ID: 1104513051

View in Genome Browser
Species Human (GRCh38)
Location 12:129399058-129399080
Sequence AGGAGCACACACATGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104513040_1104513051 19 Left 1104513040 12:129399016-129399038 CCTTCTTGCTGCATCATCCCATG 0: 63
1: 197
2: 463
3: 850
4: 1838
Right 1104513051 12:129399058-129399080 AGGAGCACACACATGGGACAAGG 0: 1
1: 0
2: 1
3: 28
4: 221
1104513046_1104513051 2 Left 1104513046 12:129399033-129399055 CCCATGGCAGGATGTGGAAGGGC 0: 1
1: 3
2: 31
3: 96
4: 356
Right 1104513051 12:129399058-129399080 AGGAGCACACACATGGGACAAGG 0: 1
1: 0
2: 1
3: 28
4: 221
1104513047_1104513051 1 Left 1104513047 12:129399034-129399056 CCATGGCAGGATGTGGAAGGGCA 0: 1
1: 2
2: 32
3: 118
4: 471
Right 1104513051 12:129399058-129399080 AGGAGCACACACATGGGACAAGG 0: 1
1: 0
2: 1
3: 28
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104513051 Original CRISPR AGGAGCACACACATGGGACA AGG Intronic
901179359 1:7330519-7330541 AGGAGCACCCACATGTACCATGG + Intronic
901452109 1:9342179-9342201 AGGCTCACTCACATGGAACATGG - Intronic
901943049 1:12678518-12678540 AGGAGCACACACTAGCAACAGGG + Intergenic
902700527 1:18169067-18169089 AGGAGCACCCACTTGGCAAATGG + Intronic
902809685 1:18881014-18881036 GTGAGCACACACCAGGGACAAGG - Intronic
904287379 1:29461196-29461218 AGGAGCACAGGGATGGGACTTGG - Intergenic
904602785 1:31683120-31683142 AGAAGCAGGCACAGGGGACATGG - Intronic
904618696 1:31763200-31763222 CGGAGCAGACACGGGGGACACGG + Intronic
905119036 1:35667606-35667628 CGGTGCATACACATGGGGCAGGG - Intergenic
905350554 1:37343394-37343416 AGGATCACACAGCCGGGACATGG - Intergenic
905412396 1:37779579-37779601 TGGAGGACACAGAAGGGACAGGG + Intergenic
905490880 1:38342902-38342924 AGTGGCACACAAATGGCACATGG + Intergenic
906148635 1:43575065-43575087 AGGAGCCCACAGATGGGCCCAGG - Intronic
907873051 1:58460297-58460319 AGATGCACACACGTGGGACTGGG + Intronic
908846801 1:68332995-68333017 AGGACCACACACATGGATAATGG - Intergenic
916863435 1:168831369-168831391 AGAAGCACACAACTGGGACACGG + Intergenic
917429857 1:174954786-174954808 AGGAGCAGAAACAAGGGCCAAGG - Intronic
920086300 1:203420076-203420098 AGCAGAACACACATGGGATGGGG + Intergenic
920972845 1:210757328-210757350 AGGAGTACACAGAAGGGACTGGG + Intronic
921079220 1:211725381-211725403 AGAAGCAAAACCATGGGACAAGG - Intergenic
923048260 1:230371275-230371297 AGGAACACAGCAATGGGACAAGG + Intronic
1064029880 10:11877105-11877127 AGCAGCTTACACATGGAACAGGG + Intergenic
1064182585 10:13131408-13131430 TGGTGACCACACATGGGACATGG + Intronic
1067708523 10:48628954-48628976 AGGAGCAGACACATTGGTCAGGG - Intronic
1069144183 10:64868587-64868609 AGAAGCACAGAAATGTGACAAGG - Intergenic
1069351552 10:67532702-67532724 AGGAGAAGAAAGATGGGACAGGG + Intronic
1071238651 10:83679209-83679231 AGAAGCACAGACATGGTAAACGG + Intergenic
1072607296 10:96995319-96995341 AGGAGCACACGCTTGGTACCAGG - Intergenic
1075444684 10:122505219-122505241 AAGAGCACACACCTGGGGCCAGG - Intronic
1075677827 10:124308519-124308541 ACGAGCTCACACATGTGACAGGG + Intergenic
1078329739 11:10409501-10409523 AGGAGCATTGACATGGGGCAGGG + Intronic
1079078861 11:17400057-17400079 AGGACCAAACTCAGGGGACACGG + Intronic
1082791022 11:57346914-57346936 AGGACAACACACATGGGAGAAGG + Intronic
1084201601 11:67562566-67562588 AGGAGCAGACAAATGGGGCCGGG + Intergenic
1084453764 11:69255467-69255489 AGGAGCTCATACATTGGAAATGG + Intergenic
1086931182 11:92694819-92694841 AGGAGCCCACACACAGGAGAGGG + Intronic
1087502217 11:98972076-98972098 ACGAGCACACACATTGGCCTAGG + Intergenic
1087833426 11:102845132-102845154 AGGATTACAGACATGGGTCACGG + Intergenic
1089112500 11:116067939-116067961 AGGAGCCCAAACATAGGCCATGG - Intergenic
1089811423 11:121134980-121135002 AGAAGCAGTCACATGGAACATGG + Intronic
1089872904 11:121692657-121692679 AGGAGCACATACACTGGACATGG - Intergenic
1091027717 11:132156892-132156914 AGGAACACACACAGAGGAGAAGG + Intronic
1091737445 12:2934551-2934573 AGCAGCACTCACATAGGAGATGG - Exonic
1093530326 12:20154216-20154238 TGGAGCACAGACATGTGACTTGG - Intergenic
1094276641 12:28684645-28684667 AGGAGCCCCCACATGGTACCAGG - Intergenic
1095587804 12:43867426-43867448 AAGAGTATACAGATGGGACAAGG + Intronic
1101033347 12:100681190-100681212 AGCAGCACACAGAGGAGACAGGG + Intergenic
1101682586 12:106984172-106984194 AGGAGCAAACACTTGAGAAAGGG - Intronic
1102858523 12:116315491-116315513 AGGGGCACACACATGGATGAAGG + Intergenic
1104065291 12:125300441-125300463 AGGGCCACACACAGGGGCCAAGG - Intronic
1104099120 12:125589650-125589672 AGGAGCAGACACATCTTACATGG + Intronic
1104513051 12:129399058-129399080 AGGAGCACACACATGGGACAAGG + Intronic
1104545137 12:129704324-129704346 GGGAGCACCCACATGGCCCATGG - Intronic
1107133025 13:36916767-36916789 AGGAGGACATACCTGGGACCAGG + Intronic
1107275608 13:38675238-38675260 AGGCCCACTCACATGGGAGAGGG - Intergenic
1107662188 13:42650194-42650216 AGGAGCACACAAATGAAACTGGG + Intergenic
1108528436 13:51305430-51305452 AGAAGCACACACATTGCTCAGGG - Intergenic
1108767780 13:53654607-53654629 AGAAGCACATACATGGGAGAAGG - Intergenic
1109790652 13:67242919-67242941 ACCAGCACACACATTGGACTAGG - Intergenic
1109859430 13:68178554-68178576 AGGAGCAAACACATCTTACATGG - Intergenic
1110143545 13:72160946-72160968 ATGAAAACACTCATGGGACATGG + Intergenic
1113933271 13:113979846-113979868 AGGTGCACACACATGGTATGAGG - Intronic
1113933292 13:113979976-113979998 GGGTGCACACACATGGGAGGAGG - Intronic
1113933307 13:113980062-113980084 TGGTGCACACACATGGGAGGAGG - Intronic
1113933323 13:113980158-113980180 AGGTGCACACACGTGGGAGGAGG - Intronic
1113933332 13:113980201-113980223 AGGTGCACACACATGGGAGGAGG - Intronic
1113933348 13:113980290-113980312 AGGTGCACATACATGGCAGAAGG - Intronic
1113933353 13:113980325-113980347 AGGTGCACACATGTGGGAGAAGG - Intronic
1113933356 13:113980345-113980367 AGGCGCACACACATGGCAGGAGG - Intronic
1113933374 13:113980438-113980460 AGGTGCACACACATGGCAGGAGG - Intronic
1113933377 13:113980458-113980480 AGGTGCACACACATGGGTGGAGG - Intronic
1115136604 14:30116842-30116864 AAGAGCAAACAGAGGGGACAAGG + Intronic
1115368768 14:32588424-32588446 AGGCAGACACAAATGGGACAAGG - Intronic
1115651872 14:35408266-35408288 AGGAGCACCCCCATGGGAAAAGG + Intergenic
1116394537 14:44431464-44431486 GGGAGCGCACAGATGGGAGAGGG - Intergenic
1117940302 14:60957392-60957414 AGGAGCAAACACATCTTACATGG + Intronic
1118087222 14:62431614-62431636 AGGAGCACAGACATCCCACATGG - Intergenic
1118916628 14:70112871-70112893 AGGAACACAGACAGGGGAGAAGG - Intronic
1119498043 14:75097860-75097882 AGCAGCACAAACAAGGAACAAGG + Intronic
1119648702 14:76367841-76367863 AGGGGGAGAAACATGGGACAAGG - Intronic
1121250557 14:92496755-92496777 AGGAGGAGACACAAGTGACAAGG - Exonic
1121834548 14:97080080-97080102 AGAAGCACACACATGGAAAAGGG + Intergenic
1122648812 14:103213701-103213723 ATGAGCATTCACATGTGACAAGG + Intergenic
1122943656 14:104995023-104995045 AGCAGCATTCACATGGGGCAGGG - Exonic
1128308584 15:66616291-66616313 AGGACCACACAGTTGGCACAAGG - Intronic
1129034291 15:72640345-72640367 GGGTGCTCACACATGGGGCACGG - Intergenic
1129156542 15:73721740-73721762 AGGGCCACACACATTGGACCAGG - Intergenic
1129215591 15:74096871-74096893 GGGTGCTCACACATGGGGCACGG + Intergenic
1129534208 15:76298396-76298418 AGGAGCCACCACATGGGATAAGG + Intronic
1129732727 15:77941200-77941222 GGGTGCTCACACATGGGGCACGG + Intergenic
1131224305 15:90611289-90611311 GGGAGCACACAGAAGGAACATGG + Intronic
1131481717 15:92787917-92787939 ATGAGAACAGAGATGGGACAGGG + Intronic
1131811855 15:96181051-96181073 AAGATCACACAACTGGGACATGG + Intergenic
1132321315 15:100927470-100927492 AGGGACACACACAAGGGCCAAGG + Intronic
1132959751 16:2615212-2615234 AGGAACCCACATATGGGACATGG - Intergenic
1132972819 16:2697200-2697222 AGGAACCCACATATGGCACATGG - Intronic
1135752881 16:25070885-25070907 AGGAGCAGACACAGCTGACATGG - Intergenic
1138146012 16:54612454-54612476 AGGAGCTAACTCATGGGGCAGGG + Intergenic
1138677854 16:58665085-58665107 AGGATCAGACACAGGGGACACGG + Intergenic
1139159613 16:64488630-64488652 AGGAGCACATACATATGATAGGG + Intergenic
1139959817 16:70711054-70711076 ATGAGGACACTGATGGGACAGGG - Intronic
1140733029 16:77873577-77873599 AGCAGCACAAACATGGTCCAAGG + Intronic
1141389646 16:83653975-83653997 AGGAACACACACATGGGTGGGGG + Intronic
1141881708 16:86864550-86864572 AGGATCAAAAACCTGGGACAGGG - Intergenic
1142198585 16:88750477-88750499 AGGAGGGCAGACACGGGACATGG - Intronic
1144034692 17:11354632-11354654 AGGAGCTCACACATCAGCCAAGG + Intronic
1145215439 17:21048059-21048081 AGGTGCAGACACATGGAAAAAGG + Intergenic
1146630334 17:34464959-34464981 GGGAGCACACATATGGGGGATGG - Intergenic
1146830540 17:36065466-36065488 AGGAGACAACCCATGGGACAAGG - Intronic
1147780657 17:42939069-42939091 AAGAGCATACAAATGGTACATGG - Intergenic
1149373435 17:56019671-56019693 ATGAGTACACTTATGGGACAAGG - Intergenic
1149375120 17:56035988-56036010 AGGAGCACACAGATGGTAGAAGG - Intergenic
1149608398 17:57941081-57941103 GGGCGCAGACACATGGGAGAAGG + Intronic
1149623019 17:58060311-58060333 AGGAGCTCACAGACTGGACAGGG + Intergenic
1149982693 17:61323846-61323868 AGGAACCCACACAGGGGCCAGGG - Intronic
1150571841 17:66393621-66393643 ACGTGCACACACATGGAAGAAGG - Intronic
1150653202 17:67023142-67023164 AGGAGAAGACACAGGGGAGAAGG - Intronic
1151345508 17:73499056-73499078 GGGAGCACAGGCATGGCACAGGG - Intronic
1151933484 17:77247529-77247551 AGGACCACACACTTGGAAGACGG - Intergenic
1155154645 18:23148317-23148339 AGGAGCCCTCACACGGGAGAGGG - Intronic
1156558304 18:38092393-38092415 AGGAGCACCCACCTGTGACAAGG + Intergenic
1156900685 18:42297498-42297520 AGGAGGGCTCACTTGGGACATGG - Intergenic
1159379045 18:67632529-67632551 AGGGCCATACACATTGGACATGG + Intergenic
1164445647 19:28315641-28315663 AGGAGCAAAGGCATGGGCCAAGG - Intergenic
1164735672 19:30539374-30539396 AGGTGCACCCACATTGGAGAGGG + Intronic
1164752448 19:30666628-30666650 AGAAGCCCACACATGGGGTAAGG + Intronic
1165895977 19:39141181-39141203 AGGAGCAGGCACAGGCGACAAGG - Intronic
1166531376 19:43545550-43545572 AGGAGGTCACACCTGGCACATGG + Intronic
1167782235 19:51606228-51606250 AGGTGCTCAGATATGGGACACGG + Intergenic
925361738 2:3284787-3284809 AGGAGCACACAGTTGGGAAAGGG + Intronic
925738990 2:6988677-6988699 AGGAGCTCACACACGTGAAAAGG - Intronic
928139604 2:28717279-28717301 TGGAGAACAAACAGGGGACAGGG - Intergenic
928706859 2:33958955-33958977 AAGACCACACACCTGGGAGAGGG + Intergenic
929124522 2:38511091-38511113 AAAAGCTGACACATGGGACATGG + Intergenic
929136178 2:38625726-38625748 AGGATTACACACATGAGCCATGG + Intergenic
932067186 2:68577293-68577315 ATGAGAATACACATGGCACAGGG - Intronic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
933112150 2:78416441-78416463 CTGAGCTCACACATGGAACAGGG + Intergenic
933220243 2:79679572-79679594 AGGACCACAGAGATGGGAAAGGG - Intronic
933357948 2:81237708-81237730 AGCAGCAGACAGTTGGGACATGG + Intergenic
933592917 2:84252338-84252360 AGGCGTACACACAGAGGACAAGG + Intergenic
934784789 2:96997261-96997283 AGGAGCACACAGAAGTGACATGG + Intronic
935266878 2:101402512-101402534 ATGCCCACACACATGGGCCAGGG - Exonic
935832317 2:107012905-107012927 ATCAGCACACACATAGGACAAGG + Intergenic
938018827 2:127889318-127889340 CGGAGGACACACAGGAGACAGGG - Intergenic
938233143 2:129679019-129679041 GCGAGCACACACATGGTTCAGGG + Intergenic
938243339 2:129759435-129759457 GTGTGCACACCCATGGGACATGG - Intergenic
938291802 2:130154581-130154603 AGGAGGACACCCCTGGGTCATGG - Intronic
938464747 2:131518383-131518405 AGGAGGACACCCCTGGGTCAGGG + Intergenic
938736730 2:134192276-134192298 AAGAGCACACTCATGGGAGGAGG - Intronic
939866771 2:147481735-147481757 AGGAGCACAGGCAGGGGAAAAGG + Intergenic
940337548 2:152545002-152545024 AGGTGAACGCACATGGGCCAGGG - Intronic
944921858 2:204422529-204422551 AGGAGCACACTCTTGAGATAAGG + Intergenic
945039655 2:205733355-205733377 AGGAGCACACAGAGGGGATGTGG + Intronic
945713614 2:213330936-213330958 AGGAGCAAACACATCTTACATGG - Intronic
947090712 2:226508265-226508287 AGGAGCAAACAAATGGGCAAAGG - Intergenic
947746007 2:232507696-232507718 ATGTGCACACACATGGGGGAAGG + Intergenic
948312082 2:236994899-236994921 AGGAGCACAGACGTGGGAAGAGG - Intergenic
1172609296 20:36237624-36237646 AGGAGCACACAGATGTCACAAGG + Intronic
1173522211 20:43708725-43708747 AAGAGCACACACATGGCCAAAGG - Intronic
1173978268 20:47203707-47203729 AGATGCACCCACATGGGACCTGG + Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1178880715 21:36448002-36448024 TGGGGCACACACATGGCACATGG + Intergenic
1179002599 21:37477276-37477298 AGGAACACAAAGATGGGCCAGGG + Intronic
1179469208 21:41599319-41599341 AGGAGCCCAGACAGGGCACATGG + Intergenic
1179532249 21:42027898-42027920 AAGACAACGCACATGGGACATGG + Intergenic
1180937834 22:19637734-19637756 GGGAGGACAGACATGGCACATGG - Intergenic
1181111436 22:20605203-20605225 AGGAGGACACCCCTGGGTCATGG - Intergenic
1181639327 22:24188514-24188536 AGGACCAGACACCTGGGACCTGG + Exonic
1183536284 22:38403454-38403476 AGAAGGACACACAAGGGACCAGG + Intergenic
1183721353 22:39564281-39564303 ACAATCACACACATGGCACATGG - Intergenic
1184073708 22:42162901-42162923 AGGAACACACACAGAGGCCATGG + Intronic
1184572183 22:45332340-45332362 AAAAGCACACACATGTGACTTGG + Intronic
1184832363 22:46996782-46996804 GGGAGCACACACATGACACTAGG - Intronic
1185278309 22:49959329-49959351 AGGAGCACAGGCATGGGCCCAGG + Intergenic
1185419597 22:50728145-50728167 AGAAGCAGACACCTGGGCCATGG + Intergenic
949422361 3:3879515-3879537 AGGAGGACACAATTGGGAAAGGG + Intronic
951925624 3:27906022-27906044 AGGAGCACACTCAGGTGAAAGGG - Intergenic
954098174 3:48347706-48347728 AGGAGAACTCAGATGGGCCAAGG + Intergenic
954307724 3:49738784-49738806 AGGAGGACACACACAGGAAATGG - Intronic
955379057 3:58422210-58422232 AGGAACACAGACCTGGGACTCGG - Intronic
955638900 3:61060553-61060575 AGGAGTACACACAGATGACAGGG - Intronic
959173744 3:102877278-102877300 TGGGGTACACAAATGGGACAAGG + Intergenic
961144508 3:124583165-124583187 AGAAACACACTCATGGGACAAGG - Intronic
962424613 3:135258762-135258784 AGGAACACACCCCTGGAACAAGG + Intronic
964956678 3:162367480-162367502 GTCAGCACACACATGGTACAGGG + Intergenic
968962299 4:3751813-3751835 AGGAGCACTCAAGTGGGACTCGG - Intergenic
973828778 4:54737318-54737340 AGGAGGACACACCTGGAACTGGG - Intronic
977534077 4:98236664-98236686 AGGAGCTTACATATGGGTCAAGG - Intergenic
977858936 4:101931883-101931905 AGGAGCAGAAACATGGGCCATGG + Intronic
982145060 4:152378388-152378410 TGGAGCACAGATAAGGGACAAGG - Intronic
984896629 4:184547317-184547339 AGGTGCACACAGCTGGGACCTGG - Intergenic
990075363 5:51839386-51839408 AAGAGCACTTACATGGAACATGG + Intergenic
991921353 5:71660585-71660607 AGTAGCACAAACATGTGACTTGG - Intergenic
992524157 5:77590428-77590450 GGGACCACACAGATGGCACATGG + Intronic
992770240 5:80040873-80040895 GGGAGCAGACACATGGGAAGAGG + Intronic
994296320 5:98092791-98092813 GGGAGCACAGAGATGGGAGAGGG + Intergenic
994795971 5:104300036-104300058 AGGGGCACATACTTGGGCCATGG + Intergenic
998649944 5:144107397-144107419 AAAAGCACACAAATGTGACAGGG - Intergenic
1001953459 5:175832028-175832050 AGGAGCACAGACAAGAGACATGG - Intronic
1002192099 5:177483638-177483660 AGGGGCTCACACATGAGAGAAGG + Exonic
1004406020 6:15334562-15334584 AGGAGCAAGCACATGGTAAAAGG - Intronic
1006914310 6:37584824-37584846 AGGAGCACAGAGAAGGGAGAAGG - Intergenic
1011771583 6:90679181-90679203 TGCAACAAACACATGGGACAGGG - Intergenic
1011794436 6:90937099-90937121 ATGAGCACTCACAAGGGCCAGGG - Intergenic
1015213051 6:130719891-130719913 AGAATCACAGACATGGGAAATGG + Intergenic
1015932633 6:138376700-138376722 AGGAACACATAAATGGAACAAGG + Intergenic
1015951768 6:138560349-138560371 AATAGCACACAAATGAGACACGG + Intronic
1017595771 6:156027252-156027274 AGCAGCCCACTCATGGGAGAGGG - Intergenic
1017628249 6:156370039-156370061 AGGAGCACTCACATGTGACTTGG + Intergenic
1017754221 6:157516002-157516024 AGGAGGGCACACAGGGGACTTGG - Intronic
1019161230 6:170068142-170068164 AGCAGCCCACACATGCGACATGG - Intergenic
1019611419 7:1938703-1938725 AGGTGCACACACATGGGCCAGGG + Intronic
1019611464 7:1938952-1938974 AGGCGCACACACACGGGCCAGGG + Intronic
1019611525 7:1939229-1939251 AGGCACACACACACGGGCCAGGG + Intronic
1020955771 7:14739027-14739049 AAGAGCATACACTTGGGACTTGG - Intronic
1022475229 7:30705716-30705738 AGGAGCCTGCACATGGGACAGGG - Intronic
1023888508 7:44376910-44376932 AGGGACACTCAGATGGGACAGGG - Intergenic
1027219615 7:76205602-76205624 AGGACCACAGGCATGGGACTAGG - Intronic
1029149156 7:98467863-98467885 AGGTGCACATACATGTAACATGG - Intergenic
1029577613 7:101413801-101413823 AGGAGGACAGAACTGGGACATGG - Intronic
1036758987 8:11494007-11494029 TGGTGCACACAGATGGCACATGG + Exonic
1037989579 8:23311305-23311327 AGGTGCACACAGATGGCACATGG + Intronic
1038342318 8:26696952-26696974 AGCAGCACATACTTGTGACAGGG + Intergenic
1042473197 8:69214457-69214479 ATGAGTACACACATAGGAAAAGG - Intergenic
1042712449 8:71733633-71733655 AGGCGGATACAGATGGGACATGG + Intergenic
1045706613 8:104930757-104930779 AGAAACACACACATGGGGGAGGG - Intronic
1047776284 8:128073415-128073437 AGAATCACACACCTGGGAGATGG + Intergenic
1048506833 8:135029419-135029441 AGGAGGATCCACATGGGACAAGG - Intergenic
1049324999 8:142017152-142017174 CGGAGCAGGCACATGGGCCAGGG + Intergenic
1049943455 9:571735-571757 AGAAGCAGACACATGGAGCAAGG + Intronic
1050119456 9:2293432-2293454 TGGAGCACCCACATAGCACATGG - Intergenic
1050663297 9:7907563-7907585 AGGAACACAGAGGTGGGACAGGG - Intergenic
1051104819 9:13567225-13567247 AAAAGTACACACATGGGGCAGGG - Intergenic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056650135 9:88452165-88452187 ATGAGAACACACTAGGGACAAGG - Intronic
1060108991 9:120893334-120893356 GGGAGCAGAGACCTGGGACAAGG - Intronic
1060520455 9:124291198-124291220 AGGTGCACACAACTGGGACGTGG + Intronic
1061940500 9:133881282-133881304 CGGAGCGCAGACGTGGGACAAGG + Intronic
1062215239 9:135385559-135385581 AGGAGCAAACAAATGGAACGAGG - Intergenic
1189615055 X:42774587-42774609 AGGAGCACATATGTGTGACATGG - Intergenic
1189755896 X:44271013-44271035 AGGTTCACACACTTGGGACAGGG - Intronic
1189849477 X:45164583-45164605 AACATCACACACATGGGCCAGGG + Intronic
1192334486 X:70205888-70205910 AGGAGCAGAAACATGGGAACTGG + Intergenic
1193692635 X:84666243-84666265 AGAAGCACACACTGGGGAAAGGG - Intergenic
1195676452 X:107510847-107510869 AGGAGCACAGTCCAGGGACAGGG - Intergenic
1197156769 X:123278683-123278705 AAGAGCACACATTTGGGAAAAGG - Intronic
1198678253 X:139153845-139153867 ACATGCACACACATGGGAAAAGG + Intronic
1199878320 X:151953036-151953058 GGGAGCAAACACTTGGGTCATGG + Intergenic
1200088473 X:153623438-153623460 GGGAGCAAACACAGGGGGCAAGG - Intergenic
1202194656 Y:22286851-22286873 AGGAGCAGATCCATGGCACATGG + Intergenic