ID: 1104522254

View in Genome Browser
Species Human (GRCh38)
Location 12:129486597-129486619
Sequence TCCCCACTCATTGTGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104522253_1104522254 -5 Left 1104522253 12:129486579-129486601 CCTGAAATCTCGGCTCTGTCCCC 0: 1
1: 0
2: 1
3: 17
4: 159
Right 1104522254 12:129486597-129486619 TCCCCACTCATTGTGTGTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104522254 Original CRISPR TCCCCACTCATTGTGTGTCC AGG Intronic
903790826 1:25891809-25891831 TTCCCCCTCATTGTGTGTGTTGG - Intronic
904177976 1:28644767-28644789 TCCAAACTCATTGTCTTTCCCGG - Intergenic
908007190 1:59739031-59739053 TCCCCACTCCATGTCTGTTCTGG - Intronic
908639489 1:66206049-66206071 TCGCCACTCCATGAGTGTCCTGG - Intronic
909554688 1:76940606-76940628 TTACCACTCACTGTGTGGCCTGG - Intronic
912801520 1:112722694-112722716 TCCCCACGCATTGTAAGCCCTGG + Intronic
912905935 1:113707277-113707299 GCCTCACTAATTTTGTGTCCTGG - Intronic
913152659 1:116060657-116060679 TCCCAACTCATTCTGTTTCCTGG + Intronic
914423818 1:147555693-147555715 TTCCCAATCATTTTTTGTCCCGG + Intronic
915091423 1:153428957-153428979 ACCCCACTCCATGTGTCTCCTGG + Intergenic
915908156 1:159894783-159894805 TCCCTAGTCATTGTCAGTCCAGG - Intronic
916175366 1:162033599-162033621 TCCCCACTCTCTGGGTTTCCAGG - Intergenic
919830813 1:201539118-201539140 TCCCTCCTCATTGTGGGGCCGGG + Intergenic
1062812839 10:478571-478593 TTCCCACTCATCCCGTGTCCGGG + Intronic
1062812871 10:478755-478777 TTCTCACTCATCGCGTGTCCAGG + Intronic
1062812877 10:478807-478829 TTCTCACTCATCGCGTGTCCGGG + Intronic
1063247388 10:4236107-4236129 TCCCCATTCATTGTGAGTGAAGG - Intergenic
1070733997 10:78851199-78851221 ACCCCACCCATTGTGTGTCCAGG - Intergenic
1071291204 10:84190582-84190604 TGCCCACTCATTCTGACTCCTGG - Intergenic
1072019538 10:91384299-91384321 TGCCCACGCACTGTGTGTGCTGG - Intergenic
1073100754 10:101005390-101005412 TCCCCACTCAGTGTCTGCTCTGG - Intronic
1075818522 10:125285147-125285169 TAGTCAGTCATTGTGTGTCCAGG + Intergenic
1076342638 10:129760072-129760094 GCCCCACCCATGCTGTGTCCCGG - Intronic
1084282693 11:68108932-68108954 TCCCCAGTAATTGGGTCTCCTGG - Intronic
1085220444 11:74869896-74869918 ACCTCACTCTTTGTGTGCCCAGG + Intronic
1087667715 11:101070205-101070227 TCCCCACTCTTTGTACTTCCCGG - Intronic
1088024460 11:105161060-105161082 TCCTCACTCATTTTCTCTCCCGG - Intergenic
1090213367 11:124938756-124938778 TCCCCACTCAAAGTGAGCCCCGG - Intergenic
1094063184 12:26336222-26336244 TCCCCACTCATTCTCAGTCCTGG + Intergenic
1096426868 12:51511364-51511386 TCCACACTCATTTTGATTCCAGG - Exonic
1097898873 12:64853750-64853772 TCCCAACCCCTTGTGTTTCCTGG + Intronic
1100353587 12:93808073-93808095 CCCCCATTCAGTGGGTGTCCTGG + Intronic
1100393753 12:94166666-94166688 TTCTCACTCACTGTGTGACCTGG - Intronic
1104522254 12:129486597-129486619 TCCCCACTCATTGTGTGTCCAGG + Intronic
1104954103 12:132455327-132455349 TCCCCAGTCGGTGTCTGTCCAGG - Intergenic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106622141 13:31380946-31380968 TCTCCAGTCATAGTGTTTCCTGG - Intergenic
1113006600 13:105710863-105710885 TCCCAACACATTTTGTGGCCTGG - Intergenic
1114613060 14:24054612-24054634 TCCCCACTCCTGGTTTTTCCTGG + Intronic
1116486435 14:45454548-45454570 TCCCCACTCCTTTTGGGCCCTGG + Intergenic
1119153763 14:72389438-72389460 TTCTCACCCAGTGTGTGTCCTGG - Intronic
1119549045 14:75494765-75494787 TGTCCTCTCATTGTGTGTCATGG + Intergenic
1123133393 14:106006455-106006477 TCCACACTCACAGTGAGTCCAGG + Intergenic
1123135787 14:106026511-106026533 TCCACACTCATAGTGAGTCCAGG + Intergenic
1124232471 15:27957141-27957163 GCCCCACTCAATTTGTTTCCTGG - Intronic
1125422583 15:39519457-39519479 TCCCCACTCAATTTGTTTCCAGG - Intergenic
1126697061 15:51335262-51335284 TGCCCACTCATTGTTTGACGTGG - Intronic
1128006063 15:64242718-64242740 TCCAAACTCATTCTGAGTCCAGG + Intronic
1128157443 15:65400816-65400838 ACCCCACCCCTTTTGTGTCCTGG - Exonic
1128282929 15:66411833-66411855 TTCCCACCCATTCTCTGTCCAGG + Intronic
1129109739 15:73330388-73330410 TCCCCACGCCTTGTGTGTTCCGG - Intronic
1130040249 15:80400412-80400434 TGCCCACGGATTGTCTGTCCAGG - Intronic
1134815711 16:17204054-17204076 TCCTCACTCACTGTGTGACCTGG - Intronic
1135390296 16:22087393-22087415 TCCCCATTCATTATCTGTCAGGG + Intronic
1135975045 16:27103203-27103225 TGCTCATTCATTCTGTGTCCGGG - Intergenic
1136448662 16:30339812-30339834 TCCCCACTCTGGGTGGGTCCAGG + Intergenic
1137272936 16:46914721-46914743 TCCCCGCTCATCGTCTGCCCTGG - Intronic
1140899039 16:79351382-79351404 TCCCACCTCCTTGTGTGTTCAGG + Intergenic
1141272424 16:82553484-82553506 TCTCTATTCATTGTGGGTCCAGG + Intergenic
1141700029 16:85638171-85638193 TCTCCTCTCATTGTGTCTCAAGG + Intronic
1141923738 16:87153516-87153538 TCCCCACTCAACCTGTGTCCTGG - Intronic
1145038978 17:19562590-19562612 TCCCCACTCATTCTGAGTGAGGG - Intronic
1145803234 17:27705192-27705214 TTCCCACACATTGTGTGTGGGGG - Intergenic
1146561118 17:33871473-33871495 TCTCCACTCATTGTCCATCCTGG - Intronic
1148747515 17:49927012-49927034 GCCCCACACATTGCCTGTCCCGG + Intergenic
1152037624 17:77883186-77883208 TCCCCACACATTTCATGTCCAGG - Intergenic
1152921012 17:83066701-83066723 TGCACACTCACTGTGCGTCCTGG + Intergenic
1152921058 17:83066871-83066893 TGCACACTCACTGTGCGTCCTGG + Intergenic
1154172704 18:12062897-12062919 TCCTCACTCACTGGGTGTCCTGG + Intergenic
1155626715 18:27843444-27843466 TGTCCACTCATTGTGAGTCTTGG - Intergenic
1157915379 18:51659116-51659138 TCCCTACTCAGGGTGTGTCCAGG - Intergenic
1157997832 18:52580666-52580688 TCCCAACTCAGTGTTGGTCCAGG - Intronic
1160235135 18:77079425-77079447 TCCCTAAACATTGTATGTCCTGG - Intronic
1160490485 18:79333630-79333652 TCTCCCCTCACTGTGTGTCATGG + Intronic
1160548334 18:79677171-79677193 TCCACACTCACTGTGTGAACAGG - Intergenic
1160746021 19:710867-710889 TCCCCACCCATTGTCAGCCCGGG - Intronic
1162195226 19:8979524-8979546 TCTCCACCCACTGTGTGTGCTGG + Exonic
1166219335 19:41354643-41354665 TCCCCCATCACTGGGTGTCCGGG + Exonic
1167986814 19:53325297-53325319 TCCCCAGTCATTCTGGCTCCAGG - Intergenic
1202671378 1_KI270709v1_random:56784-56806 TCTGCACGCATCGTGTGTCCGGG - Intergenic
925342380 2:3146442-3146464 ACCCCTCTCACTGTGTGGCCTGG + Intergenic
926055377 2:9771230-9771252 CCCTCACTCGCTGTGTGTCCTGG + Intergenic
934525675 2:95050102-95050124 TCACCAGTCATTGTGGGACCTGG + Intronic
934610992 2:95736189-95736211 TCCCCACCCATTCTGTTGCCTGG + Intergenic
936995442 2:118409465-118409487 CCCCCACCCCTTGTGTTTCCTGG - Intergenic
940854195 2:158717079-158717101 TTCCCTCTCACTGTGTCTCCTGG - Intergenic
945427906 2:209730051-209730073 TCCCCACTTCTTATTTGTCCAGG - Intronic
945908156 2:215617201-215617223 TCCCAAGTCCTTGTTTGTCCTGG - Intergenic
946758004 2:222965809-222965831 TCCCCATCCATTGTGGGTCAAGG + Intergenic
946961362 2:224989029-224989051 TCCACACTCACAGAGTGTCCTGG - Intronic
948050612 2:234976815-234976837 TCCCCAGACATTGTGTGTTTTGG - Intronic
948485607 2:238279021-238279043 CCCCCCCTCAGTTTGTGTCCAGG - Intronic
1168860419 20:1042458-1042480 TGCTCACTCACTGTGTGACCAGG + Intergenic
1169347095 20:4837167-4837189 TCCCTCCCCTTTGTGTGTCCAGG - Intergenic
1173773584 20:45684567-45684589 GCCCCACTCATCTTGTGTCCTGG - Intergenic
1180612166 22:17105152-17105174 TCCTCACTCATTGTGAGTCACGG + Intronic
1181673062 22:24434879-24434901 TACCAACTCGTTGTGTGGCCCGG - Intronic
1182943593 22:34301287-34301309 TTCCAACTGATTGTGGGTCCTGG - Intergenic
1183697476 22:39431369-39431391 GCCCCACTGATTGTGTGGCTTGG - Exonic
1184611193 22:45604666-45604688 TCCCGTCTCATTCTATGTCCAGG - Intergenic
1185041937 22:48508550-48508572 TCCCCACTCAGGCTGTCTCCAGG - Intronic
952284293 3:31953362-31953384 TGCCCACTCTTTGTGTGTGTGGG - Intronic
953010581 3:39021693-39021715 TGCCCACCCATTTTGTGTTCTGG - Intergenic
954334592 3:49908966-49908988 TTCCCACACCTAGTGTGTCCAGG + Exonic
960040052 3:113141544-113141566 TCCACACTCTTTATGTGTGCTGG + Intergenic
960912489 3:122663241-122663263 TTCCCAATGTTTGTGTGTCCTGG + Intergenic
962169416 3:133084902-133084924 CACCCACTCACTGCGTGTCCTGG - Intronic
962330531 3:134473896-134473918 TCCCCACTCATGCTTTGTCGGGG - Intergenic
963780516 3:149481653-149481675 TCTCCACACATGGTGTGTCCTGG - Intronic
967194135 3:187012067-187012089 TCCCCACTCACTGTTTGCCCAGG + Intronic
968283333 3:197493439-197493461 TCCCCACTCCTCATGTTTCCTGG - Intergenic
969849193 4:9943215-9943237 TCCCCACTCACTCTGAGCCCTGG - Intronic
971040594 4:22747708-22747730 TCCCAACTCAGTGTCTGACCAGG + Intergenic
975712296 4:77172969-77172991 TGGCCACTCATTGTTTGACCTGG + Intronic
979773852 4:124562896-124562918 TCCTATCTCATTGTGTGACCTGG - Intergenic
982345351 4:154351833-154351855 TCACCTCCCATTGTGTGGCCTGG + Intronic
983741973 4:171146490-171146512 TTCCCTCTCATTGGGTGTCTGGG - Intergenic
987233831 5:15923135-15923157 TCCTCTCTGAGTGTGTGTCCTGG + Intronic
994074105 5:95631911-95631933 TACTCTCTCACTGTGTGTCCTGG - Intergenic
1001210544 5:169806774-169806796 TCCCCACACCTTGTGTGACTGGG - Intronic
1001280201 5:170381324-170381346 TTCCCTCCCATTGTCTGTCCTGG - Intronic
1001543303 5:172554191-172554213 TACCAACTCACTGTGTGCCCTGG + Intergenic
1001812259 5:174637907-174637929 TCCCCACTCATTCTGCCTCCTGG + Intergenic
1003517104 6:6826563-6826585 TCCACAGTCACTGTGTGTGCCGG - Intergenic
1004348005 6:14866240-14866262 TCCCCAGTCACTGGGAGTCCTGG - Intergenic
1006044853 6:31286562-31286584 GGCCTGCTCATTGTGTGTCCTGG - Intronic
1006294891 6:33165920-33165942 TCCTCACTCACCGGGTGTCCTGG + Exonic
1007240645 6:40422557-40422579 TCCCCACTCCTGGTCTGACCTGG + Intronic
1007564907 6:42842532-42842554 GCCAGACTCATTGTGTGTTCAGG + Intronic
1009052169 6:58289399-58289421 TCCTCACTCATTGCTTCTCCTGG - Intergenic
1010821863 6:80423507-80423529 TCCCCACCCATTGTGTAACTTGG + Intergenic
1011021828 6:82822445-82822467 TCTCTACTCACTGTGTTTCCTGG - Intergenic
1014181571 6:118390032-118390054 TCCTCATTCTTTGTGTTTCCAGG - Intergenic
1014286531 6:119505025-119505047 TGGCAACTCATTGTGTGGCCCGG + Intergenic
1017890119 6:158631023-158631045 TCCCCACTCCTTGTGTCAACAGG + Intronic
1019903170 7:4040481-4040503 ACCTCACTCCTTGTGTGTCCGGG - Intronic
1021972678 7:25981077-25981099 ACCCCACACTCTGTGTGTCCTGG - Intergenic
1023703392 7:42914208-42914230 TCCCAACACTTTGTGAGTCCAGG + Intronic
1026136220 7:67663623-67663645 TGCCCACAGATTGTGTGTGCAGG + Intergenic
1030178447 7:106679067-106679089 TCCCTACAAATTGTGTGCCCAGG - Intergenic
1030207281 7:106963262-106963284 TCCCCACTCTTTTAGTGTCTAGG - Intergenic
1032736533 7:134697498-134697520 ACCTCACTCACTGTGTGCCCTGG - Intergenic
1033155176 7:138950754-138950776 TCCCACCTCATTGTGGCTCCAGG + Intronic
1034415680 7:150963210-150963232 TCCGCCCTCCTTGTCTGTCCTGG - Intronic
1034896039 7:154876995-154877017 TCCACCCTCCTTGTGTGCCCGGG - Intronic
1035360843 7:158313418-158313440 TCCCCAGGGACTGTGTGTCCTGG - Intronic
1036222088 8:6929573-6929595 TCCACACTCACTGTGTCTGCTGG - Intergenic
1036720025 8:11165484-11165506 TGCCCTCACCTTGTGTGTCCAGG - Intronic
1047357642 8:124138887-124138909 TCCACACTCACTGTGTGCTCCGG + Intergenic
1048411249 8:134175836-134175858 TCCACACTCACTGTCTGTTCTGG + Intergenic
1048953135 8:139512613-139512635 TCCCCAGCAATGGTGTGTCCTGG + Intergenic
1049768721 8:144368895-144368917 TCCCCATTCTTTGTGGGTGCAGG - Intergenic
1049845836 8:144800627-144800649 CCCCCACTCACTGTCTGTCCAGG - Intronic
1049878057 8:145040005-145040027 TCACCACTCACTGGGTGACCAGG - Intergenic
1053043161 9:34891724-34891746 TCCCCAATCAAAGAGTGTCCTGG + Intergenic
1057311198 9:93944326-93944348 ATCCCACTCATTGCATGTCCAGG + Intergenic
1057802856 9:98200496-98200518 TCCCCACACATTGTGCCTCCAGG - Intronic
1058620023 9:106873011-106873033 TCCCCACTCCATGTGAATCCTGG - Intronic
1058922373 9:109629187-109629209 TACCCACACATTCTGAGTCCTGG + Intergenic
1185620763 X:1451344-1451366 TCCCCATTCCTTGGGGGTCCCGG + Intronic
1185782317 X:2860054-2860076 CCCCCACTTACTGTGTGACCAGG - Exonic
1187856180 X:23637600-23637622 TTCCCAATCATTGTGTGGCGTGG - Intergenic
1189731197 X:44022842-44022864 TCCTCACTCATTCTGTGACCTGG - Intergenic
1197714764 X:129698754-129698776 TCCCTACACATTGTGTGGGCAGG + Intergenic