ID: 1104515273

View in Genome Browser
Species Human (GRCh38)
Location 12:129419358-129419380
Sequence CAGGGAAAAGAGCCTCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104515273_1104515279 7 Left 1104515273 12:129419358-129419380 CCTGCAAGAGGCTCTTTTCCCTG 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1104515279 12:129419388-129419410 GGGGATGAAGATGAGCGTGCAGG 0: 1
1: 0
2: 0
3: 20
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104515273 Original CRISPR CAGGGAAAAGAGCCTCTTGC AGG (reversed) Intronic
902520660 1:17013898-17013920 CAGGGAATAGAGCCCCTTTAAGG - Intergenic
902783647 1:18719646-18719668 AAGGGAAGGGAGCCCCTTGCCGG - Intronic
903778616 1:25808386-25808408 CAGGGAGAGGAGCCTCTCTCTGG + Intronic
904031198 1:27534409-27534431 GAGGGAGAAGAACCTCTTGCGGG - Exonic
904132853 1:28288190-28288212 CAAAGAAAAGAGCTTCCTGCTGG - Intergenic
904744859 1:32704209-32704231 CAGCAAACAGAGCCTCTGGCAGG - Intergenic
914833356 1:151187211-151187233 AAGGGAAAAAAGCCACTTGAGGG + Intronic
915789697 1:158654839-158654861 AGGAGAAAAGAGCCTCTGGCTGG + Intronic
915811003 1:158910310-158910332 AAAGAAAAAGAGCCTCTTTCTGG + Intergenic
915978143 1:160403860-160403882 CAGGGAAGAAAGCCACTTGGTGG - Intronic
918071907 1:181139497-181139519 CTGGGAAGAGAGTCCCTTGCAGG + Intergenic
918250554 1:182699595-182699617 CAGGGAGAAGAGCCTCCAACAGG - Intergenic
918912847 1:190595714-190595736 CAGGGAAAAGACCCGCTAACTGG + Intergenic
922239021 1:223743374-223743396 CCAGGAAAAGAGGCTCTGGCAGG - Intronic
923552449 1:234974879-234974901 AAGGAGAAGGAGCCTCTTGCAGG + Intergenic
924559258 1:245143912-245143934 CAGGGAAGAGAGGGACTTGCTGG - Intergenic
1062997624 10:1881766-1881788 CAGAGAAGGGAGCCCCTTGCAGG + Intergenic
1064763928 10:18651751-18651773 CAGGTGAAAGAGCCTCACGCAGG - Intronic
1065722222 10:28637765-28637787 CAGGGAACATAGCCTCTGCCAGG + Intergenic
1067040628 10:42951532-42951554 CAGGGAAATGAGGCTCCAGCTGG + Intergenic
1069679968 10:70277451-70277473 CAGGGCACAGAGACTCTGGCAGG + Intronic
1077347587 11:2071108-2071130 CCGGGAAAAGATCCCCTTTCAGG + Intergenic
1077434742 11:2533406-2533428 CAGGGAGGAGAGCCACTTCCTGG + Intronic
1078861885 11:15256138-15256160 CAGGGGAAAGAGCAGCTTTCAGG + Intergenic
1080889948 11:36400866-36400888 CAGGGAATAGATGCTATTGCTGG + Intronic
1081378689 11:42389032-42389054 CAAGGAAAAGAGCCTCAAGGAGG + Intergenic
1084349384 11:68584299-68584321 CTGGGAAAAGGGCTGCTTGCAGG - Intronic
1085515334 11:77108273-77108295 CAGGGAAAAGAGAGCCATGCTGG + Intronic
1088463901 11:110112667-110112689 CAAGGAAAAGGGCCTCTGGCAGG - Intronic
1088526503 11:110761907-110761929 CAGGGAGAAGAGCCCATTCCTGG - Intergenic
1088773041 11:113054610-113054632 CAGTGAAAACAGCCTCTCTCAGG - Intronic
1089807586 11:121105251-121105273 TTGGGCAAAGAGCCTCTTGCAGG + Intronic
1089943068 11:122439842-122439864 CAGGGAAAAGAAGTTCTTCCTGG + Intergenic
1091024227 11:132127655-132127677 CAAGGAAAAGAACCTCTTTGGGG - Intronic
1091266178 11:134272894-134272916 CAAGGACAGCAGCCTCTTGCTGG + Intergenic
1091451812 12:576693-576715 CTGGCAAAACGGCCTCTTGCAGG - Intronic
1092049713 12:5459475-5459497 CCTGGGAAATAGCCTCTTGCTGG - Intronic
1093768347 12:22991259-22991281 AAGGTAAAAGAGCATCTTGTGGG + Intergenic
1096573578 12:52539089-52539111 CAGGGAAAGGGGCCCCATGCAGG - Intergenic
1100991448 12:100255585-100255607 AAGGGAAAGGAGCCTCATTCAGG + Intronic
1102471502 12:113162254-113162276 CAGGGACAAGGGCCTCCTGGAGG + Intronic
1102700759 12:114837284-114837306 TTGGGTAAATAGCCTCTTGCTGG + Intergenic
1104515273 12:129419358-129419380 CAGGGAAAAGAGCCTCTTGCAGG - Intronic
1104892390 12:132146810-132146832 AAAGCAAAAGAGCCTCGTGCGGG - Intronic
1105434050 13:20362145-20362167 CAGAGCAAAGAGCCTTTTGAGGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1118021918 14:61725716-61725738 CTGAGAAAAGAGCATCTTGCTGG - Intronic
1120831846 14:89004434-89004456 CTGGGAAATGAGTCTTTTGCTGG - Intergenic
1120860761 14:89253256-89253278 CGCGGAAAAGAGCCTCTGGCAGG + Intronic
1122625935 14:103085363-103085385 CTGGGAAGAGAGCCCCTGGCAGG - Intergenic
1123578283 15:21694662-21694684 CTGGGAACAGAGCCAGTTGCAGG + Intergenic
1123614908 15:22137144-22137166 CTGGGAACAGAGCCAGTTGCAGG + Intergenic
1124219267 15:27835334-27835356 CAGGGGAAGGAGCTTCTTGATGG - Intronic
1124353758 15:28979425-28979447 CAGGCAGCAGAGCCTTTTGCCGG - Intronic
1124995943 15:34722839-34722861 CACGGAGAAGAGCATTTTGCAGG + Intergenic
1126164690 15:45644837-45644859 AGGGGAAAATTGCCTCTTGCAGG + Intronic
1128657932 15:69476162-69476184 CTGGGAGAAGAGCCCCTGGCAGG - Intergenic
1202987153 15_KI270727v1_random:428907-428929 CTGGGAACAGAGCCAGTTGCAGG + Intergenic
1133100967 16:3479503-3479525 AAGGGAAAAGAACTTCTTGTTGG - Exonic
1133408072 16:5542060-5542082 CAAAGAAAACAGCCTCTTGAGGG + Intergenic
1136317029 16:29460478-29460500 CAGGGGCTAGAGCCTCGTGCGGG - Intronic
1136431604 16:30199820-30199842 CAGGGGCTAGAGCCTCGTGCGGG - Intronic
1143347202 17:6258538-6258560 CAGGGAGAGGAGGCTGTTGCTGG + Intergenic
1143736833 17:8916822-8916844 CAGGGAGGAGAGCCTCTTGGGGG + Intronic
1143993868 17:10990088-10990110 CAGGGAAGGGAGCCTATTGGTGG + Intergenic
1144773060 17:17770276-17770298 CAGGGGAAGGAGCCTGTGGCTGG + Intronic
1146453880 17:32994862-32994884 CAGGGAGAAGGGCTTTTTGCAGG + Intronic
1146708130 17:35017068-35017090 CAGGGAAATGTGCCTCTTGTGGG - Intronic
1147453651 17:40521215-40521237 CAGGGACAAGAGTCGCTTGGTGG + Intergenic
1148452792 17:47790860-47790882 CAGTGAAAAGAGCAACTTGGAGG - Intergenic
1149595614 17:57862893-57862915 CAGGCCAAAGAGCCTCTGGTGGG + Exonic
1151552929 17:74832246-74832268 CAGGGAAACGAGCTTCTAGATGG + Intronic
1151750221 17:76032874-76032896 CAGCCAAAAGAGCCTCCTCCTGG - Intergenic
1152403244 17:80082274-80082296 CAGGGAAATCAGCCTTTGGCTGG - Intronic
1153698791 18:7671369-7671391 CAGGGAAAAGTGTCTCTCTCAGG - Intronic
1153960270 18:10134410-10134432 CAGGGAGAAGAGCCACTGGGAGG - Intergenic
1154986008 18:21551593-21551615 CAAGGAGAAGAGTCTCTTGCTGG + Intronic
1157521122 18:48346285-48346307 CATGGCAAAGAGCCTTGTGCTGG - Intronic
1158118886 18:54026383-54026405 CAGGGAGCAGAACTTCTTGCTGG + Intergenic
1158406694 18:57166134-57166156 CAGGAAAGAGAGCATTTTGCAGG + Intergenic
1160373798 18:78395862-78395884 AAGGGAAAGCAGCCCCTTGCTGG + Intergenic
1160896830 19:1407096-1407118 CAGGGGAAGGAGCCTCGCGCGGG + Intergenic
1161331757 19:3691959-3691981 CAGGGAAAAGAGCCTGGGGTGGG - Intronic
1162017052 19:7851600-7851622 GAGGGAAGAGAGCCCCTTGGGGG + Intronic
1164842109 19:31400348-31400370 CAGGGAAAAACTCTTCTTGCTGG + Intergenic
1164918173 19:32068561-32068583 GAGGGAAAAGAGGCTCTGCCAGG - Intergenic
1165159789 19:33809382-33809404 TAGTGTAAAGGGCCTCTTGCAGG + Intronic
1166693040 19:44835558-44835580 CAGGGAAATGAGCACTTTGCTGG + Intergenic
1168607706 19:57772908-57772930 CAGGGAAAAGAGACTATGTCAGG - Intronic
926330441 2:11821214-11821236 CCTGGAAAAGAGCCTCTGGCAGG + Intronic
927053049 2:19348767-19348789 CAGGGAAAAGAACAGCTTGCAGG - Intergenic
927880293 2:26685598-26685620 AAGGGAAATGGGCCTCTGGCAGG - Intergenic
932452928 2:71827337-71827359 CTGGGAAAGTAGTCTCTTGCTGG - Intergenic
932641232 2:73449290-73449312 CAGGGAAAAGAAAGTCTGGCAGG - Exonic
934501385 2:94862465-94862487 CAGGGCACAGAGCCTCGGGCAGG + Intergenic
934909324 2:98236385-98236407 CACAGAAATGAGCATCTTGCTGG + Exonic
936578017 2:113671399-113671421 CAGGGAAGAGAGTCTCATCCCGG - Intergenic
937958686 2:127438329-127438351 AAGGGAAAAGAGCCTCTGGGGGG + Intronic
941031346 2:160515362-160515384 CAGGGAAGAGAGCAGCTTGGGGG + Intergenic
942476042 2:176321843-176321865 CAGGGATAACAGCCTCTACCAGG + Intronic
944889339 2:204100836-204100858 CAAGGAATAGAGCCTCTTTGGGG - Intergenic
946189587 2:218001382-218001404 CTGGGAAAAGTGCCTCATCCTGG - Intronic
948270302 2:236668923-236668945 CAGGGAAAAGAGGGTCCTGGAGG - Intergenic
948596284 2:239081749-239081771 CAGTGGACAGAGCCCCTTGCCGG + Intronic
1171376892 20:24699974-24699996 CATGGAGAGGAGCCCCTTGCTGG + Intergenic
1172113900 20:32562790-32562812 CAGGGAAAGGCCCCTCCTGCAGG - Intronic
1173084704 20:39904587-39904609 CAGGGAAAAGGGCCTCTGCTGGG - Intergenic
1173502932 20:43566642-43566664 CATAGAAATGAGCCACTTGCAGG + Intronic
1175974414 20:62703196-62703218 GAGGAGACAGAGCCTCTTGCGGG + Intergenic
1180120230 21:45741120-45741142 GAGGGAAAGGAGCCACTTGGTGG + Intronic
1180248291 21:46562938-46562960 CAGGGAAAAGAGCGACGTGGAGG - Intronic
1181627906 22:24133818-24133840 CTGGGCAAAGAGCCTCTTGGTGG - Intronic
1182121094 22:27787481-27787503 CAGGGAAATCTTCCTCTTGCTGG + Intronic
1183342941 22:37292056-37292078 CTGGGAAATGAGCCTGTAGCAGG - Intronic
1184947406 22:47813397-47813419 CGTGGAGAAGAGCCTCTTCCTGG - Intergenic
953394621 3:42557911-42557933 CCTGGAAAAGAGCCTTTTTCTGG - Intronic
955252360 3:57297090-57297112 CAGGGAAGAGGGCCTCGTGATGG - Intronic
956178713 3:66499289-66499311 CACAGAAAAGAACCTCTTTCGGG + Intronic
956228106 3:66982466-66982488 AAGGGAAAGGAGCCTCCTGCAGG + Intergenic
956502595 3:69902614-69902636 AAGGAAAAAGAGCCTCAGGCTGG - Intronic
961511280 3:127405300-127405322 CAGGGTAAAGAGCCACTGCCTGG - Intergenic
963025410 3:140914025-140914047 CAGGGATGTGGGCCTCTTGCTGG + Intergenic
968607217 4:1541212-1541234 CAGGGAAAAGGGCCCCGAGCTGG - Intergenic
970046961 4:11865365-11865387 CAGGCAAAAGAGGCTATTGTGGG - Intergenic
971167889 4:24202991-24203013 CTGGAGAAAGAGCCTCTTTCTGG - Intergenic
972941884 4:44206035-44206057 TAGGGAAAAGAGCCTGGTACTGG + Intronic
973620450 4:52721292-52721314 CAGGGAAAACAGACTCAGGCTGG + Intergenic
975696009 4:77013795-77013817 CAGGGAACAGAGAGTCTTTCGGG - Intronic
976256443 4:83105493-83105515 AAAGGAAAAGAGCCTCTTCGAGG + Intronic
977214650 4:94266100-94266122 CAGAGAAAAGAGCTTCTTTGTGG - Intronic
978333264 4:107638633-107638655 GAGGGCAGAGAGCCTCTTGAGGG - Intronic
986357876 5:6946729-6946751 CAGGGAGAAGAGCCTAGAGCTGG + Intergenic
986680837 5:10231552-10231574 CAGGGAAGAGCGCCTCGGGCAGG - Intronic
986688028 5:10291020-10291042 CAGGGAAAAGGGACTCTTCAGGG + Intronic
987385686 5:17327086-17327108 CAGTGAACAGAGCTTCTGGCTGG - Intergenic
989152951 5:38318125-38318147 CATGGAAGAGAGTCTCCTGCTGG + Intronic
989704577 5:44313475-44313497 CAGTTAAAAGAGCCTCCTGGAGG + Intronic
990470630 5:56111966-56111988 CATGGTAAAGAGCCTCTTCTGGG - Intronic
991188310 5:63837618-63837640 CAGAGCCAAGAGCCTCTTGCAGG + Intergenic
992873017 5:81025163-81025185 CAGCGAAAAGGGCAGCTTGCAGG - Intronic
993620166 5:90158814-90158836 GAGGGAAAAAAGCCTGTTTCAGG - Intergenic
994658454 5:102623897-102623919 CAGGGAATTGAGCCTGCTGCTGG - Intergenic
997202805 5:132022919-132022941 CAGGCAAAGGAACATCTTGCAGG + Intergenic
1000426051 5:161092990-161093012 CAGGGAAAAAGGCCTTATGCGGG - Intergenic
1000648947 5:163791975-163791997 AACTGAAAAGAGCATCTTGCAGG - Intergenic
1004134302 6:12951620-12951642 CAGAGCAAAAAGCCTCTTCCTGG + Intronic
1006025352 6:31143261-31143283 GAGGGATAAGAACCTCATGCTGG - Exonic
1006380186 6:33692721-33692743 CTGGGAAGAGAGACTCCTGCAGG - Exonic
1007526531 6:42499812-42499834 CAGGGAAAACAGCCTTATGATGG + Intergenic
1007755476 6:44096521-44096543 CAGGAAAGAGAGCATCTGGCAGG - Intergenic
1008125873 6:47667676-47667698 GAGACAAAAGAGCCTCCTGCTGG + Intronic
1009419058 6:63444980-63445002 CATGGAAAAGTGCCATTTGCAGG + Intergenic
1010403903 6:75480789-75480811 CAGCCAAAGAAGCCTCTTGCAGG - Intronic
1012145379 6:95673705-95673727 GAAGCCAAAGAGCCTCTTGCTGG + Intergenic
1019035658 6:169055318-169055340 CAGGGAAGTGAGTCTCTTGTAGG + Intergenic
1020145456 7:5638926-5638948 TAGGGAAAAAAGCTGCTTGCTGG - Intronic
1020149863 7:5673541-5673563 CAGGGAAGAGAGCAAGTTGCAGG + Intronic
1023660918 7:42470102-42470124 TAGGGAAGTGAGCCTCTTCCTGG + Intergenic
1024606885 7:51028840-51028862 CAGGGAAATGATCCTGATGCCGG + Exonic
1024658674 7:51473346-51473368 CAGAAAAAAGAGCATCTTGTTGG + Intergenic
1026095504 7:67343332-67343354 CAGGGACCAGAGACTGTTGCTGG + Intergenic
1028383986 7:90232543-90232565 CTGGGAAAAGAGCCAATTTCTGG + Exonic
1031764653 7:125762918-125762940 CAGGCAAGAGAGCTTGTTGCAGG - Intergenic
1034242992 7:149624225-149624247 CAGAGAAAAGAGCCTCGGGTGGG + Intergenic
1034870628 7:154680089-154680111 CCAGGAGAAGAGCCTCTTGGTGG - Intronic
1034936534 7:155203933-155203955 CAGGTAAAGAAGCCTCATGCAGG + Intergenic
1037138841 8:15495708-15495730 CAGGGAAAATGGACTCTTCCTGG + Intronic
1037698004 8:21244295-21244317 CTGGGAAAATACCCTCTTGAAGG + Intergenic
1038289833 8:26239206-26239228 CAGGCAAGAGAGCATGTTGCAGG + Intergenic
1038596790 8:28893517-28893539 CAAGGAAAGGAGCCTTTAGCTGG + Intronic
1039350207 8:36756046-36756068 AGGGGGAAAGAGCCTCTTGTTGG - Intergenic
1040949350 8:52920500-52920522 GAGGGAAAAGAGCCACTTCCAGG - Intergenic
1041863575 8:62542085-62542107 CAGGGGAAAGAGCCTCTCTGAGG - Intronic
1042269727 8:66942704-66942726 CAGGAAATAGAGCTTCTTGCAGG - Intergenic
1042813923 8:72857165-72857187 CAGGTACATGAGCCTCTTGAGGG + Intronic
1048019817 8:130527906-130527928 CAAGGAAAAGAGCATCTGACTGG + Intergenic
1048314919 8:133354828-133354850 CAGGGAAAATAGCATCTCACAGG - Intergenic
1055329681 9:75170961-75170983 CAGGGAAGAAAGCCTGTTGGTGG - Intergenic
1058558335 9:106195730-106195752 AAGGGAAAAGAGTCTCTTTCTGG - Intergenic
1059703236 9:116795991-116796013 CAGGGACTAGATCCTCTTCCTGG - Intronic
1059739469 9:117135689-117135711 CAGAGAAAAGAGTGGCTTGCTGG + Intronic
1060697744 9:125723772-125723794 CACGGAGAAGAGCCTATAGCAGG - Intergenic
1062051471 9:134449460-134449482 AAGGAAACAGAGCCCCTTGCAGG - Intergenic
1186740987 X:12517847-12517869 CCTGGAAAAGAGCCCCTTGGGGG - Intronic
1187025005 X:15425825-15425847 CAGGCAAAACAGCCTCTTGTTGG + Intronic
1187944437 X:24412569-24412591 CAGGGCAGAGAGGCTCTTGAAGG - Intergenic
1188349950 X:29116565-29116587 CAGAGAAAAGAGCTGCTTTCAGG + Intronic
1189052799 X:37664119-37664141 CTGGGAAATGAGGCACTTGCTGG + Intronic
1190437139 X:50436816-50436838 CAGTGAAAAGAGCCTTGTACTGG - Intronic
1190438449 X:50451256-50451278 AAGTGAAAAGAGCTTCTTTCAGG + Intronic
1192432854 X:71124455-71124477 CAGGCAAAAGAGGCTCTTAGAGG - Intronic
1197630194 X:128849437-128849459 CAGTGAAAGGAGCTTGTTGCAGG + Intergenic
1201625040 Y:16005597-16005619 CAGTGAAAAGAGCTTATTGGAGG + Intergenic
1201776791 Y:17674333-17674355 CAGGTAAAAGACACTCTTTCTGG - Intergenic
1201824765 Y:18231659-18231681 CAGGTAAAAGACACTCTTTCTGG + Intergenic