ID: 1104516582

View in Genome Browser
Species Human (GRCh38)
Location 12:129432492-129432514
Sequence CTTACTTATACACCCGTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104516582_1104516585 1 Left 1104516582 12:129432492-129432514 CCAAATACGGGTGTATAAGTAAG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1104516585 12:129432516-129432538 CAACTTTTCTTCATTGGCATGGG 0: 1
1: 0
2: 0
3: 16
4: 179
1104516582_1104516583 -5 Left 1104516582 12:129432492-129432514 CCAAATACGGGTGTATAAGTAAG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1104516583 12:129432510-129432532 GTAAGACAACTTTTCTTCATTGG 0: 1
1: 0
2: 1
3: 13
4: 160
1104516582_1104516586 10 Left 1104516582 12:129432492-129432514 CCAAATACGGGTGTATAAGTAAG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1104516586 12:129432525-129432547 TTCATTGGCATGGGCCATAAAGG 0: 1
1: 0
2: 1
3: 3
4: 104
1104516582_1104516584 0 Left 1104516582 12:129432492-129432514 CCAAATACGGGTGTATAAGTAAG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1104516584 12:129432515-129432537 ACAACTTTTCTTCATTGGCATGG 0: 1
1: 0
2: 0
3: 19
4: 225
1104516582_1104516587 21 Left 1104516582 12:129432492-129432514 CCAAATACGGGTGTATAAGTAAG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1104516587 12:129432536-129432558 GGGCCATAAAGGAATGAGAGTGG 0: 1
1: 0
2: 0
3: 14
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104516582 Original CRISPR CTTACTTATACACCCGTATT TGG (reversed) Intronic