ID: 1104522467

View in Genome Browser
Species Human (GRCh38)
Location 12:129488046-129488068
Sequence GAGGACACCATGTCCTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104522467_1104522470 3 Left 1104522467 12:129488046-129488068 CCTTGTGAGGACATGGTGTCCTC 0: 1
1: 0
2: 4
3: 32
4: 242
Right 1104522470 12:129488072-129488094 ACAGCACCCAGGTGCCATCTTGG 0: 1
1: 0
2: 22
3: 147
4: 412
1104522467_1104522468 -8 Left 1104522467 12:129488046-129488068 CCTTGTGAGGACATGGTGTCCTC 0: 1
1: 0
2: 4
3: 32
4: 242
Right 1104522468 12:129488061-129488083 GTGTCCTCAGCACAGCACCCAGG 0: 1
1: 0
2: 3
3: 46
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104522467 Original CRISPR GAGGACACCATGTCCTCACA AGG (reversed) Intronic
901395205 1:8976074-8976096 GATGATAACATGACCTCACAGGG + Intergenic
902275804 1:15338465-15338487 GTGGACCCAATGTCATCACATGG - Intronic
902280329 1:15369726-15369748 GAGGCCTCCACGTTCTCACATGG + Intronic
904070179 1:27789669-27789691 AAGGACACTGTGTCCTCAAATGG - Intronic
905953366 1:41971907-41971929 AGGAACACCGTGTCCTCACATGG - Intronic
907642672 1:56206861-56206883 GACTACATCATGTACTCACAAGG + Intergenic
908347112 1:63245372-63245394 GTGAACACTGTGTCCTCACATGG + Intergenic
908714681 1:67056426-67056448 AAGAACACCATGTCCTCACATGG + Intergenic
909258434 1:73454719-73454741 CAGGACACCTTGTGTTCACAAGG + Intergenic
909266859 1:73570788-73570810 CAGTACACCATTTCCTCCCAGGG + Intergenic
909458456 1:75878362-75878384 AAGGACAGCATGTCCTGAAAAGG - Intronic
910591425 1:88931026-88931048 GAGGAAACTATGTCCTCATGAGG - Intergenic
910804874 1:91180267-91180289 GAGGAAACTATGTCCTCATGAGG - Intergenic
911724148 1:101224003-101224025 GAGAACACTGTGTCCTCACATGG - Intergenic
911844177 1:102728416-102728438 GAGAACACTGTGTCTTCACATGG - Intergenic
913230186 1:116735113-116735135 GAGGACGCTATGGCCTCCCAAGG + Intergenic
913447960 1:118970067-118970089 GAAGCCAGCATGTCTTCACATGG - Intronic
915647511 1:157284292-157284314 AGGAACACCGTGTCCTCACATGG + Intergenic
915647522 1:157284353-157284375 GGGAACACTGTGTCCTCACATGG + Intergenic
915647546 1:157284505-157284527 GGGAACACCATGTCCTCATATGG + Intergenic
915663083 1:157419862-157419884 GGGAACACCATGTCCTCAGATGG - Intergenic
915663112 1:157420044-157420066 AAAAACACCTTGTCCTCACATGG - Intergenic
915663127 1:157420135-157420157 AGGAACACCATGTCCTCATATGG - Intergenic
915663133 1:157420166-157420188 GGCGATACCATGTCCTCACATGG - Intergenic
918874313 1:190019861-190019883 CAGGACGTCATTTCCTCACAGGG + Intergenic
918961135 1:191279675-191279697 AAGGACACTGTGTTCTCACATGG + Intergenic
919565466 1:199179912-199179934 GCAGATCCCATGTCCTCACATGG - Intergenic
920440450 1:205977206-205977228 GTGGACAAGATGTCCTCTCAGGG - Exonic
921312129 1:213855009-213855031 TTTCACACCATGTCCTCACATGG + Intergenic
921601347 1:217109908-217109930 GAGCACACCATATCCTTAAAGGG + Intronic
922027412 1:221763697-221763719 GTGAACACTGTGTCCTCACATGG + Intergenic
922684304 1:227627307-227627329 GAGGAAACTATGTCCTCATGAGG + Intronic
923220952 1:231892449-231892471 GAGGACACCAAGGCACCACAGGG - Intronic
923556815 1:235007562-235007584 AAAGACACCATGTCCTCTCTTGG - Intergenic
923621326 1:235581860-235581882 GAAGACACCCGGTCCTCACAGGG + Intronic
1062869691 10:889343-889365 GAGGACACCATCCCATCACAGGG + Intronic
1063361758 10:5465152-5465174 GTGGACACTTTGTCCTCACATGG - Intergenic
1063451798 10:6154937-6154959 GAGGTCACCATGACCTCCTACGG - Intronic
1066507797 10:36063560-36063582 GAGGACAACGTGTACTCCCAAGG - Intergenic
1071255503 10:83868434-83868456 GAGGTCTCCTTGTCCTCGCAAGG + Intergenic
1071875295 10:89837611-89837633 GAGGACACTCCGACCTCACATGG - Intergenic
1071919057 10:90329041-90329063 GAGAACACAATGTCACCACAGGG + Intergenic
1072313614 10:94180823-94180845 GGGGACACTGTGTCCTCACATGG - Intronic
1074413621 10:113248356-113248378 GAGGACACCAAGACCTGAGAAGG + Intergenic
1074498456 10:114000771-114000793 GTGGACCCCATGTAATCACAAGG - Intergenic
1076572798 10:131443702-131443724 GACCACACCATGTCCTGCCATGG + Intergenic
1077222643 11:1424382-1424404 CAGGACACCTTGTCCCCACCTGG - Intronic
1077931112 11:6734052-6734074 AGGAACAACATGTCCTCACATGG - Intergenic
1077932333 11:6746636-6746658 GGGACCACCATGTCCTTACATGG + Intergenic
1081240182 11:40695802-40695824 GAGGAGACAATGACCTCACTGGG + Intronic
1081337086 11:41880082-41880104 GTGAACACTATGTCCTCACATGG - Intergenic
1083277785 11:61606951-61606973 GAGGTCACCACTTCCTCTCATGG - Intergenic
1084906957 11:72355887-72355909 GAGGCCAGCCTGTGCTCACAGGG - Intronic
1087102716 11:94380756-94380778 GAGCGCACAATGTCCTCACTGGG + Exonic
1087309955 11:96529806-96529828 GAGGCCACCATGTCCGGCCAGGG - Intergenic
1094390820 12:29948663-29948685 GAGAATACTGTGTCCTCACATGG + Intergenic
1095139127 12:38640675-38640697 GAGGAAACTATGTCCTCATGAGG - Intergenic
1095152577 12:38812773-38812795 GGGCACACTCTGTCCTCACATGG - Intronic
1095927430 12:47592867-47592889 GAAGACACCAGTTTCTCACAGGG - Intergenic
1096210369 12:49760742-49760764 TTCGACACCATGTCCTCACGGGG - Intronic
1096335191 12:50749886-50749908 ACGAACACCATGTCCTCGCATGG - Intergenic
1096351693 12:50906074-50906096 GAGGAAACTATGTCCTCATGAGG + Intergenic
1097691330 12:62737250-62737272 GAGCACACCATGTCTTCAATTGG + Intronic
1098205581 12:68105915-68105937 GTGGGCCCAATGTCCTCACAAGG + Intergenic
1098273885 12:68794489-68794511 GAGGTCAGGATGTCCTCACTGGG - Intergenic
1099605420 12:84796667-84796689 GAGGAAACTATGTCCTCATGAGG - Intergenic
1099963877 12:89424108-89424130 GATGACTCCAAGTTCTCACATGG + Intronic
1102437390 12:112935964-112935986 AGGAACACTATGTCCTCACATGG + Intergenic
1102550940 12:113691789-113691811 CCTCACACCATGTCCTCACAGGG - Intergenic
1102891008 12:116558546-116558568 GATGACACGAGGTCGTCACAAGG - Intergenic
1104091740 12:125523445-125523467 GTGGGCCCCATGTCATCACAAGG - Intronic
1104522467 12:129488046-129488068 GAGGACACCATGTCCTCACAAGG - Intronic
1104983103 12:132582692-132582714 GAGGCCCCCCTGTCCTAACAGGG + Intronic
1107137100 13:36956976-36956998 GAGGAAACTATGTCCTCATGAGG - Intronic
1108801245 13:54098197-54098219 AAGGTCACCAAGTCCTCACATGG + Intergenic
1109908145 13:68872978-68873000 GAGGACACAATATAATCACAGGG - Intergenic
1111843064 13:93473637-93473659 GGGGACTTCAGGTCCTCACAGGG + Intronic
1113544466 13:111137405-111137427 GAGGCCACGGTGTCCTCACCTGG + Intronic
1114621957 14:24101409-24101431 GAAGGCACCATGTCCACTCAGGG + Intronic
1115405536 14:33011354-33011376 GAGGACATCATCCCATCACAGGG + Intronic
1115509307 14:34124151-34124173 GAGGACAGCTTTTCCTCACTGGG + Intronic
1115515687 14:34182746-34182768 GAGAAGACCATGTTGTCACATGG + Intronic
1116447076 14:45022630-45022652 GAGGAAACTATGTCCTCATGAGG + Intronic
1117508661 14:56427155-56427177 GGGGACACCTTGTACTGACAGGG + Intergenic
1117865517 14:60144484-60144506 GAGGAATGTATGTCCTCACATGG - Exonic
1119120679 14:72073545-72073567 CAGGACACCATCCCATCACAGGG + Intronic
1119353328 14:73984308-73984330 GAGGAAACCAAGTCCCAACAAGG - Intronic
1120257599 14:82140212-82140234 GAAGAAAGCATGTCTTCACATGG - Intergenic
1120535253 14:85687212-85687234 AGGAACACCTTGTCCTCACATGG + Intergenic
1120697952 14:87665369-87665391 GTGGACACAATGTAATCACAAGG + Intergenic
1121507232 14:94486419-94486441 GAGGGCACCAGGTGCTCGCAGGG - Intergenic
1122459022 14:101879885-101879907 CAGGCCGCCATGTCCTCCCAGGG - Intronic
1123947851 15:25247577-25247599 CCGGACACCATGCCCACACAGGG - Intergenic
1126180278 15:45778620-45778642 GAGGACCCCTTGTCTTCAGAAGG + Intergenic
1129497514 15:75999453-75999475 CCGAACACTATGTCCTCACATGG - Intronic
1129592236 15:76927045-76927067 AAGAACACTATGTCCTCACGTGG - Intergenic
1129801002 15:78414184-78414206 CAGGACACCATCTCATCGCAGGG + Intergenic
1130960282 15:88654463-88654485 GAGGACTTCCTGTTCTCACAGGG - Intronic
1131330164 15:91490696-91490718 GACAACACTGTGTCCTCACATGG - Intergenic
1131622190 15:94080109-94080131 CAGGACACCATCCCATCACAGGG + Intergenic
1132246571 15:100300712-100300734 GAGGGCACCACATCATCACATGG + Intronic
1132480014 16:162740-162762 TAGGTCACCCTGTCATCACAGGG + Intronic
1135068675 16:19333339-19333361 GAGGAACCCAGGTCCTCCCATGG - Intergenic
1136414376 16:30094896-30094918 GACTACCCCATGTCCCCACAGGG - Exonic
1136909055 16:34131829-34131851 GACGGCCCCATGTCCTCAAAAGG + Intergenic
1137247191 16:46715491-46715513 TAGGAGACCGTATCCTCACAGGG + Intronic
1138878156 16:60978436-60978458 GAATATACCTTGTCCTCACAAGG + Intergenic
1139597332 16:67966123-67966145 GAGGAAACCAAGGCCGCACAGGG - Intronic
1139950164 16:70664597-70664619 GAGGACACCATCCCCTCCCAAGG - Exonic
1140882962 16:79215519-79215541 GAGGCCAGCATGTCCTCTCTTGG - Intergenic
1146137518 17:30335963-30335985 GAGTACACTTTGCCCTCACAGGG - Intergenic
1146673602 17:34758235-34758257 GAGAACACCACCTCCTCCCAGGG - Intergenic
1148783786 17:50135451-50135473 GGGGATGCCATGTCCTCACCGGG - Intronic
1149937713 17:60825688-60825710 TTGAACTCCATGTCCTCACATGG + Intronic
1151068085 17:71175094-71175116 GAGGATATCAGGTCCTTACAAGG + Intergenic
1153517619 18:5918806-5918828 AAGGACTCAATGTCATCACAAGG + Intergenic
1154053559 18:10988179-10988201 ATGGACACTGTGTCCTCACATGG - Intronic
1154209434 18:12366780-12366802 GAGGACACCAGGTCAAAACACGG + Intronic
1154938656 18:21088783-21088805 GGGGTCAGTATGTCCTCACATGG - Intronic
1155561262 18:27079900-27079922 GTGGACTCCATGTCATCACAAGG - Intronic
1156066286 18:33147285-33147307 GAGAACACCATGTCCTCGGGTGG + Intronic
1156547538 18:37979720-37979742 CAGCACACAATGTGCTCACATGG - Intergenic
1160572355 18:79827035-79827057 GGGGACGCCACGTCCTCACAAGG - Intergenic
1160854801 19:1211952-1211974 GAGGACACCCAGGCCTCACATGG - Intronic
1161340600 19:3739874-3739896 GGGGACCCGATGTCCTCACAGGG - Intronic
1161810805 19:6470218-6470240 GAGGACACTTTGACCTCCCAAGG - Intronic
1162118945 19:8449891-8449913 GGGGTCACCATGTCGTCACTAGG - Intronic
1165501181 19:36190655-36190677 GTGGACACAATGTATTCACAAGG + Intronic
1167490521 19:49790339-49790361 GTGGACCCAATGTCATCACAGGG - Intronic
925473581 2:4188748-4188770 GATCAGGCCATGTCCTCACATGG - Intergenic
925831794 2:7903413-7903435 GAGTCCTCCATCTCCTCACAGGG + Intergenic
930394023 2:50796978-50797000 GAGGACACTGTGTCCTCACATGG + Intronic
930757824 2:54995683-54995705 CAGGACACCATTCCATCACAGGG + Intronic
935478677 2:103557944-103557966 GAGAACACTGTGTCCTCACATGG + Intergenic
936387063 2:112040198-112040220 GAGGAAACTATGTCCTCATGAGG + Intergenic
936412068 2:112268824-112268846 AAGAGCACCATGTCTTCACATGG + Intergenic
937594499 2:123657626-123657648 ATGAACACCATGTGCTCACATGG + Intergenic
937997092 2:127702169-127702191 GAGGGCGCGAGGTCCTCACACGG - Exonic
938259541 2:129885261-129885283 CAAGACTCCATGACCTCACAAGG + Intergenic
939336307 2:140833074-140833096 AAGGACACTATTTCATCACAGGG - Intronic
940121085 2:150266843-150266865 CAGAACACTATGTCCTCAGATGG + Intergenic
941554781 2:166963935-166963957 GAACACACCATGTCTTCACCTGG - Intronic
943281701 2:185943020-185943042 GGGGACACTGTGTCCTCACGTGG + Intergenic
944223580 2:197326655-197326677 GGCGATACCATGTCCTCACATGG - Intergenic
947360456 2:229340600-229340622 GAGGACACCATATGGTCACCAGG + Intergenic
947502640 2:230682712-230682734 GAGTCCACCTTGTCCTCAAAAGG - Intergenic
947502862 2:230683921-230683943 GAGGCCACCTTGTCCCCAAAAGG - Intergenic
947914588 2:233823087-233823109 GACTGGACCATGTCCTCACAAGG - Intronic
947995606 2:234524682-234524704 GAGAACACTGTGTCCTCACATGG - Intergenic
1170407897 20:16058823-16058845 GAGGGCACCATGACATCACAGGG - Intergenic
1171726251 20:28623877-28623899 GGGAACACTGTGTCCTCACATGG + Intergenic
1171904514 20:30890599-30890621 GACGGCCCCATGTCCTCAAAAGG + Intergenic
1173395865 20:42678737-42678759 GGGAAAACCATTTCCTCACATGG - Intronic
1173912697 20:46682050-46682072 GAGGAGCCCATGTTCTTACAAGG - Intronic
1174226888 20:49007848-49007870 GAGGAGACTGAGTCCTCACATGG + Intronic
1175759942 20:61555455-61555477 GATGAGACCCTGTCCTCAGAGGG - Intronic
1177906371 21:26975946-26975968 GAGGACTCCATCTACACACATGG + Intergenic
1178820637 21:35971966-35971988 GAGGCCACCATCTCAGCACATGG - Intronic
1180337936 22:11596736-11596758 GATGGCCCCATGTCCTCAAAAGG + Intergenic
1181036486 22:20172167-20172189 GAGGACAGCATGGCCTGACCGGG + Intergenic
1183524304 22:38314660-38314682 CATGACACCAAGACCTCACACGG + Intronic
949141442 3:638146-638168 TGGGACACTTTGTCCTCACATGG - Intergenic
952921838 3:38290704-38290726 GAGGAAACTATGTCCTCATGAGG + Intronic
953975215 3:47377148-47377170 GGGAACACCTTGTCCCCACATGG - Intergenic
954043461 3:47908513-47908535 GAGGCCACCATTTCCTCATAAGG + Intronic
954426272 3:50444802-50444824 GATGAGCCCATGTCCTCTCATGG + Intronic
954590145 3:51776101-51776123 GGGGACACCATGTCATCTGAGGG + Intergenic
955649244 3:61175706-61175728 AAGTACACCATGTCCTCACATGG - Intronic
956178624 3:66498419-66498441 GAGGACACCCTGCCCTCTCTGGG + Intronic
958425705 3:93976457-93976479 CAGGACACCATTCCATCACAGGG - Intergenic
959403914 3:105937301-105937323 AGGAATACCATGTCCTCACATGG - Intergenic
959686955 3:109157977-109157999 GAGGCAAACATGTCTTCACATGG + Intergenic
960539619 3:118848862-118848884 GAGGAAACTACGTCCTCATAAGG - Intergenic
960567137 3:119145962-119145984 GAGTACGCCATGTCCTGAGAAGG - Intronic
961098092 3:124174965-124174987 GACAACACAAAGTCCTCACATGG - Intronic
962158400 3:132973590-132973612 GAAGACACCATGTTCTCAACTGG - Intergenic
968605609 4:1533800-1533822 GAGGCCACCATCTGCTTACAGGG + Intergenic
969614566 4:8244800-8244822 GAGAGCACCATCTCCACACAAGG + Intergenic
970722746 4:19007103-19007125 AAGGACACTGGGTCCTCACAAGG - Intergenic
971022520 4:22551662-22551684 CAGGACACCATCCCATCACAGGG + Intergenic
972179116 4:36442516-36442538 GAGGAAACTATGTCCTCATGAGG + Intergenic
973551614 4:52040886-52040908 GATGTCACTGTGTCCTCACATGG - Intergenic
974511073 4:62841649-62841671 GAAGACACTGTGTCCTCACATGG + Intergenic
975193272 4:71491575-71491597 CAGGACACTATCTCATCACAGGG - Intronic
976830719 4:89310549-89310571 GTGGACCCCATGTCATTACAGGG - Intergenic
978740868 4:112136411-112136433 ATGAACACTATGTCCTCACATGG + Intergenic
978917512 4:114144905-114144927 CAGGAAAACATGTCTTCACATGG - Intergenic
979616420 4:122747694-122747716 GAGAACACTGTGTCTTCACATGG - Intergenic
979748356 4:124244798-124244820 ATGGACACTGTGTCCTCACATGG - Intergenic
981561503 4:146053330-146053352 GAAGTAGCCATGTCCTCACAAGG - Intergenic
982617503 4:157658853-157658875 TAGAACACCTTGTCCTCACATGG + Intergenic
983132971 4:164044357-164044379 GAAGATATCATGTCCTCACGTGG + Intronic
983378986 4:166967547-166967569 GAGGCAAGCATGTCTTCACATGG - Intronic
984938177 4:184908056-184908078 GAGGACATAATGTCCTCTGAAGG - Intergenic
984955401 4:185040540-185040562 GTGGCCACTCTGTCCTCACAGGG - Intergenic
987605333 5:20127231-20127253 GTAAACACCATGTCCTCACATGG - Intronic
987816328 5:22905679-22905701 AGGAATACCATGTCCTCACATGG + Intergenic
990430286 5:55728167-55728189 AAGAACACTGTGTCCTCACATGG - Intronic
990915544 5:60900426-60900448 GATGCTATCATGTCCTCACAAGG + Intronic
991081321 5:62603570-62603592 CAGGACACCATTTCCTGACAGGG + Intronic
991900651 5:71456305-71456327 GAGGAGACCATGTCTTCAAGTGG + Intronic
992413509 5:76531190-76531212 GAGAACACCATGTCCTCGGGTGG + Intronic
994999312 5:107106812-107106834 ATGAACACTATGTCCTCACATGG - Intergenic
997782975 5:136678373-136678395 GAGGACACCAGTGCCACACAGGG - Intergenic
998799380 5:145853725-145853747 AAGGACATCATGGTCTCACAGGG - Intergenic
998932328 5:147194931-147194953 ATGAACACTATGTCCTCACATGG + Intergenic
999638662 5:153648984-153649006 GGGGACACAATGTAATCACAAGG + Intronic
1000941943 5:167372405-167372427 GTGTACTCCATGTCCTCCCATGG + Intronic
1002157719 5:177295860-177295882 AAGAACACCATTTCCTCCCAAGG - Exonic
1002261562 5:177996827-177996849 CAGGACACCATGACCTTCCAAGG + Intergenic
1002993307 6:2257896-2257918 GGGAACACTGTGTCCTCACATGG - Intergenic
1003257658 6:4488409-4488431 GAGGAGAGCATGGCCCCACATGG + Intergenic
1005894064 6:30163333-30163355 GAGCACACCATGAGGTCACAGGG - Exonic
1006723735 6:36180290-36180312 ATGAACACTATGTCCTCACATGG - Intergenic
1011209906 6:84944437-84944459 GAGGAAACTATGTCCTCATGAGG - Intergenic
1011698641 6:89935201-89935223 GAGGATGCTATGTCCTGACAGGG - Intronic
1013850104 6:114504037-114504059 AAGGACACTGTGTCCTCACATGG + Intergenic
1015256811 6:131186698-131186720 GAGAACACTGTATCCTCACATGG + Intronic
1017632892 6:156415679-156415701 AAGGTCACTGTGTCCTCACATGG + Intergenic
1017768366 6:157625347-157625369 GAGGACAGGATGTCCTCTCCAGG + Intronic
1018680508 6:166260477-166260499 AGGAACGCCATGTCCTCACATGG - Intergenic
1019126926 6:169846677-169846699 GAGCACATCATGTCCTCTCCGGG - Intergenic
1019687259 7:2388703-2388725 CCGGCCACCATGTCCTCACCAGG - Intergenic
1022699357 7:32743597-32743619 AGGAACACCGTGTCCTCACATGG + Intergenic
1022846156 7:34212069-34212091 GAGGACACAATGTAGTCTCAAGG - Intergenic
1026083036 7:67239224-67239246 AATGACTCCATGCCCTCACATGG - Exonic
1026694025 7:72574781-72574803 AATGACTCCATGCCCTCACATGG + Exonic
1028983485 7:96992590-96992612 GAGGTCCCCATGCCCGCACAGGG + Intergenic
1029124235 7:98285992-98286014 GAGGCCACCATGTGCGCAGAGGG + Intronic
1029688881 7:102167363-102167385 GCGGATACCATCTCATCACAGGG - Intronic
1030098580 7:105923746-105923768 GAGGAAACCATGTCTTCTCAGGG - Intronic
1030276307 7:107725328-107725350 GTGGACACCATCTCCTAAAACGG + Intergenic
1030337693 7:108343601-108343623 GAGGAAACTATGTCCTCATGAGG - Intronic
1030490782 7:110231379-110231401 GTGGATACTGTGTCCTCACAGGG - Intergenic
1031088482 7:117325084-117325106 GAGGACACGATGTGCTGAGATGG - Intergenic
1031514394 7:122683932-122683954 GAGGATGCCATCTCATCACAGGG - Intronic
1032371114 7:131353256-131353278 GATGACACCAAATGCTCACAAGG - Intronic
1034278311 7:149834052-149834074 CAGGAGACAAAGTCCTCACATGG - Intergenic
1035186506 7:157130206-157130228 GTGGACCCCATGTCATCCCAGGG + Intergenic
1035863137 8:3052338-3052360 AAAGACACCAAATCCTCACAAGG + Intronic
1036152638 8:6312958-6312980 GTGGGCCCAATGTCCTCACAAGG + Intergenic
1036359405 8:8066428-8066450 CAGGACACCAGGAGCTCACAGGG - Intergenic
1036505335 8:9349692-9349714 GATGAGACCATTTACTCACACGG - Intergenic
1041277436 8:56177416-56177438 GAGGACCCCATGTACTCTCCTGG + Intronic
1044941579 8:97349102-97349124 GAGGGCACCATGACCCCAGAAGG - Intergenic
1045714118 8:105021585-105021607 AAGGAAGCCATGTCTTCACATGG - Intronic
1046268018 8:111857626-111857648 GAAGCCAGCATGTCTTCACATGG - Intergenic
1046340129 8:112843347-112843369 GAAGACACTGTGTCCTCACATGG - Intronic
1046845206 8:118907666-118907688 GTGGACCCCATGTAATCACATGG + Intergenic
1047151135 8:122264460-122264482 CAGGACACCATGCCCTCACAGGG + Intergenic
1047195847 8:122720845-122720867 CAGGGCACCATTCCCTCACAGGG + Intergenic
1047401962 8:124555741-124555763 GAGGACACCATCCCTTCCCAAGG - Exonic
1049384143 8:142332598-142332620 GAGGACAGCAAGTCCTCATGAGG + Intronic
1050225982 9:3456037-3456059 GAGGAAACTGTGTCCTCACATGG + Intronic
1050389179 9:5120171-5120193 AGGAACACCATGTCCTCACATGG + Intronic
1050670274 9:7989073-7989095 GAAGACAGCATGTTTTCACATGG + Intergenic
1051257446 9:15229298-15229320 GAAGACTGCATGTCCTCTCAAGG + Intronic
1053185831 9:36015654-36015676 TTGAACACTATGTCCTCACATGG + Intergenic
1053459653 9:38258439-38258461 GGGAGCACTATGTCCTCACATGG + Intergenic
1053723365 9:40971986-40972008 GGGAACACTGTGTCCTCACATGG - Intergenic
1055034804 9:71807008-71807030 GAGGGCACCATGTGCATACAGGG + Intronic
1056665441 9:88577571-88577593 GTGGACACTGTGTCCTCACATGG + Intronic
1056775829 9:89511992-89512014 GAGGAACGCTTGTCCTCACATGG - Intergenic
1056815288 9:89796679-89796701 GAGGAGGCCAAGTGCTCACAGGG + Intergenic
1057346990 9:94259790-94259812 GAGGATATCATGTCCTCCAAAGG - Intronic
1057791293 9:98126841-98126863 GTGGGCACCCCGTCCTCACATGG - Intronic
1058066001 9:100548857-100548879 GAGGACACCATTTACTGACAGGG + Intronic
1058083019 9:100719005-100719027 GAGGACACCATGTAGTATCATGG + Intergenic
1186441615 X:9591794-9591816 GAGGACAGCATGAACTCATAGGG + Intronic
1187662077 X:21559673-21559695 GAAGTAAACATGTCCTCACATGG - Intronic
1188753224 X:33929033-33929055 GTGGACACTATATCCTCATATGG - Intergenic
1189367884 X:40403139-40403161 GAGGACACCCTGGCCTTGCATGG - Intergenic
1190074412 X:47305674-47305696 GGGAACACTGTGTCCTCACATGG - Intergenic
1190714319 X:53091126-53091148 AAGAACATCCTGTCCTCACATGG - Intergenic
1194262082 X:91708487-91708509 GAGAACGCTGTGTCCTCACATGG + Intergenic
1194909945 X:99629964-99629986 GAAGCAACCATGTCTTCACATGG + Intergenic
1196760228 X:119194136-119194158 GAGGCCACCATGGCCTCTCCTGG - Intergenic
1197804993 X:130390099-130390121 GTGGACCCAATGTCATCACAAGG - Intergenic
1200580729 Y:4947274-4947296 GAGAACACTGTGTCCTCACATGG + Intergenic