ID: 1104523116

View in Genome Browser
Species Human (GRCh38)
Location 12:129493965-129493987
Sequence CCTTAGGTATAATGTCAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104523116 Original CRISPR CCTTAGGTATAATGTCAAAT GGG Intronic
903643542 1:24876494-24876516 CCTTAGATATAATCTCAGAAGGG + Intergenic
908674314 1:66585344-66585366 CCTTAAGTTTAATGTCTATTAGG + Intronic
911295813 1:96113586-96113608 CCTAATGTATAAGGGCAAATTGG - Intergenic
917044219 1:170838810-170838832 GCATTGGTATAAGGTCAAATAGG - Intergenic
917405384 1:174700689-174700711 CCATAAGTACAATGACAAATGGG + Intronic
917555124 1:176077619-176077641 CCTTCAGTATAATGTTGAATAGG - Intronic
918899330 1:190392223-190392245 CCTTATAAATAATGTCAAACTGG + Intronic
922634573 1:227154342-227154364 CCTTCAGTACAATGTTAAATAGG - Intronic
923880716 1:238101315-238101337 CCATAGGTATATTCTCTAATCGG - Intergenic
1065253509 10:23841018-23841040 CCTTGGGTATAATGTTGGATTGG + Intronic
1066142396 10:32519209-32519231 CTTTAGGTATCATGCCAAATAGG + Intronic
1066652632 10:37672592-37672614 ACTTAGGTTTAATGAAAAATTGG + Intergenic
1067671522 10:48327093-48327115 CTTTAGGTATGATGTTGAATAGG + Intronic
1068286115 10:54937867-54937889 CTTTGAGTACAATGTCAAATGGG + Intronic
1069504735 10:68987747-68987769 CCTAAGTTATCAAGTCAAATGGG - Intergenic
1070420041 10:76227631-76227653 CCTTGGGGATAATATCAAAGGGG - Intronic
1070526374 10:77299303-77299325 CCTTAGGGAGAATTTCAGATGGG - Intronic
1070945297 10:80386201-80386223 CTTTCAGTATAATGTCGAATAGG + Intergenic
1074411105 10:113229421-113229443 CCTTAGGGATAAAGTTGAATGGG + Intergenic
1078969237 11:16387965-16387987 CCTTAAATACAATGTCAAGTAGG + Intronic
1080593867 11:33750447-33750469 TCTTACATATCATGTCAAATGGG + Intronic
1080653622 11:34241772-34241794 CTTTAGATAGAATGTAAAATTGG + Intronic
1085268509 11:75253369-75253391 CGTCTAGTATAATGTCAAATAGG + Intergenic
1088105448 11:106202099-106202121 TCTTAGGTTTAAAGTCTAATGGG + Intergenic
1088266816 11:107995679-107995701 CCTTAAGAATTATGTTAAATTGG - Intergenic
1093103129 12:15052112-15052134 CCTTAACCATAATGTCATATTGG - Intergenic
1097444980 12:59659655-59659677 GCTTGGGTATATGGTCAAATGGG + Intronic
1099579884 12:84431764-84431786 CTTGAGGTATAATATTAAATTGG + Intergenic
1100117377 12:91323907-91323929 CCTTAAGAATTATGTTAAATTGG - Intergenic
1104523116 12:129493965-129493987 CCTTAGGTATAATGTCAAATGGG + Intronic
1107591232 13:41908862-41908884 ACTTAAGTATAATGGAAAATGGG + Intronic
1110669678 13:78162445-78162467 TCTTAGGTGCAAGGTCAAATCGG - Intergenic
1111149826 13:84235911-84235933 CACTAGGTGTAATGTCAAACTGG + Intergenic
1112093970 13:96112321-96112343 GCTTTGGGATAATGTAAAATTGG + Intronic
1112256706 13:97840464-97840486 TCTTATGTTTAATGTCATATAGG + Intergenic
1114733896 14:25023207-25023229 TATTAGGTGTAATATCAAATGGG + Intronic
1118099606 14:62581705-62581727 CCTCATGTATGATGTTAAATGGG - Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1126223183 15:46239105-46239127 CCTTTGGGATTATGTCAAAATGG - Intergenic
1128173977 15:65537488-65537510 CCTTAAGAATTATGTTAAATCGG + Intronic
1130732313 15:86509543-86509565 CTTTTGGAATTATGTCAAATTGG + Intronic
1133169717 16:3974488-3974510 TCATAGTTATAATGTCTAATGGG - Intronic
1137391980 16:48089031-48089053 CCTCAGGTCCAATGTCACATAGG - Intronic
1142823352 17:2490373-2490395 CTTACAGTATAATGTCAAATGGG + Intronic
1155052453 18:22160587-22160609 CCTTAGGTATTATGACAATTTGG + Intergenic
1155625564 18:27830526-27830548 CCTTAGATAGATTGTCAACTTGG - Intergenic
1158257467 18:55569168-55569190 CCTTAAGTACACTGTTAAATAGG - Intronic
1159364056 18:67443072-67443094 CATTACATATAATGTCAACTTGG - Intergenic
1160352168 18:78193051-78193073 AATGAGGTATAATGTTAAATAGG + Intergenic
930460017 2:51661954-51661976 CCTAAGGTATATTGACAAGTAGG + Intergenic
933096694 2:78191679-78191701 CCTTTGCTCTCATGTCAAATGGG - Intergenic
935301003 2:101693945-101693967 CCCTATGTAAAATGTCAAATTGG + Intergenic
935596413 2:104881591-104881613 ACATAGGTATTATTTCAAATTGG + Intergenic
936953678 2:118003253-118003275 CCTTAGATATGTTGCCAAATGGG - Intronic
937141299 2:119603683-119603705 CCTAAGCTATTATGCCAAATTGG + Intronic
939652616 2:144783707-144783729 CTTTATGTATATTGTCAAGTAGG + Intergenic
939700996 2:145390568-145390590 CCTCAGGTATTATGTCTCATAGG + Intergenic
939804003 2:146749869-146749891 CCTTAGACAGAATCTCAAATAGG - Intergenic
941450087 2:165650405-165650427 CCTTGGCTATCATGTCAAGTTGG + Intronic
941487065 2:166095463-166095485 CCTTTGTTAAAATGTCAAACTGG - Intronic
943314320 2:186367442-186367464 CATTAGGTAAGATGTCAATTAGG - Intergenic
943803127 2:192087549-192087571 CCTAAGGCATACTGCCAAATTGG + Intronic
945645844 2:212492154-212492176 ACTTAGGTAAAATATGAAATTGG + Intronic
947268942 2:228311858-228311880 CATTAAATATCATGTCAAATAGG + Intergenic
1175969946 20:62680383-62680405 CCTCCAGTACAATGTCAAATGGG + Intronic
1176686847 21:9856786-9856808 CCTTAGTTGTCTTGTCAAATTGG + Intergenic
1176688740 21:9879681-9879703 ACTTAGGTATAATGGCTGATAGG + Intergenic
1177865345 21:26506350-26506372 TCTTAGCTATAATGTCAATGAGG + Intronic
1179429107 21:41306910-41306932 CCTTAAGAAGCATGTCAAATGGG - Intronic
954373026 3:50179122-50179144 CCTTAAGAATTATGTGAAATAGG - Intronic
955482919 3:59407554-59407576 CCTTAGTTACAACGTCAGATGGG - Intergenic
956347498 3:68297053-68297075 CCTGAGGTAGAAGGTAAAATAGG + Intronic
957130938 3:76221992-76222014 CCTGGGGAATAATGCCAAATGGG + Intronic
957520171 3:81309151-81309173 CATAAGAAATAATGTCAAATAGG + Intergenic
960497777 3:118395524-118395546 CCTTTGGTATCGTGACAAATAGG - Intergenic
963289900 3:143476992-143477014 CATTATTTATAATGTCACATGGG - Intronic
965629373 3:170715788-170715810 CCTAAGGTTGAAAGTCAAATTGG + Intronic
971702890 4:30003077-30003099 TCATTGGTAGAATGTCAAATAGG - Intergenic
972044158 4:34642168-34642190 CTGTAGGTATTAGGTCAAATTGG - Intergenic
973136904 4:46720268-46720290 TCTTAGCTATAATTTCACATTGG + Intergenic
974381222 4:61142877-61142899 ATTTAGGTATAATGGTAAATGGG + Intergenic
976246360 4:83010286-83010308 CCTTAGGTATAAGAGCAAACTGG + Intronic
979892148 4:126111647-126111669 ACATATGTATAATGTCAAGTAGG + Intergenic
980041159 4:127942222-127942244 TCTTCTGTATAAAGTCAAATTGG - Intronic
980350235 4:131674935-131674957 CCTTAGTTGTCTTGTCAAATTGG + Intergenic
980352127 4:131697495-131697517 ACTTAGGTATAATGGCTGATAGG + Intergenic
981617767 4:146659774-146659796 CCTTAAGGATAATTTCAAAAAGG + Intergenic
983406804 4:167341253-167341275 CCTAAGCTATAATGTGCAATAGG + Intergenic
983926666 4:173410075-173410097 ACTTAGGTTGAATCTCAAATGGG - Intergenic
984201172 4:176723050-176723072 CCTTAGGTAAAATCTAAACTTGG - Intronic
984554285 4:181195568-181195590 CCTTAGGTAAAATCTCCAAGAGG - Intergenic
987531645 5:19129686-19129708 CTTAATGTATAATGTGAAATTGG + Intergenic
988908022 5:35809917-35809939 CCTTTGGAATTATGTAAAATAGG + Intronic
989493638 5:42086079-42086101 CCTTGTGTATTAGGTCAAATGGG + Intergenic
995992351 5:118256154-118256176 CTTTAGTTATAATGGCAAGTAGG - Intergenic
999221086 5:149978230-149978252 CCTTAGGAATGGTTTCAAATGGG + Exonic
1000655911 5:163877537-163877559 ACTTAGGTATAAGTTTAAATGGG + Intergenic
1005361978 6:25039449-25039471 CCTTAGGCATTATGCCAAAGAGG + Intronic
1008679307 6:53855671-53855693 ACTTATGGCTAATGTCAAATGGG - Intronic
1014622535 6:123686554-123686576 CTTTAGGTATGATGTGAAGTTGG - Intergenic
1015509222 6:134021248-134021270 ACATAGGAAAAATGTCAAATTGG - Intronic
1016944711 6:149519069-149519091 CCTAAGATAAAATGTCACATAGG - Intronic
1018117057 6:160597148-160597170 AGTTCGGTATAATGTTAAATAGG + Intronic
1019946675 7:4335111-4335133 CCTTAGGTAAATTGTTAAGTAGG + Intergenic
1022642323 7:32199742-32199764 CCTGTGGTATAATGACAAACTGG - Intronic
1027511091 7:79081107-79081129 CCTTGTGTACACTGTCAAATTGG - Intronic
1031780413 7:125954624-125954646 CTTTCAGTATTATGTCAAATAGG - Intergenic
1043203649 8:77407337-77407359 CATTAGGTATATTGAGAAATAGG - Intergenic
1048436043 8:134418787-134418809 CCTTAGGTATATACCCAAATGGG - Intergenic
1053262613 9:36682265-36682287 CATTAGGTATGATGTTAACTGGG + Intergenic
1053780589 9:41602219-41602241 ACTTAGGTATAATGGCTGATAGG - Intergenic
1053782474 9:41624776-41624798 CCTTAGTTGTCTTGTCAAATTGG - Intergenic
1054168532 9:61812376-61812398 ACTTAGGTATAATGGCTGATAGG - Intergenic
1054170430 9:61834933-61834955 CCTTAGTTGTCTTGTCAAATTGG - Intergenic
1054667107 9:67745882-67745904 CCTTAGTTGTCTTGTCAAATTGG + Intergenic
1054668998 9:67768442-67768464 ACTTAGGTATAATGGCTGATAGG + Intergenic
1058264938 9:102887536-102887558 CCAGAGGTATAATGTCTGATGGG + Intergenic
1186776578 X:12870943-12870965 GATAAGGTATAAGGTCAAATAGG + Intronic
1190141818 X:47853478-47853500 CCTTAAGAATTATGCCAAATCGG - Intronic
1193890305 X:87035949-87035971 CCTGTGGTACAATGTGAAATTGG - Intergenic
1198136711 X:133759014-133759036 CTTTAAGTATAATGTTGAATAGG - Intronic
1198971383 X:142284645-142284667 TCTAAAGTATAATGTCATATAGG + Intergenic
1202183933 Y:22164663-22164685 CATCAGGAATAATTTCAAATTGG - Intergenic
1202207426 Y:22421738-22421760 CATCAGGAATAATTTCAAATTGG + Intergenic