGGGAAAGAATCAGG + Intergenic
927753055 2:25686984-25687006 CTGGGAATCTGGACAGGAACTGG - Intergenic
929205163 2:39283285-39283307 CTGTGAGACTAGAAAGAACCAGG - Intronic
931147218 2:59532632-59532654 ATGTGATCCTGCAAAGAAAAGGG - Intergenic
932689558 2:73900771-73900793 CTGGGAGTGTGGAAAGGAACTGG - Intronic
933810192 2:86028251-86028273 CTGTGCTGCTGGAAGGAAGCGGG - Intronic
934132082 2:88957874-88957896 ATGTGATTCTGGAAAGCAGAAGG + Intergenic
935098243 2:99967799-99967821 CATTGGTTCTGGAAAGAAAGTGG - Intronic
935387031 2:102510683-102510705 CGGTGATTTTAGAAACAAACAGG - Intronic
937002737 2:118482999-118483021 CTGGGGTTCTGGAAGGAAATGGG + Intergenic
939102704 2:137914000-137914022 CAGAGGTTCTGGAAAGAAAGTGG + Intergenic
939144027 2:138390779-138390801 CTGTGATTCAGGAAATTGACAGG - Intergenic
939331167 2:140763004-140763026 TTGGGTTTCTGGAAATAAACAGG + Intronic
939698045 2:145352963-145352985 GTGTGATTCTGAAAAGCCACAGG + Intergenic
940180884 2:150931575-150931597 CTGTGACTGTGGATAGATACAGG - Intergenic
940800193 2:158124533-158124555 CTGTGATTCTGTTAACACACAGG - Intronic
941278349 2:163518856-163518878 TTCTAATTCTGGAAGGAAACTGG - Intergenic
942040891 2:172061095-172061117 CCGTGATTCTTGAAAGGAAACGG + Intronic
942152073 2:173086617-173086639 CAGTGATTCTGTGAAGAACCTGG + Intronic
942199130 2:173553339-173553361 GTGTGTTTTTGGAAAGGAACAGG - Intergenic
943138930 2:183953470-183953492 TTCTGATTTTGGAAAGGAACTGG + Intergenic
944545179 2:200791950-200791972 TTGTGATTCTTAAAAGAATCAGG - Intergenic
945145519 2:206734081-206734103 CTGAGTTTCTGGAAGCAAACTGG - Intergenic
945413375 2:209540206-209540228 CTATAATTATGGAAAGAAAGTGG - Intronic
945479058 2:210323268-210323290 ATGTGATTCTGGCAAGAGAGAGG + Intergenic
945647607 2:212519027-212519049 CTGTGATTCTGGGTACACACAGG - Intronic
946218039 2:218201109-218201131 TGGTGATGTTGGAAAGAAACTGG + Intergenic
946465725 2:219910192-219910214 CTGACACTTTGGAAAGAAACTGG + Intergenic
946600544 2:221355597-221355619 CTGTTATTCAGGAAAGAAGCTGG - Intergenic
947366810 2:229404591-229404613 CAGTCATTCTGGCCAGAAACTGG - Intronic
1169106240 20:2997507-2997529 ATGTTGTTCTGGAGAGAAACTGG + Intronic
1169577365 20:6979994-6980016 ATGAGTTTCTGGAAAGAAATTGG + Intergenic
1169594039 20:7177618-7177640 GTGTGATGCTGTAAAGATACTGG - Intergenic
1169876356 20:10301407-10301429 TTTTGATTCTGGAAAAAAAAGGG - Intronic
1170499091 20:16956289-16956311 CTGTGACTTTGCAGAGAAACAGG + Intergenic
1170741733 20:19064592-19064614 CTGTGTTTCAGCAAAGAGACTGG + Intergenic
1170812844 20:19687986-19688008 CTGTGCTTCAGGAAGGACACAGG - Intronic
1171111361 20:22485559-22485581 CTTTGATTCTGGAGAGAGCCTGG + Intergenic
1172747902 20:37227199-37227221 ATGTCATTCTGGGAAGAAGCTGG - Intronic
1176455223 21:6902286-6902308 CAGAGGTTCTGGAAAGAAAGTGG + Intergenic
1176833395 21:13767334-13767356 CAGAGGTTCTGGAAAGAAAGTGG + Intergenic
1177121300 21:17140107-17140129 CTAGGATTTTGGAAATAAACAGG - Intergenic
1177709841 21:24760209-24760231 CAATGACTTTGGAAAGAAACAGG - Intergenic
1178458832 21:32782227-32782249 CTGTGCTTTGGGAAAGAAAGAGG + Intergenic
1178993940 21:37379653-37379675 CTGTGAATCTGTAAAGGAAAAGG + Intronic
1179766287 21:43575483-43575505 CTCTCCTTCTGGAAAGAATCAGG - Intronic
1181919123 22:26306172-26306194 CTAATATTCTGGGAAGAAACGGG - Intronic
1182078653 22:27512824-27512846 GTGTGAATCTGGAGAGAAACAGG + Intergenic
949348582 3:3100253-3100275 CTCTGCTTCTTGAAAGACACTGG - Intronic
949721897 3:6999201-6999223 CTATGATTTCGCAAAGAAACTGG - Intronic
951005280 3:17608817-17608839 TGCTGATTCAGGAAAGAAACAGG - Intronic
951096457 3:18637413-18637435 CTTGGCTTGTGGAAAGAAACAGG + Intergenic
951236202 3:20239772-20239794 CTGTAATTCAGGAAGGAAAATGG + Intergenic
951816159 3:26757343-26757365 CTGTAATTCTGAGAAGAAAATGG + Intergenic
952255542 3:31692134-31692156 CTGGGACTCTGGAAAAACACAGG - Intronic
952889299 3:38029950-38029972 GGGTGATGCTGGAAAGAATCCGG + Intergenic
953381699 3:42477214-42477236 CTGGGATTCTGGAAAGTGTCAGG - Intergenic
953429466 3:42826787-42826809 CTATGATTCTGGAAAAAGAAGGG - Intronic
954112910 3:48445583-48445605 CTCTGGTCCTGGAAAGAGACAGG - Intergenic
954837659 3:53484040-53484062 CTGTGATTCTGAATAGATTCTGG - Intergenic
955012312 3:55030286-55030308 CTTTAATGCTGGAAAGAAATTGG - Intronic
955439360 3:58939333-58939355 CTGGGATTCTAGAAAGGAAAAGG + Intronic
955710268 3:61771718-61771740 CTATGGTTCAGGAAAGAAAAAGG - Intronic
955776397 3:62438204-62438226 CCGGGTTTCTGTAAAGAAACAGG + Exonic
956843398 3:73160522-73160544 CTGTGATTCTGCAGACAATCAGG - Intergenic
958827494 3:99049282-99049304 GTGTGGTCCTGGTAAGAAACAGG + Intergenic
960650856 3:119948238-119948260 CTGAGAATCTGGAAAGGAAATGG + Intronic
961589106 3:127962129-127962151 CTGTGAGTCTGGATAGAATGAGG + Intronic
962880403 3:139571636-139571658 AAATGATTCTGGAAAGAACCTGG + Intronic
963396144 3:144737263-144737285 CTGTGTTTCAGAAAAGAAGCAGG + Intergenic
964280026 3:155053702-155053724 CTGGGATTCTAGCAAGAAATGGG + Intronic
965003402 3:162986789-162986811 CAGTAAATCTGGAAAGAAATTGG - Intergenic
966197233 3:177325629-177325651 CTATGGTTCTGGAAATAAAGAGG - Intergenic
967464418 3:189787285-189787307 CTCTGATTCTGGACAAAAACAGG + Intronic
967631370 3:191746077-191746099 CAGTAATTCTGTAGAGAAACTGG - Intergenic
967766448 3:193285056-193285078 ATGTGAGTTTGGAAAGAAACTGG - Exonic
968717379 4:2170638-2170660 CTGTCATTCTAAAAAGAAAAAGG + Intronic
970273539 4:14372452-14372474 CCGTGAGGGTGGAAAGAAACTGG - Intergenic
971042837 4:22773934-22773956 CAGTGATAATGAAAAGAAACAGG + Intergenic
972736062 4:41842625-41842647 CTGTGATGTTGTGAAGAAACTGG - Intergenic
973074429 4:45904713-45904735 CTGTGCTTTAGCAAAGAAACTGG - Intergenic
973239276 4:47939865-47939887 CTGGGATTCTGACAAGACACTGG - Intronic
978725373 4:111963359-111963381 CTGTTCTTCTGGAAACAAACTGG + Intergenic
980027620 4:127784352-127784374 CTGTGATTCTTTAAAGATCCTGG + Intronic
980743818 4:136989356-136989378 GTGTCATTCTGGAAAGAATATGG + Intergenic
983509079 4:168588175-168588197 CAGTGATCCTGGTAGGAAACTGG - Intronic
983816906 4:172141313-172141335 GAGAGATTCTTGAAAGAAACAGG - Intronic
984341390 4:178461235-178461257 TTGTGATTCTAGTAAGTAACTGG + Intergenic
984877018 4:184378337-184378359 ATGTGTGTCTGGAAAGAAAATGG - Intergenic
985513722 5:326356-326378 CTGTGATGCGTGAAAGAAGCTGG - Intronic
987790996 5:22567483-22567505 ATGTGATTCTTGAAAGACACGGG - Intronic
988446194 5:31288694-31288716 CTGGGATTGAGGAAAGAAACAGG - Intronic
990310673 5:54534889-54534911 CTGTCATTCTAGAAAAAAATTGG + Intronic
991163454 5:63532884-63532906 CTGTGATTTTGGCAAGAAAGTGG + Intergenic
991186495 5:63814940-63814962 CTGTGCTTCAGCAAAGAGACTGG + Intergenic
993152317 5:84176384-84176406 CACTGAGCCTGGAAAGAAACAGG - Intronic
994124099 5:96150697-96150719 AGGTGACTCTGGAAAGAGACAGG + Intergenic
995246465 5:109940831-109940853 CTGTGAGTCTTCAGAGAAACTGG - Intergenic
995727100 5:115192756-115192778 ATGGGATCCTGGAAAGAAAAAGG - Intergenic
996325236 5:122265806-122265828 CTGTGATTATGTAGAGCAACAGG - Intergenic
996727601 5:126686463-126686485 CATTGATTCTGGAAAGAAACTGG + Intergenic
997863491 5:137441087-137441109 CTGTGATTCTGGATAGAAATAGG + Intronic
998078892 5:139258455-139258477 CTGTTCTTCTGGAAAGAAAATGG - Intronic
998383831 5:141744614-141744636 CTGGGGTTCTGGGAAGAACCTGG - Intergenic
998488269 5:142523014-142523036 CTGTGAATGGGGAAAGAAAGGGG - Intergenic
999661916 5:153873650-153873672 CTGTGATTCTGGAGAGATTCTGG + Intergenic
999885832 5:155921519-155921541 CTGAGACTCTGGAAAGAAAGGGG + Intronic
1000391180 5:160725138-160725160 GTCTGATTTAGGAAAGAAACAGG + Intronic
1001937821 5:175718248-175718270 CTGTGACCATGGAAATAAACAGG + Intergenic
1003192648 6:3888088-3888110 CTGTGATTGTGCAGAGCAACAGG + Intergenic
1004047336 6:12039150-12039172 CTGTGATTATGTAAAAAACCAGG + Intronic
1004247172 6:13990087-13990109 CTGTGACTCTGGAGAGGACCAGG - Intergenic
1004337846 6:14780945-14780967 CAGCCATTCTGGAAAGAATCTGG + Intergenic
1004722077 6:18276699-18276721 CTCAGGTTCTGGAAAGAAGCAGG - Intergenic
1005881216 6:30062209-30062231 CTGTCAACCTGGGAAGAAACTGG - Exonic
1005969960 6:30753023-30753045 CTCTGGTTCAGGAAAGAAAAAGG + Intergenic
1007855234 6:44848729-44848751 CTGTAATTCTGGAAAGCAGGGGG + Intronic
1008024910 6:46624384-46624406 GTTAGATTCTGGAAAGACACTGG - Intronic
1008606853 6:53148969-53148991 CTGGCATTCTGGGAAGAATCAGG - Intergenic
1010314043 6:74423966-74423988 CAGTGATTCCGTAAACAAACAGG - Intergenic
1010591136 6:77713552-77713574 TTTTGATTCTGGACTGAAACTGG - Intronic
1012813860 6:103996905-103996927 CTGTGATTCTAGAAAGATCTGGG + Intergenic
1014410628 6:121114732-121114754 TTGTAATTTTGAAAAGAAACAGG - Intronic
1014583592 6:123169089-123169111 CTGTGCTTCTCTAAAGTAACAGG - Intergenic
1015453718 6:133400914-133400936 CTTTGATTTTGGAATGAGACTGG + Intronic
1016502800 6:144741367-144741389 CTTTGATTCTTGAAAGAGAAAGG + Intronic
1016728416 6:147401568-147401590 CTGTGCTTTAGGAAAGAGACTGG - Intergenic
1016938174 6:149463896-149463918 CAGGAATTCTGGAAAGGAACAGG + Intronic
1018358041 6:163038365-163038387 ATGTGAAGCTGGAAAGAAAATGG + Intronic
1018611341 6:165650430-165650452 TTGTGATTGCGTAAAGAAACTGG - Intronic
1019084809 6:169466135-169466157 CTGCTTTTCTGGACAGAAACGGG - Intronic
1020197505 7:6053145-6053167 CTGTGAGTCTGGAAAGCGTCTGG - Intronic
1020601856 7:10285428-10285450 TTCAGATTCTGGAAAGAAAGTGG + Intergenic
1023234203 7:38066832-38066854 CTGTGCTTCTGAAAAGAGAGAGG + Intergenic
1023367324 7:39476777-39476799 CAGTGATGCTGGGAAGAAAGAGG - Intronic
1024077149 7:45827308-45827330 TTGTGATGGTGGAAAGAAATGGG + Intergenic
1025127267 7:56354113-56354135 TTGTGATGGTGGAAAGAAATGGG - Intergenic
1025602518 7:63013685-63013707 TTGTGATGGTGGAAAGAAATGGG - Intergenic
1026303854 7:69123187-69123209 GTGTGAATCTGGTAAGAAGCAGG - Intergenic
1026567129 7:71498502-71498524 ATGTAATATTGGAAAGAAACAGG + Intronic
1029317484 7:99727593-99727615 CTGTGATTCAGGTGAAAAACAGG - Intronic
1029557528 7:101280703-101280725 TTGTGATGGTGGAAAGAAATGGG - Intergenic
1030556380 7:111030036-111030058 CTGGCTTTCTGGAAAGAATCAGG - Intronic
1030898831 7:115096558-115096580 CTGAGAATGTGGAAAGAAGCTGG - Intergenic
1031550922 7:123110468-123110490 CTTTGATTCAGGAAGGAAAATGG - Intergenic
1033125301 7:138701997-138702019 CACTGATGCTGGAAACAAACTGG - Intergenic
1035179347 7:157078036-157078058 CTGGGATTCTGGAACCACACTGG - Intergenic
1036484400 8:9166199-9166221 GTGTGGTTGTGTAAAGAAACAGG + Intronic
1036731394 8:11268756-11268778 CTCTGATTCTGTACAGAATCAGG - Intergenic
1038160310 8:25030946-25030968 CTGTGAGGCTAGAAAGAAAATGG + Intergenic
1038279510 8:26151224-26151246 CAGTGATTCAGAAAAGAAAATGG - Intergenic
1039160504 8:34613134-34613156 CAGAGATTTTGGAAAGAAACAGG - Intergenic
1039323664 8:36461374-36461396 GTGTCATTCTGGAAAAAAGCAGG + Intergenic
1041981818 8:63870739-63870761 ATATGATGCTGGAAAGATACTGG + Intergenic
1042067198 8:64891346-64891368 CTGGGATTCTGGAACAAATCCGG - Intergenic
1042405076 8:68395457-68395479 CAGTGATTCTCAATAGAAACAGG - Intronic
1042554893 8:70026033-70026055 TTGTGATTTTGAAAAGAAAAAGG + Intergenic
1042796524 8:72669181-72669203 CAGTAATTCTGGAAAGGAGCTGG - Intronic
1044898528 8:96919159-96919181 AGGTGATTGTGGAAAGAAAAGGG + Intronic
1045053052 8:98344109-98344131 ATGTGATTTTGGAAAGAGACTGG + Intergenic
1045269359 8:100649176-100649198 CTCTGACTCTGGCAAGACACTGG - Intronic
1045772745 8:105763310-105763332 CTGTTATTCTGGAAGGAGATTGG - Intronic
1046351822 8:113025319-113025341 CTTTGATTCTGGGTAGAAGCAGG + Intronic
1046639438 8:116710679-116710701 CTGTGCTTCTGAAAACATACTGG + Intronic
1047244132 8:123123465-123123487 TGGTGATGCTGCAAAGAAACTGG + Intronic
1048456270 8:134581403-134581425 CTCTGATTCTAGGAAGAAAGGGG - Intronic
1048472866 8:134719058-134719080 CTGAAAATGTGGAAAGAAACCGG + Intergenic
1048525858 8:135201817-135201839 CTGTGATGCTGGGGAGATACAGG + Intergenic
1050175059 9:2861256-2861278 CTATGTTCCTGGAAAGAAATAGG + Intergenic
1051205056 9:14678968-14678990 CGGTTTTTCTGGAAAGAGACAGG + Intronic
1052487496 9:29120176-29120198 CAGTGATCCTGGAAACAGACTGG - Intergenic
1053236134 9:36456002-36456024 CTCTGATGCTAGAAAGAAATGGG - Intronic
1057200739 9:93138517-93138539 CTCTGATTCTGGGAAGCCACTGG - Intergenic
1059056423 9:110986086-110986108 AGATGACTCTGGAAAGAAACAGG - Intronic
1059758362 9:117315315-117315337 TTGTGATTCTTAAAGGAAACTGG - Intronic
1060594397 9:124839757-124839779 CTGAACTTCTGGAAAGAAATGGG + Intergenic
1060916649 9:127396155-127396177 GTGTAATTCTGGAAAGAGCCAGG - Intergenic
1185550549 X:980304-980326 TAGGGATTCTGGAAAGAAAAAGG + Intergenic
1186686320 X:11928618-11928640 TTGTGAGTCTGTAAAGAAAAAGG + Intergenic
1187808270 X:23145150-23145172 CTGTGTTTCTTGAAACACACTGG + Intergenic
1188370992 X:29369422-29369444 CTTTGATTCTCGAAGGAAATGGG + Intronic
1188865107 X:35304907-35304929 CTATGTTTTTGCAAAGAAACTGG + Intergenic
1189539287 X:41969778-41969800 CTGTGATTCTGTCAAGTCACTGG + Intergenic
1189686641 X:43571130-43571152 ATTTGGTTCTGTAAAGAAACAGG - Intergenic
1191768686 X:64731938-64731960 TTGGGATGCTGGAAAGAAACAGG - Intergenic
1192030214 X:67503120-67503142 CTGAGATTCTGCAAAGTAAATGG + Intergenic
1193177786 X:78414825-78414847 CTTAGATTCTGGGAAGAAACAGG + Intergenic
1193422268 X:81295698-81295720 CTGTGCTTCAGCAAAGAGACTGG - Intronic
1194598832 X:95894573-95894595 ATGTAATTGTGGAAAGTAACTGG + Intergenic
1195047088 X:101063994-101064016 CCATGATTCTGTAAAGAAACTGG + Intergenic
1195079566 X:101358166-101358188 CTGTGATACTGGGTAGAAGCTGG - Intronic
1195352866 X:104011271-104011293 CTCTGTCTCTGGAAAGGAACAGG + Exonic
1196050598 X:111299655-111299677 CTGAGCTTCTAGAAAGAAATAGG + Exonic
1197687525 X:129457379-129457401 GTGTGACTGTGTAAAGAAACTGG + Intronic
1199301541 X:146219776-146219798 CTGAGATTGGGGAAAAAAACTGG + Intergenic
1199887779 X:152039190-152039212 CTGGGATTCTTTAAAGAAAATGG - Intergenic
1201382302 Y:13395315-13395337 CTGAATTGCTGGAAAGAAACTGG + Intronic
1201525802 Y:14932802-14932824 CTGTGTTGCTGCAAAGAAAATGG + Intergenic