ID: 1104524472

View in Genome Browser
Species Human (GRCh38)
Location 12:129505888-129505910
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1545
Summary {0: 6, 1: 331, 2: 463, 3: 348, 4: 397}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104524472_1104524475 -7 Left 1104524472 12:129505888-129505910 CCCTCTACCTTAAGTTTATGTGA 0: 6
1: 331
2: 463
3: 348
4: 397
Right 1104524475 12:129505904-129505926 TATGTGAGTCCTTATGTGTTAGG 0: 349
1: 430
2: 380
3: 255
4: 362
1104524472_1104524478 22 Left 1104524472 12:129505888-129505910 CCCTCTACCTTAAGTTTATGTGA 0: 6
1: 331
2: 463
3: 348
4: 397
Right 1104524478 12:129505933-129505955 TCTTGAAGGCAGCAGATAGTTGG 0: 55
1: 233
2: 636
3: 1181
4: 2114
1104524472_1104524479 26 Left 1104524472 12:129505888-129505910 CCCTCTACCTTAAGTTTATGTGA 0: 6
1: 331
2: 463
3: 348
4: 397
Right 1104524479 12:129505937-129505959 GAAGGCAGCAGATAGTTGGTTGG 0: 116
1: 226
2: 324
3: 360
4: 428
1104524472_1104524477 8 Left 1104524472 12:129505888-129505910 CCCTCTACCTTAAGTTTATGTGA 0: 6
1: 331
2: 463
3: 348
4: 397
Right 1104524477 12:129505919-129505941 GTGTTAGGTGAGTCTCTTGAAGG 0: 88
1: 291
2: 250
3: 151
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104524472 Original CRISPR TCACATAAACTTAAGGTAGA GGG (reversed) Intronic
900699546 1:4036240-4036262 TCACATAAACTTAAGGTAAAGGG + Intergenic
900723416 1:4196181-4196203 TCACATAAACTTAAGTTAAAAGG + Intergenic
901101752 1:6724477-6724499 TCAAATGAGCTTCAGGTAGAGGG - Intergenic
901679627 1:10905399-10905421 TCACATAAAATTATGGTATATGG + Intergenic
902803086 1:18842749-18842771 TCATAGAAACATAAAGTAGAAGG + Intronic
902969382 1:20035584-20035606 TCACTTAAACTTAAGGTATAGGG - Intronic
903752377 1:25633643-25633665 TCATATAAACTCAAAGTAAAGGG - Intronic
904147710 1:28407639-28407661 TCACATAAACAAAAGGTAATTGG - Intronic
904572300 1:31475684-31475706 TCACATAAACTTAAGTTAAAGGG - Intergenic
904627779 1:31816802-31816824 TCAAATATAATTAATGTAGATGG + Intergenic
905272703 1:36797351-36797373 TCACAAAACTTTTAGGTAGAAGG - Exonic
905497612 1:38405538-38405560 TCACATAAACATAAGGTAAAGGG + Intergenic
906053772 1:42898140-42898162 TCATATAAACTTAAAGTAAAAGG - Intergenic
906486228 1:46237484-46237506 ACAAATAAATTGAAGGTAGATGG + Intergenic
906563810 1:46781799-46781821 TCACATAAACTTAAAGTAAATGG - Intronic
906594705 1:47064824-47064846 TGACATGAACTTAAGGTAAGTGG + Intergenic
906869361 1:49460454-49460476 TCACATAAATCTAAGGAAAAGGG - Intronic
906914847 1:49997331-49997353 TCACAAAAACTCAAGGTAAAGGG + Intronic
907001422 1:50862669-50862691 TCACACAAACTTAAGGTAAAGGG + Intronic
907349354 1:53813404-53813426 CCACATAAACTTAAAGTAAAAGG + Intronic
908174907 1:61545857-61545879 TTACATAAACTTAAAGTAAAGGG - Intergenic
908657021 1:66399009-66399031 TCACATAAAATTAAGAAAGTTGG + Intergenic
908660490 1:66430069-66430091 TCACATAAACTTAAGGAAAAGGG - Intergenic
908803441 1:67904997-67905019 TCACATAAGCTTAAGGTAAAGGG - Intergenic
908860303 1:68478681-68478703 TCACAAAAGGTGAAGGTAGAGGG - Intronic
908862128 1:68500896-68500918 TCACATAAACTTAAGGTAAAGGG + Intergenic
908883625 1:68761383-68761405 TCACATAAACTTAAGGTAAAGGG + Intergenic
908890596 1:68843358-68843380 TCACATAAACTTAAGGTAAAGGG - Intergenic
908981985 1:69969406-69969428 TCACATAAACTTAAGGTAAAGGG + Intronic
909235058 1:73142505-73142527 TCACATAAACTTAAGGTAAAGGG - Intergenic
909405668 1:75286336-75286358 TCACATGAACTTAAGGTAAAGGG - Intronic
909420067 1:75454005-75454027 TCCCATAAAATTGAGGGAGAGGG + Intronic
909511160 1:76454145-76454167 TCTTCTAAACTTAAGGTAAAGGG - Intronic
909580129 1:77224023-77224045 TGACAGAAACTGAAGGGAGAGGG + Intergenic
909673837 1:78216830-78216852 TCACATAAACTTAAAGTAATGGG + Intergenic
909828158 1:80152330-80152352 TCACATAAATTTAAGGTAAAGGG - Intergenic
909830513 1:80183514-80183536 TCAAGTAAACTTAAGATAGAGGG - Intergenic
909860270 1:80595968-80595990 TCACGTAAACTTAAGGTAAAGGG + Intergenic
909981190 1:82103425-82103447 TCACATAAACTTAAAGTAAATGG - Intergenic
910077804 1:83300829-83300851 TCACATAAACTTCAAGTAAAGGG + Intergenic
910232917 1:85005022-85005044 TCACATAAACTTAAGGTAAAGGG + Intronic
910323672 1:85978496-85978518 TCAAATAAACCTAAGGTAAAAGG + Intronic
910598241 1:89003215-89003237 TCACATAAAGTTAAAGTAAATGG - Intergenic
910738787 1:90492852-90492874 TCACATAAACTTAAAGTAAGGGG - Intergenic
910919386 1:92327521-92327543 TCACATAAACTTAAGGTAAAGGG - Intronic
911047119 1:93637844-93637866 TCCTATAAACGTAAGCTAGAAGG + Intronic
911080912 1:93929501-93929523 TCACATAAACTTAAAGTTAAGGG + Intergenic
911322516 1:96432521-96432543 TCACAAAAACTTAAGGTAAAGGG - Intergenic
911685104 1:100766423-100766445 TCACAGAAGCTAAAGGAAGAGGG + Intergenic
911689338 1:100814283-100814305 TCACATAAACTTAAGGTAAAGGG + Intergenic
911743461 1:101412873-101412895 TCACATAAAATTAAGGCAAAGGG + Intergenic
911812528 1:102301338-102301360 TCATATAAACTTTGAGTAGAAGG + Intergenic
911989034 1:104667837-104667859 TGAAATAACCTTCAGGTAGAAGG + Intergenic
912079712 1:105920026-105920048 CCACATAAAGTTTAGGAAGAGGG - Intergenic
912082142 1:105950014-105950036 TCACATAAACTTAAGGCAAAGGG - Intergenic
912793621 1:112675865-112675887 ACAAATAAACATAAGGTAGTGGG + Intronic
913035617 1:114962525-114962547 TCACATAAACTTAAGGTAAAGGG - Intronic
913151556 1:116048876-116048898 TCACATAAACTTAAGGTAAAGGG + Intronic
913236377 1:116787181-116787203 TCACATAAACTTAAGGTAAAGGG + Intergenic
913337301 1:117720544-117720566 TCACATAAACTTAAGGTAAAGGG + Intergenic
913383599 1:118235457-118235479 TCACATGAAGTTAAGGTAAAGGG + Intergenic
913417980 1:118633603-118633625 TCACATATAGTTAAGGTAAAGGG - Intergenic
913493712 1:119407007-119407029 TCATATAAACTTAGGGTAAAGGG + Intergenic
913588007 1:120295264-120295286 TCACATAAACTTAAGGTAAAGGG - Intergenic
913620178 1:120603105-120603127 TCACATAAACTTAAGGTAAAGGG + Intergenic
913972854 1:143428728-143428750 TTACATAAACTTAAGGAAAGTGG - Intergenic
914067238 1:144254336-144254358 TTACATAAACTTAAGGAAAGTGG - Intergenic
914111915 1:144712018-144712040 TTACATAAACTTAAGGAAAGTGG + Intergenic
914455287 1:147831036-147831058 TCACATAAACTTAAAGCAAAGGG - Intergenic
914570023 1:148907137-148907159 TCACATAAACTTAAGGTAAAGGG - Intronic
914602806 1:149223132-149223154 TCACATAAACTTAAGGTAAAGGG + Intergenic
914968165 1:152279822-152279844 TCACATGAACCTAAAGTAAAGGG + Intergenic
915821445 1:159028834-159028856 TCATATAAACATAAGGTAAAGGG - Intronic
915999744 1:160604063-160604085 TAACATAAACTTAAGGTAAAGGG - Intergenic
916331504 1:163623007-163623029 TCATATAAACCTAAGGTAAAGGG - Intergenic
916868921 1:168890734-168890756 TCATATAAACTCAAGGTAAAAGG + Intergenic
916872973 1:168937693-168937715 TCACAAAAACCTAAGGTAAAGGG - Intergenic
917351398 1:174081893-174081915 TCACATAAACTTAAGGTAAAGGG + Intergenic
917461780 1:175236720-175236742 TCACATAAACTTAAAGTATAGGG + Intergenic
917478628 1:175390828-175390850 TCATATTAACTTAATGAAGAAGG + Intronic
917573077 1:176290406-176290428 TCATATAAACTCAAGTTAAAGGG + Intergenic
918694099 1:187521559-187521581 CTACATAAATTTAAGTTAGAAGG + Intergenic
918718463 1:187822259-187822281 TCGCATACACTTAAGATAAAGGG - Intergenic
918823861 1:189297056-189297078 ACACATAATTTAAAGGTAGAAGG - Intergenic
918972317 1:191435195-191435217 TCAAATAAACTTAATGTAAAGGG + Intergenic
919115317 1:193274327-193274349 TCACATAAACTTAAAGTAAAGGG - Intergenic
919214289 1:194532693-194532715 TCACATAAACTTAAGGTAAAGGG - Intergenic
919281330 1:195493607-195493629 TCACATAAACTTAAGGTTATAGG - Intergenic
919397780 1:197071888-197071910 TCACATAAACTTAAGGTAAAGGG + Intergenic
919424065 1:197406871-197406893 TCACAACAACTAAAGGTAGGTGG + Intronic
919470217 1:197969194-197969216 TCAGATCAAATTAAGGTACATGG + Intergenic
919485485 1:198141440-198141462 TCACATAAACTTAAGGTAAGGGG - Intergenic
919520317 1:198580525-198580547 TCACATGAACTTAAAGTAAAGGG - Intergenic
919571722 1:199257227-199257249 TCACATAAACTTAAGGTAAAGGG - Intergenic
919700002 1:200621876-200621898 TCAATTAAAATTAAGGTATAAGG + Intergenic
920726769 1:208443595-208443617 TCACATAAACTTAAAGTAAAGGG - Intergenic
920990018 1:210927835-210927857 TCACATAAACTTAAGGTAAAGGG + Intronic
921196631 1:212763559-212763581 TCATAAAAATTTAAGGTAAAGGG + Intronic
921242308 1:213197817-213197839 GCACATAAATTTAAGGAAAAGGG - Intronic
921690398 1:218141978-218142000 TCACATAAACTTCAGGTAAATGG + Intergenic
921762701 1:218935450-218935472 TCACATAAACTTAAGGTAAAGGG - Intergenic
921843088 1:219849108-219849130 TCACACAAACTTAAGATAAAGGG + Intronic
921999976 1:221467207-221467229 TCACATAAACTTAAGGTAAAGGG - Intergenic
922377497 1:224983315-224983337 TAACATAAACTTAAAGTAAAGGG - Intronic
922395811 1:225200197-225200219 TCACATAAACTTAAGATAAAGGG - Intronic
922673186 1:227530550-227530572 TCACATAAACTTAAGGAAAGTGG - Intergenic
922927164 1:229359279-229359301 TCACATAAACTTAAAGTAAAGGG - Intergenic
922995750 1:229958516-229958538 TCATGTAAACTTAAAGTAAAAGG - Intergenic
923122452 1:231004760-231004782 ACTCATAAACTTAAGGCAAAGGG + Intergenic
923458939 1:234190344-234190366 TCACATAAACTTAAGGTAAAGGG + Intronic
923691740 1:236200707-236200729 TCACATAAACTTAAGGTAAAGGG - Intronic
923808445 1:237286670-237286692 TCACATAAACTTAAAGTAAAGGG - Intronic
923874902 1:238036560-238036582 TCACATAAACTTAAAGCAAAGGG + Intergenic
923909952 1:238430589-238430611 TCACATAAATTTAAAGTAGAGGG - Intergenic
923910291 1:238433787-238433809 TCATATAAACTCAAGGTAAAGGG + Intergenic
923960926 1:239083004-239083026 TCACATAAACTTAAGGTAAATGG - Intergenic
923996477 1:239500902-239500924 TAACAGAAACTTAAAGTAAAAGG + Intronic
924193051 1:241576126-241576148 TCACACAAACTCAAGGTAGAGGG - Intronic
924492046 1:244547917-244547939 ACACATAAACTGAAAGTAAAGGG + Intronic
924691736 1:246358090-246358112 TCACATAAACTTAAGGTAAAGGG + Intronic
924877974 1:248126907-248126929 TTACATAAACTTAATATAAAGGG - Intergenic
924883098 1:248185047-248185069 TCACATAAACTTAAGATAAAGGG - Intergenic
924885194 1:248208176-248208198 TCACATAAACTTAAGTTAAAGGG - Intergenic
924894346 1:248319192-248319214 TCACATAAACTTACTATAAAGGG + Intergenic
1062761005 10:19065-19087 TTACATAAACTTAAGGAAAGTGG + Intergenic
1063561102 10:7128689-7128711 TCACATAAACTTATGGTAAAGGG - Intergenic
1064557023 10:16557583-16557605 TCACATAAACTTAAGGTAAATGG - Intergenic
1065136689 10:22677843-22677865 TCATTTAAACTTCAGCTAGAAGG - Intronic
1065355481 10:24836087-24836109 TCATATAAACTTAAGATAAAGGG + Intergenic
1065418352 10:25514371-25514393 TCACATAAACTTAAGGTAAAGGG - Intronic
1065462582 10:25984388-25984410 TCGCAAAAACTTAAGGTAAAGGG + Intronic
1065470756 10:26079363-26079385 TCACATAAACTTAAAGTAAAGGG - Intronic
1065894385 10:30150222-30150244 TCACATAAACTTAAGGTAGGGGG - Intergenic
1066047360 10:31604961-31604983 CCACATACACTTGAGGCAGAAGG - Intergenic
1066145334 10:32552264-32552286 TCGCATAAACTTAAAGTAAATGG - Intronic
1066164381 10:32770951-32770973 TCATATAAACTCAAGGAAAAGGG - Intronic
1066651074 10:37655707-37655729 TCACATAAACTTAAGGTAAAGGG + Intergenic
1066747284 10:38613560-38613582 TTACATAAACTTAAGGAAAGTGG + Intergenic
1067234017 10:44432920-44432942 TCACATAAACTTAAGGTAAAGGG - Intergenic
1067895190 10:50171512-50171534 TCATATAAACTCAAGGAAAAAGG + Intergenic
1067953795 10:50770464-50770486 TCATATAAACTCAAGGAAAAAGG - Intronic
1068087591 10:52393676-52393698 TTTCAGAAACTTAAGGTACAGGG + Intergenic
1068122654 10:52799524-52799546 TCACATAAACTGAAGGTGAAGGG - Intergenic
1068157221 10:53215784-53215806 TCACTTAAACTTAAGGTGAAGGG - Intergenic
1068161832 10:53274203-53274225 TCACATAAACTTAATGTAAAAGG + Intergenic
1068172928 10:53419848-53419870 TCACATAAACTTAAGGTGAGAGG - Intergenic
1068480975 10:57587591-57587613 TCACATAAACTTAAAGGAGGGGG + Intergenic
1068808705 10:61229990-61230012 TCAGATAAACTTAAGTTAAAGGG + Intergenic
1068924830 10:62525224-62525246 TCACATAAACTTAAGGTAAAGGG - Intronic
1069113084 10:64470416-64470438 TTACAGAAACTTAAGGTAATGGG + Intergenic
1069129387 10:64680281-64680303 TCACATAAACTTAAGGTAAAGGG - Intergenic
1069146185 10:64894622-64894644 TCACATAAACTTAAGATAAAGGG - Intergenic
1069150311 10:64952108-64952130 TCACATGAACTTAAAGTAAAGGG - Intergenic
1070215583 10:74376680-74376702 TCAAATAAACTTACTGTAAAAGG - Intronic
1070465106 10:76713605-76713627 TCACATAAACTTAAAGTTAAGGG + Intergenic
1071015684 10:80994944-80994966 TCATATAAACTTAAGGTAAAGGG - Intergenic
1071023995 10:81091064-81091086 TCACATAAACTTAAGGTAAAGGG - Intergenic
1071045779 10:81374691-81374713 TCACAAAAACTTAAGCTAAAGGG - Intergenic
1071271836 10:84014680-84014702 TCACATCAACTTTAGGAAGCAGG + Intergenic
1071382523 10:85082317-85082339 TCTCAGAAAATTAAGGTATATGG + Intergenic
1072164053 10:92794918-92794940 TCACATAAACTTAAAGTAAAGGG + Intergenic
1072928221 10:99635745-99635767 TCACATAAACTTAAAGTAAAGGG + Intergenic
1073618259 10:105020470-105020492 TGACATAAACCTGGGGTAGAGGG - Intronic
1075157948 10:119995596-119995618 TCACATAAATTTAAGGTAAATGG - Intergenic
1075493983 10:122902349-122902371 TCACATAACCTTGAGGTAAAGGG + Intergenic
1075660417 10:124191428-124191450 TCACATAAACTTAAAGTAAAGGG - Intergenic
1076112184 10:127869036-127869058 TCATATAGACTCAAGGTAAAGGG - Intergenic
1076376117 10:129986567-129986589 TCACATAAACTTCAGGTAAAGGG + Intergenic
1076665399 10:132086724-132086746 TCACATAAACTTAAGGTAAAGGG - Intergenic
1077774992 11:5260653-5260675 TCACATAAACTTAAGGTAAAGGG + Intronic
1078288794 11:9985229-9985251 TCACATAAACTTAAGGTAAAGGG + Intronic
1078411750 11:11127638-11127660 TCATATCAACTCAAGGTAAAAGG - Intergenic
1078753802 11:14189702-14189724 CTACATAAACTTAAGGAAGAGGG + Intronic
1078991388 11:16649909-16649931 TCACATAACCGAAAGGTAAAGGG + Intronic
1079179699 11:18179534-18179556 TCACATAAACTTAAGGTAAAGGG + Intronic
1079255763 11:18828282-18828304 TCACATAAACTTAAAGTAAAGGG - Intergenic
1079273464 11:19011419-19011441 TCACATAAACTTAAAGTAAAAGG - Intergenic
1079463987 11:20711247-20711269 TCACACTAACTAAAGGTAAAGGG - Intronic
1079805836 11:24930095-24930117 TCAAATAAACTTAAGGTAAGGGG - Intronic
1079951973 11:26817367-26817389 TCACATAAAATTAAGGGAAAGGG - Intergenic
1079956299 11:26869623-26869645 TCATACAAACTTAAGATAAAGGG + Intergenic
1080203153 11:29697639-29697661 TCACATAGACTTAAGGTAAAGGG - Intergenic
1080324316 11:31052126-31052148 TCACATAAACATAAAGTAAAGGG + Intronic
1080402495 11:31949146-31949168 TCACATAAACTTATAGTAAATGG + Intronic
1080672346 11:34392919-34392941 TCACATAAACTTAAAGTAAAGGG - Intergenic
1080863887 11:36176162-36176184 TCACATAAACTTAAGGTAAAGGG - Intronic
1081009568 11:37792224-37792246 TCAGACAAACTTAAGGTAAAGGG - Intergenic
1081064691 11:38526062-38526084 TCGTATAAACTCAAGGTAAAAGG + Intergenic
1081075121 11:38662948-38662970 TTACATAAATTTAGGGCAGAAGG - Intergenic
1081090888 11:38865281-38865303 CCATATAAACTTCAGGTAAAGGG - Intergenic
1081195447 11:40154488-40154510 TCAAATAAACTTAAAGTAAAGGG + Intronic
1081940199 11:46935192-46935214 TCCCATAACCTCAAGCTAGATGG + Intergenic
1082104178 11:48202029-48202051 TCACATAAACTTAAGGTAAAGGG + Intergenic
1082120681 11:48376618-48376640 TCACATAAACCTGAGGTAAATGG - Intergenic
1082679986 11:56155378-56155400 TCACATAAACATAAGGTAAAGGG + Intergenic
1082761580 11:57131807-57131829 TCACTGACACATAAGGTAGATGG - Intergenic
1082897516 11:58207852-58207874 AAACATAAACTTAAAATAGAAGG + Intergenic
1082917053 11:58448421-58448443 TCACATAAACTTAAAGTAAAGGG + Intergenic
1083127032 11:60580127-60580149 TCACATAAACTTAAAGGAAAGGG + Intergenic
1085240334 11:75048310-75048332 TCACATAAACTTAAGGTAAAGGG - Intergenic
1085748062 11:79131812-79131834 TCACATAAATTTAAAGTAAAGGG + Intronic
1085917359 11:80905285-80905307 CCACACAAACTTAAGGTAAAGGG + Intergenic
1085949846 11:81317253-81317275 TCATATTAAGGTAAGGTAGAAGG + Intergenic
1086264783 11:84984760-84984782 TCACATAAACTTAAGGTAAAGGG + Intronic
1086297796 11:85390129-85390151 TCACATAAACTTAAGGTAAAGGG + Intronic
1086813451 11:91338713-91338735 TCATATAAACTCAAGGTACAGGG + Intergenic
1086997705 11:93377480-93377502 TCACACAAACTTAAGGTAAAGGG - Intronic
1087090436 11:94265665-94265687 TCAAGTAAACTTAAGGTGAATGG + Intergenic
1087395485 11:97591303-97591325 TCACATAAATTTAAGGTAAAGGG + Intergenic
1087688747 11:101295685-101295707 TCACATAAACTTAAGGTAAAGGG - Intergenic
1087804515 11:102541131-102541153 TCACATAAACTTAAATTAAAGGG + Intergenic
1087866013 11:103228049-103228071 TCTCATAAACTTAAGGTAAAGGG - Intronic
1088137513 11:106576157-106576179 TCACATAAACTTAAAGTAAAGGG - Intergenic
1088179659 11:107094573-107094595 TCATATAAACTTAAGGTAAAGGG + Intergenic
1088206630 11:107399347-107399369 TTACATAAACTTAAAATAAAGGG + Intronic
1088372266 11:109104748-109104770 TCACAGAAACTTAAGGTAAAGGG - Intergenic
1088387261 11:109273499-109273521 TCACAGAAACTTAAGGTAAAGGG - Intergenic
1088387859 11:109279822-109279844 TCAAATAAACTTAAAGTAAAGGG - Intergenic
1088413316 11:109560983-109561005 TCATATAAACTCAAGGTAAAAGG - Intergenic
1088552647 11:111029008-111029030 TCTTATAAACTCAAGGTAAAGGG + Intergenic
1088580730 11:111313335-111313357 TCACATAAACTTAAGGAAAAGGG + Intergenic
1088800273 11:113299254-113299276 TCCCATAAACTTTAGGTAAAGGG + Intergenic
1088951346 11:114573491-114573513 TCACATAAACTTAAGGTAAAGGG + Intronic
1089107582 11:116025918-116025940 TCACATAAACTTAAAGTAAAGGG + Intergenic
1089826057 11:121278952-121278974 TCAGGTAAACTTAAAGTAAAGGG - Intergenic
1089952700 11:122544832-122544854 TCACATAAACTTAAAGTAAAGGG - Intergenic
1090545442 11:127761337-127761359 TCACATAAACTTAAGGTAAAGGG + Intergenic
1090559294 11:127913378-127913400 TCACATAAACTTAAGGTAAGGGG - Intergenic
1090682873 11:129079877-129079899 TCACATAAACTTAAGGTAAAGGG + Intronic
1090688425 11:129151002-129151024 TCAACAAAACTTAAGGTAAAGGG + Intronic
1090756903 11:129800046-129800068 TCACATAAACTTAAGGTAAAGGG + Intergenic
1090894813 11:130962571-130962593 TCACATAAACTTACAATAAAGGG - Intergenic
1091193549 11:133713999-133714021 TCAGCAAAACTCAAGGTAGATGG - Intergenic
1091380981 12:59194-59216 TCACATAAACTTAAGGTAAAGGG + Intergenic
1091479381 12:810959-810981 TCAAAACAACTTAATGTAGATGG + Intronic
1091891743 12:4060846-4060868 TCATAGATACTTAAGGTAGAGGG + Intergenic
1092060248 12:5544754-5544776 TCACATAGACTTAAGGTAAAAGG + Intronic
1092604653 12:10105065-10105087 TCATATAAATTCAAGGTAAAGGG + Intronic
1093001836 12:14005961-14005983 TCACATAAACTTAAGGTGAAGGG - Intergenic
1093010725 12:14103788-14103810 TCACATAAACTTAAAGTAAAGGG + Intergenic
1093135972 12:15451109-15451131 TCACATAAACTTAAGGTAAAGGG + Intronic
1093277752 12:17150607-17150629 TCACATAAACTTAAGGTTTAGGG + Intergenic
1093409018 12:18843104-18843126 TCACATAAATTTAAAGTAAAGGG - Intergenic
1093468856 12:19479842-19479864 TCAAATAAACTTAAGGTAAAGGG - Intronic
1093488511 12:19679503-19679525 TCACATAAACTTAAAGTAAAGGG - Intronic
1093598140 12:20986669-20986691 TCACATAAACTTAAAGCTAAGGG - Intergenic
1093608391 12:21123172-21123194 TCACATAAACTTAAGGTAAAAGG + Intronic
1093720772 12:22439234-22439256 TCACATAAACTTAAAATAAAGGG + Intergenic
1093963953 12:25305308-25305330 TCATATAAACTTAAGGTAAAGGG + Intergenic
1093995161 12:25632945-25632967 TCACATAAACTTAAAGTAAAAGG + Intronic
1094263252 12:28525959-28525981 TCACACAAACTTAAGGTAAAGGG - Intronic
1094447164 12:30544367-30544389 TCACATAAACTTAAAGTCAAGGG - Intergenic
1094789412 12:33894323-33894345 TGTTATAAACTTAAGGTAAAGGG + Intergenic
1094808744 12:34116784-34116806 TTACATAAACTTAAGGAAAGTGG + Intergenic
1095118049 12:38379989-38380011 TCACATAAACTTAAAGCAAAAGG - Intergenic
1095176519 12:39098043-39098065 TCACATAAACTTAAGGTAAAGGG + Intergenic
1095500850 12:42837275-42837297 TCACATAAACTTAAGGTAAGGGG - Intergenic
1095776325 12:46013934-46013956 ACACATAAACTGAAGGTGAAAGG - Intergenic
1095784679 12:46096432-46096454 GCACATAAACTCAAGGTAAAGGG + Intergenic
1095893011 12:47252214-47252236 TCACATAAACTTAAAGTAAAGGG + Intergenic
1096600057 12:52722707-52722729 TCACGTGAACTGAAGGAAGAGGG - Intergenic
1096956642 12:55532913-55532935 TCACATAAACTGAAGGTAAAGGG + Intergenic
1096957033 12:55536631-55536653 TCACAGAAACTTAAAGTAAAAGG + Intergenic
1097295699 12:57960039-57960061 TCACATAAACTTAAACTAAAGGG + Intergenic
1097511358 12:60545971-60545993 TTATATAAACGTAGGGTAGATGG + Intergenic
1097537183 12:60887370-60887392 TCACATAAACTTAAGGTAAAGGG - Intergenic
1097547711 12:61024770-61024792 GCACATAAACTTAATGTAAAGGG - Intergenic
1097581455 12:61462188-61462210 TCATATAAACTGAAGGTAAAGGG + Intergenic
1097603830 12:61728593-61728615 TTACATAAACTTAAGGCAAAGGG - Intronic
1097659953 12:62418789-62418811 TGACATAAACTTAAGGTAAAGGG + Intergenic
1097760795 12:63461627-63461649 TCTCATAAACTTAAAGTACAGGG + Intergenic
1097906778 12:64928544-64928566 TCACATAAACTTAAGGTAAAGGG - Intergenic
1098223878 12:68300440-68300462 TCATATAAGCTCAAGGTAAAGGG + Intronic
1098500797 12:71189332-71189354 TCACATAAACTGAAGGTAAAGGG + Intronic
1098518817 12:71411482-71411504 TGTCATAAACTTAAGGTAAAGGG + Intronic
1098654537 12:73011432-73011454 TTACATAAACTTAAGGTAAAGGG - Intergenic
1098786261 12:74760243-74760265 TCACATAAACTTAAGGTAGAGGG - Intergenic
1098852438 12:75612882-75612904 TCACATAAACTTAAGGTAAATGG + Intergenic
1098960672 12:76737018-76737040 TCACATAAACTTAAAGTAAAGGG - Intergenic
1098982482 12:76972417-76972439 TCACATAAACTTAAAGTAAAGGG - Intergenic
1099042181 12:77669476-77669498 TCACATAAACTTAAGGTAAAGGG + Intergenic
1099292506 12:80789216-80789238 TCACATACACATAATGTATACGG - Intergenic
1099382541 12:81972654-81972676 TCACATAAACTTAAGGTAAAAGG + Intergenic
1099392223 12:82095992-82096014 AAACATAAACTTAAGGTAAAGGG - Intergenic
1100011673 12:89961343-89961365 TCTCAAAAACTTAAGCTAGGAGG + Intergenic
1100290801 12:93213113-93213135 TCACAAAAACTTAAAATAAAGGG - Intergenic
1100697047 12:97106165-97106187 TCACACAAACTTAAGGTAAAGGG - Intergenic
1100698684 12:97123135-97123157 TCAAATTAACTTAAATTAGATGG - Intergenic
1100706497 12:97205626-97205648 TCACATAAACTTAAGGTAAAGGG + Intergenic
1100862951 12:98826562-98826584 TCAGCTAAACTTGAAGTAGAGGG + Intronic
1100918736 12:99457552-99457574 TCACATAAACGTAAGGTAAAGGG + Intronic
1100937163 12:99681892-99681914 TCACATAAACTTAAGGAAAAGGG + Intronic
1100951509 12:99855178-99855200 TCACATAAACTTAAGGTGAAGGG + Intronic
1100970648 12:100066152-100066174 TCACACAAACTTAAGGTAAAGGG + Intronic
1101290587 12:103363620-103363642 TCACACAAACTTAAGGTAAAGGG + Intronic
1101298051 12:103446635-103446657 TCACATAAACTTAAGGTAAAGGG + Intronic
1102413476 12:112740188-112740210 TCACAAATACCTTAGGTAGAAGG - Intronic
1103806229 12:123575264-123575286 TCATATAAAACTATGGTAGAAGG - Intergenic
1104524472 12:129505888-129505910 TCACATAAACTTAAGGTAGAGGG - Intronic
1105080518 13:16110296-16110318 TCACATAAAAACAAGGCAGAAGG + Intergenic
1105908478 13:24837000-24837022 TCACATAAACTTGAACTAAAGGG + Intronic
1105990198 13:25612988-25613010 TCACATGAACTTAAGGTAAAGGG - Intronic
1106060163 13:26282840-26282862 TCACATAAACTTAAGGTAAAAGG + Intronic
1106378062 13:29209288-29209310 TCAAATCAACTTAAGGTAGGGGG - Intronic
1106392051 13:29344514-29344536 TCACATAAACTTAAGGTAGAGGG - Intronic
1106424748 13:29615831-29615853 TTACATAAACTTAAGGTAGAGGG + Intergenic
1106977955 13:35245161-35245183 TCACATAAAATTAAGGTAAAAGG - Intronic
1106995622 13:35476823-35476845 GCACACAAACTAAAGGTAGGAGG + Exonic
1107070915 13:36267727-36267749 TCATATAAACTCAAGGTAAAAGG + Intronic
1107361395 13:39621223-39621245 TCACATAAACATAAGGTAAAGGG + Intergenic
1107426618 13:40300211-40300233 TCATGTAAACTTAAGGTAAAGGG - Intergenic
1108134541 13:47341048-47341070 TCACATAAACTTAAGGTAAAGGG + Intergenic
1108134745 13:47343526-47343548 TCACATAAACTTAAGGTAAAGGG + Intergenic
1108165917 13:47693053-47693075 TCACATAAAAGGAAGGCAGAGGG - Intergenic
1108298533 13:49051012-49051034 TAACATAAACTTAAGGTAAAGGG - Intronic
1108469585 13:50754538-50754560 TCACATAAACTTAAAGTAAAGGG - Intronic
1108817281 13:54307166-54307188 TCACATAAGCTTAAAGTAAAGGG + Intergenic
1108825760 13:54410092-54410114 TCACATAAACTTAAAGTAAAGGG + Intergenic
1108831842 13:54488853-54488875 TCACATAAACTTAAGGTAAAGGG + Intergenic
1109001895 13:56815050-56815072 TCATATAAACTCAAGGTAAGTGG + Intergenic
1109047703 13:57435355-57435377 TCACATAAAGTTAAAGTAAAGGG - Intergenic
1109058131 13:57579217-57579239 TCACATAAACTTAAGGTAAGAGG - Intergenic
1109125332 13:58510390-58510412 TCACATAAACTTAAAGTAAAGGG + Intergenic
1109400862 13:61826707-61826729 TCAAATAAACTTAACCAAGAAGG - Intergenic
1109484748 13:63003830-63003852 TCACATAAACTTAAGGTGAAGGG + Intergenic
1109508184 13:63334757-63334779 TCACATAAATTTAAAGTAAAGGG - Intergenic
1109618082 13:64863160-64863182 TCACATAAACTTAAGGTAAAGGG - Intergenic
1109822439 13:67675637-67675659 TCTCATGAACTTAAGGTAAAGGG - Intergenic
1109824414 13:67698738-67698760 TCTCATAAACTTAAGGTAAAGGG + Intergenic
1110182031 13:72628284-72628306 TCCAATAAACTTAAGGTGAAGGG + Intergenic
1110504916 13:76274029-76274051 TCACATAAACCTAAGGTAAAGGG + Intergenic
1110627767 13:77670356-77670378 TCATATAAACTTAAAATAAAGGG + Intergenic
1110755935 13:79173922-79173944 TCACATAAACTTAAGGTAAAGGG + Intergenic
1110793465 13:79611109-79611131 TCATATAAACTTAAGATAAAGGG - Intergenic
1111148670 13:84218683-84218705 TCACATAAAATTAAGATAAAGGG + Intergenic
1111160759 13:84392157-84392179 TCACAATAACTTAAGATAAAGGG - Intergenic
1111283218 13:86053820-86053842 TCACATAAACTTAAGGTAAAGGG + Intergenic
1111291516 13:86177206-86177228 TCACAGATACTGAAGGAAGACGG - Intergenic
1111601329 13:90479211-90479233 TCACCTTAACTTAAGGAAAAAGG + Intergenic
1111748156 13:92295824-92295846 TCACACAAACTTAAGGTAAAGGG - Intronic
1112035200 13:95491120-95491142 TCACATAAACTTAAAGTAAAGGG - Intronic
1112068695 13:95823623-95823645 TCACATAAATTCAAGGTAAAGGG - Intronic
1112087191 13:96043640-96043662 TCACATAAACTTAAGGTAAAGGG + Intronic
1112738326 13:102445626-102445648 TCACACGAACTTAAAGTAAAGGG + Intergenic
1112747509 13:102543351-102543373 TCACATAAACTTAAAGTAAATGG + Intergenic
1112945511 13:104921924-104921946 TCATAAAAACTTAAAGTAAAGGG + Intergenic
1113240490 13:108331104-108331126 TCACATAAACTTAAGGTAAAGGG + Intergenic
1113269751 13:108660640-108660662 TCACATAAACTTAAAGTAAAGGG - Intronic
1113637960 13:111934705-111934727 TCATATAAACTTAGGGTAAAGGG - Intergenic
1113845434 13:113386674-113386696 TCACATAAACTTAAGGTAAAGGG - Intergenic
1113998506 14:16118614-16118636 TCACATAAAAATTAGATAGAAGG + Intergenic
1114030599 14:18576220-18576242 TTACATAAACTTAAGGAAAGTGG - Intergenic
1114337139 14:21701759-21701781 TCACATAAGCTTAAGGTAAAGGG + Intergenic
1114691983 14:24592138-24592160 TCACATAAACTTAAAGTAAAAGG - Intergenic
1114756493 14:25266134-25266156 TCACATAAACTTAAGGTAAAGGG - Intergenic
1114946630 14:27689937-27689959 TGAAATAAACTTAAGATAGAGGG - Intergenic
1115350440 14:32389207-32389229 TCGCACAAACTTAAGGTAAAGGG - Intronic
1115937920 14:38576056-38576078 TCACATAAACTTAAGGTAAAGGG - Intergenic
1115958884 14:38812024-38812046 TCACATAAACTTAAAGTAAAGGG + Intergenic
1115970043 14:38934667-38934689 TCACATAAACTTAAAGTAAAGGG + Intergenic
1115997244 14:39206828-39206850 TCACATAAACTTAGAGTAAAGGG + Intergenic
1116048844 14:39779337-39779359 TCACATAAACTTAAAGTAAAGGG - Intergenic
1116076451 14:40117341-40117363 TCATAAAAACTCAAGGTAAACGG - Intergenic
1116335701 14:43653406-43653428 TCACACAAACTTAGGGTAAAGGG + Intergenic
1116732190 14:48637956-48637978 TCACATAAGCTTAAAGCAAAAGG + Intergenic
1116747787 14:48843751-48843773 TCTCACAAACTCAAAGTAGAAGG - Intergenic
1117103599 14:52376505-52376527 TCACATAAACTTAAGATAAAGGG - Intergenic
1117112963 14:52477448-52477470 TCACATAAACTTAAGGTAAAGGG + Intronic
1117182404 14:53204466-53204488 TTACATAAACTTAAGGTAAAGGG + Intergenic
1117240911 14:53831473-53831495 TCACATAAACTCAAGGTAAAGGG + Intergenic
1117271558 14:54148847-54148869 TCACATAAACTTAAGGTAAAAGG + Intergenic
1117509934 14:56440941-56440963 TCACATAAACTTAAAGTAAAGGG - Intergenic
1117640029 14:57788046-57788068 TCACATAGACTTAAAGCAAAGGG + Intronic
1117655229 14:57949394-57949416 TCCCATAAACTTAAGGTAAAGGG - Intronic
1118162498 14:63303965-63303987 TCACATAAACTTAAAGTAAAGGG + Intergenic
1118165782 14:63334409-63334431 TCACATAAACTTAAGGTAAAGGG + Intergenic
1118421031 14:65603880-65603902 TGACATAAACTTAAGGTACAGGG + Intronic
1119098666 14:71858225-71858247 TCACATAAACTTCAAGTAAAGGG + Intergenic
1120400148 14:84021135-84021157 TCAAATAAACTTAAGGTAAAGGG - Intergenic
1120450738 14:84664091-84664113 TCACATAAACTTAAGGTAAACGG - Intergenic
1120545571 14:85807509-85807531 TCACATAAACTTAAAGTAAAGGG - Intergenic
1120736162 14:88055613-88055635 TCACATAAACTTAAGGTAAGGGG - Intergenic
1120847029 14:89135206-89135228 TCACTTAAAACTAAGGCAGAGGG + Intronic
1121460064 14:94068136-94068158 TCACATAAACTTAAAGTAAAGGG + Intronic
1121475839 14:94201683-94201705 TCACATAAACTTAAGGTAAAGGG - Intronic
1121503273 14:94456886-94456908 TCACATAAATGTAAGGTAAAGGG - Intergenic
1121848245 14:97194604-97194626 TCACCTAAACTTAAGGTAAAGGG - Intergenic
1123220053 14:106846773-106846795 TTACATAAACTCAAGGTAAAAGG - Intergenic
1124505311 15:30267491-30267513 TCACATAAACTTAAGGTAAAGGG + Intergenic
1124557331 15:30738254-30738276 TCACATAAACTTAAAGTAAAAGG + Intronic
1124673932 15:31667493-31667515 TCACGTAAACTTAAAGTAAAGGG - Intronic
1124738241 15:32271140-32271162 TCACATAAACTTAAGGTAAAGGG - Intergenic
1125145645 15:36464911-36464933 TCTTATAAACTCAAGGTAAAGGG - Intergenic
1125151663 15:36539220-36539242 ACACATAAACTGAAAATAGAGGG + Intergenic
1126178375 15:45760644-45760666 TCACAGAAGCTTAAGGAACATGG + Intergenic
1126184457 15:45818383-45818405 TCACGTACACTTAAGGTAAAGGG - Intergenic
1126190755 15:45875587-45875609 TCACATACACTTAAGGAAAGGGG + Intergenic
1126193312 15:45901797-45901819 TCAAATAAACTTACAGAAGAAGG - Intergenic
1126244762 15:46491349-46491371 TCAGATAAACTTAAAGTAAAGGG + Intergenic
1126488408 15:49209020-49209042 TCACATAAACTTAAAGTAAAGGG - Intronic
1126520170 15:49583968-49583990 TTCCAAAAACTTAAGGAAGAAGG + Intronic
1126521241 15:49596747-49596769 TCACATAAACTTAAGGTAAAGGG + Intronic
1126566124 15:50101365-50101387 TCACATAAACTTAAGGTAATGGG + Intronic
1126572926 15:50170833-50170855 TCACATAAACTTACAGTAATGGG + Intronic
1126997238 15:54458763-54458785 ACACATAAACTTAAGGTAAAGGG - Intronic
1127036304 15:54921987-54922009 TCGCATAAACTTAAGGTAAAGGG - Intergenic
1127194665 15:56570676-56570698 TCACATAAGCTTAAGGTACAAGG + Intergenic
1127573763 15:60270529-60270551 TCATATAAACTTATGGTAAAGGG - Intergenic
1127694476 15:61431625-61431647 TCACATAAACTTAAGGTAAAGGG - Intergenic
1128238943 15:66086952-66086974 TCACATAAACTTAAAGGGGTGGG + Intronic
1128626503 15:69211545-69211567 TTAAATAAACATAAGATAGAAGG + Intronic
1129562644 15:76588460-76588482 TCACATAAACTTAAGGTAAAGGG - Intronic
1129631900 15:77269292-77269314 TCACATAAAGCTAAGGTAACAGG + Intronic
1130575034 15:85084478-85084500 GCAAGGAAACTTAAGGTAGATGG + Intronic
1130779764 15:87023255-87023277 TCACACAAACTTAAGTGAAAGGG + Intronic
1131246348 15:90797111-90797133 TCACCAAGAATTAAGGTAGATGG + Intronic
1132033590 15:98459753-98459775 TCACATAAACTTAAGATAAAGGG + Intronic
1132253910 15:100357386-100357408 TCACATAAACTTAAGGTAAAAGG + Intergenic
1133952938 16:10413026-10413048 TCACATAAGCTTAAGGTAAAGGG - Intronic
1134086384 16:11360208-11360230 TCACCTGACCTTAAGGTAGGGGG - Intronic
1135203046 16:20455924-20455946 TCACATAAACTTAAGGTAAGGGG + Intronic
1135216053 16:20571937-20571959 TCACATAAACTTAAGGTAAGGGG - Intronic
1135289237 16:21220577-21220599 TCACATAAACTTAAAGTAAAGGG - Intergenic
1135794185 16:25425697-25425719 ACAAATAACCTTAAGGTAGGAGG + Intergenic
1135901839 16:26467036-26467058 TCACATAAACTTAAAGCAAAGGG + Intergenic
1136735778 16:32466083-32466105 TTACATAAACTTAAGGAAAGTGG - Intergenic
1138192313 16:55024083-55024105 TCACATAAACTTAAGGTAAAGGG + Intergenic
1138618484 16:58192065-58192087 TCAGATAAACTATAGATAGATGG - Intronic
1138793103 16:59932177-59932199 TCACAAAAAATTAAAATAGATGG - Intergenic
1139024196 16:62793953-62793975 TCATATAAACTCAAGGTAAAAGG - Intergenic
1139370545 16:66466437-66466459 TCCCAGTATCTTAAGGTAGAAGG + Intronic
1140531009 16:75666057-75666079 TCACATAAACTTAAGGTAAAGGG + Intronic
1140548113 16:75832014-75832036 TCACATAAACTTAAGGTAAAGGG - Intergenic
1203017297 16_KI270728v1_random:363491-363513 TTACATAAACTTAAGGAAAGTGG + Intergenic
1203035632 16_KI270728v1_random:636649-636671 TTACATAAACTTAAGGAAAGTGG + Intergenic
1142516946 17:438166-438188 GCACATAAGATTAAGGTACAGGG - Intergenic
1142840964 17:2629949-2629971 TCACATAAATTTAAAGTAAAGGG - Intronic
1142940129 17:3373659-3373681 TCATGGAAACTTAAGGTAAAGGG - Intergenic
1143991023 17:10961713-10961735 TCACATAAACTTAAAGTAAAGGG + Intergenic
1144139468 17:12334739-12334761 ACACATAAACTTAAAGTGAAGGG - Intergenic
1144276555 17:13674421-13674443 TCATATAAACTCAAGGTAAAAGG + Intergenic
1144278169 17:13697377-13697399 TCACATAAACTTAAGATAAAGGG - Intergenic
1144616277 17:16776982-16777004 TCACATAAACTTAAGGCAAAGGG + Intronic
1144896426 17:18538677-18538699 TCACATAAACTTAAGGCAAAGGG - Intergenic
1145135791 17:20405540-20405562 TCACATAAACTTAAGGCAAAGGG + Intergenic
1146583597 17:34061649-34061671 TCACATAAACTTAAAGTAAAGGG + Intronic
1146587256 17:34092985-34093007 TCACACAAACCTAATGTTGAGGG - Intronic
1146612926 17:34323985-34324007 TCACATGAGCTTAAGATAGAGGG - Intergenic
1146751246 17:35383099-35383121 TCACATACACTTAAAGTAAAGGG - Intergenic
1147005892 17:37403728-37403750 TAACATCAACTGAAGGGAGAGGG + Intronic
1147398921 17:40167309-40167331 TCTCCTAAATGTAAGGTAGAAGG + Intronic
1147462989 17:40587272-40587294 TCACATAAACTTAAAGTGGTGGG - Intergenic
1148400389 17:47354731-47354753 TCACATAAACCTAAGGTAAAGGG - Intronic
1148408051 17:47437625-47437647 TCAAATAAACTTAAAGTAAAGGG - Intronic
1149004667 17:51793186-51793208 TAACATAAACTTGGGGTGGAGGG + Intronic
1149122204 17:53183254-53183276 TCACATAAACTTAACGTGAAGGG - Intergenic
1149221591 17:54420457-54420479 TCACATAAACTTAAGGTTAAGGG + Intergenic
1150093197 17:62348784-62348806 TCACATAAACTTAAGATAAGGGG - Intergenic
1150528849 17:65955625-65955647 TCACATAAACTTACAGTAAAGGG + Intronic
1150896087 17:69212814-69212836 TCACATAAACTTAAGGTAAAGGG - Intronic
1150945283 17:69739373-69739395 TCACATAAACTTAAAGTAAAAGG - Intergenic
1151079010 17:71306716-71306738 TCACATAAACTTAAGGTAAAGGG + Intergenic
1151146977 17:72050190-72050212 GCAAATAAATATAAGGTAGATGG + Intergenic
1152953912 18:19419-19441 TTACATAAACTTAAGGAAAGTGG + Intergenic
1153071736 18:1114063-1114085 TCACACAAACTTAAGGTAAAGGG - Intergenic
1153128283 18:1823364-1823386 CAACATAAATTTAAGATAGAAGG - Intergenic
1153164471 18:2246231-2246253 TCACATAAACTTAAGGAAAGAGG + Intergenic
1153400669 18:4680894-4680916 TCAGATCAACTTAAAGTAAAGGG + Intergenic
1153425241 18:4955661-4955683 TCACATAAACTTAAGGTAAAGGG + Intergenic
1153451162 18:5231035-5231057 TCACATAAACTTAAGATAAAAGG - Intergenic
1153532793 18:6066723-6066745 TCACATAAACTTAAGGTAAAGGG - Intronic
1153633430 18:7093662-7093684 TACCATAACATTAAGGTAGATGG + Intronic
1153828959 18:8902952-8902974 ACACATATACTTAAGGTAAAGGG + Intergenic
1153869676 18:9305952-9305974 TCACATAAACTTAAAGTAAAGGG + Intergenic
1153965730 18:10180292-10180314 TCACATAAACTTTAAGTAAATGG - Intergenic
1154079070 18:11236322-11236344 TCACATACATTCAAGGTAGCTGG - Intergenic
1154090198 18:11351351-11351373 TCACATAAACTTAAGGTAAAGGG + Intergenic
1154298076 18:13167812-13167834 TCACAAAAATTTAAGGTAAAGGG + Intergenic
1154498658 18:14981497-14981519 TTACATAAACTTAAGGAAAGTGG + Intergenic
1155286979 18:24299093-24299115 TCATATAAACTCAAGGTAAAGGG - Intronic
1155462050 18:26093551-26093573 TCACATAACCAAGAGGTAGAAGG + Intergenic
1155534133 18:26798170-26798192 ACACATAAACTTAAAATAAAAGG + Intergenic
1155573632 18:27222043-27222065 TCACATAAACTTAATGTAAAGGG - Intergenic
1156326861 18:36081733-36081755 TCACATAAACTTAAGGAAAAGGG + Intergenic
1156606935 18:38677968-38677990 TCAAGTAAACTTAAGGTAAAGGG - Intergenic
1156642707 18:39121491-39121513 TCACATAAACTTCAGGTAAAGGG + Intergenic
1156643185 18:39126743-39126765 TCACAGAAATTTAAGGTAAAGGG + Intergenic
1156773175 18:40755040-40755062 TCCTATAAACTGAAGGTAAAAGG - Intergenic
1156893170 18:42213620-42213642 TCACATAAACTTAAGGTAAAGGG - Intergenic
1157037864 18:43998011-43998033 TCACATAAAATGAATGTACATGG - Intergenic
1157040063 18:44028047-44028069 GTACATAAACTTAAAGTACAAGG - Intergenic
1157218790 18:45809013-45809035 TCACATAAACTTAAGGTAAAGGG + Intergenic
1157507699 18:48240974-48240996 TCACATAGACTTAAGGTTAAGGG + Intronic
1157541046 18:48507263-48507285 TCACATAAACTTAAACTAAAGGG + Intergenic
1158045315 18:53148453-53148475 TGACATAAACTCAAGGGAAAGGG + Intronic
1158756709 18:60333714-60333736 TCACATAAACTTAAAGGGGGGGG + Intergenic
1159061067 18:63514375-63514397 TTACATAAACTTAAACTAGTAGG - Intergenic
1159225552 18:65530220-65530242 GCACAAAAAGTAAAGGTAGAAGG + Intergenic
1159398229 18:67893055-67893077 TAATACAAACTTCAGGTAGATGG + Intergenic
1159453846 18:68636773-68636795 TCATATACACTTAAGGTAAAGGG - Intergenic
1159612677 18:70544154-70544176 TCACAAAAACTTAAGGTAAAGGG - Intergenic
1159830607 18:73273896-73273918 TCCCATATACTTAAAGTATATGG + Intergenic
1159838640 18:73371250-73371272 TCACATAAACTAAAAGTAAAGGG + Intergenic
1159906793 18:74099690-74099712 TCACATAAACTTAAGGTAAAGGG + Intronic
1160059028 18:75512952-75512974 TCACATAAACTTAAGGTAAAGGG + Intergenic
1160267420 18:77352112-77352134 TCACATAAACTTGAAGTAAAGGG - Intergenic
1163855658 19:19700110-19700132 TCACTTAAACTTAAGGCAAAGGG - Intergenic
1163871662 19:19826314-19826336 TCACTTAAACTTAAGGGAAAGGG + Intergenic
1163886366 19:19968788-19968810 TCACTTAAACTTAAGGTAAAGGG - Intergenic
1163897255 19:20069966-20069988 TCACATAAACTTAAGGCAAAGGG + Intergenic
1163907973 19:20163699-20163721 TCACATAAAGTTAAGGTAAAGGG + Intergenic
1163935563 19:20439933-20439955 ACACATGAAGTTAAGGTAAAGGG - Intergenic
1164319936 19:24135300-24135322 TCACATAAACTTAAAGTAAAGGG - Intergenic
1164422608 19:28108644-28108666 TCATATAAACTCAAGGTAAAGGG + Intergenic
1164497419 19:28779643-28779665 ACACATAAACTGAAAGTAAAAGG + Intergenic
1166258616 19:41622540-41622562 TCACATCACCTTGAGGGAGAGGG + Intronic
1166262930 19:41654683-41654705 TCACATAAACTTAAGGTAAAGGG + Intronic
1166428904 19:42706080-42706102 TCATGTAAACTTAAGGTAAAAGG - Intronic
1166442500 19:42827101-42827123 TCACATGAACTTAAGGTAAAAGG - Intronic
1166450301 19:42893560-42893582 TCACATAAACTTAAGGTAAAAGG - Intronic
1166479465 19:43157820-43157842 TCACATGAACTTAAGGTAAAAGG - Intronic
1166604052 19:44124879-44124901 TCATATAAACTTAAAGTAAAAGG - Intronic
1166899875 19:46051760-46051782 TCACATAAACTTAAGGTAAATGG + Intronic
1167106327 19:47431930-47431952 TCCCATAAAACTAAGGTAGCAGG - Intronic
924992657 2:326893-326915 TGACATAAACTTAAAGTAAAGGG - Intergenic
925127264 2:1468053-1468075 TCACATAAACTTAAGGTAAAGGG - Intronic
925637714 2:5957615-5957637 TCTTATACACTTAAGGTAAAGGG - Intergenic
925705728 2:6683335-6683357 TCCCATAAATTTAAGGCAAAGGG + Intergenic
925795499 2:7537845-7537867 CCACATAAACTTAAGGTAAAGGG - Intergenic
926915800 2:17891273-17891295 TCACAGAAACTTAAAGTAAAGGG - Intronic
927036525 2:19183321-19183343 TCACATAAACTTAAGGTAAAGGG - Intergenic
927069754 2:19515323-19515345 TAACATTCACTTAAGGTAAAGGG - Intergenic
927363298 2:22262967-22262989 TCACATAAACTTAAGGTAAAAGG - Intergenic
928356893 2:30624393-30624415 TCACATAAACTTAAGGTAAAGGG + Intronic
928443033 2:31309400-31309422 TCATATAAACTTAAGATAAAAGG - Intergenic
928479940 2:31673012-31673034 TCATATAAACTCAAGGTAAATGG - Intergenic
928685193 2:33742545-33742567 TCACATATACTTAAGGTAAAGGG - Intergenic
928798670 2:35058473-35058495 TCACATAAACTTAAGGTAAAGGG - Intergenic
928988665 2:37206927-37206949 TCACATAAACTTAAGGTAAAGGG + Intronic
929010081 2:37433236-37433258 TCACATAAACTTAAGGCAATGGG - Intergenic
930179619 2:48340006-48340028 TCACATAAAATTAAATTATATGG - Intronic
930423271 2:51179844-51179866 TCACATAAACTTAAGGTAAAAGG + Intergenic
931084849 2:58818478-58818500 AAACTTAAACTTAAGGTAGAAGG - Intergenic
931136178 2:59403925-59403947 TCACACAAACTTAAGGTAAAGGG + Intergenic
931136808 2:59412377-59412399 TCACACAAATTTAAGGTAAATGG - Intergenic
931524968 2:63143285-63143307 TCACATAAACTTAAAGTAAAGGG - Intronic
931548071 2:63410666-63410688 TCACATAAACTTCAAGTAAAGGG + Intronic
931834824 2:66087550-66087572 TCATATAAATTTAAGGTAAATGG + Intergenic
932100364 2:68894131-68894153 TCACCTAAACTTAAAGTAAAAGG - Intergenic
932954448 2:76335527-76335549 TCACATAAACTTAAAGTGAAGGG - Intergenic
933081470 2:77993100-77993122 TCATATAAACATATGGTTGATGG + Intergenic
933086127 2:78056582-78056604 TCACATAAACTTAAGGTAAAAGG - Intergenic
933110958 2:78399379-78399401 TCACATAAAATTAAGGTAAAGGG + Intergenic
933340783 2:81023700-81023722 TCACAGAAATATAAGGTAAAGGG - Intergenic
933382212 2:81563248-81563270 TCACATAAAGTAAAGGTAAAGGG - Intergenic
933410923 2:81923938-81923960 TCACATAAACTTAAGACAAAGGG + Intergenic
933576706 2:84077627-84077649 TCACATAAAATGAAGGGAGATGG - Intergenic
933627360 2:84616555-84616577 TCACATAAACTTAAGGTAAAGGG - Intronic
933822624 2:86128035-86128057 TCACATAAACTCAAGAAAGCTGG - Intronic
934111161 2:88744859-88744881 TCACATAAACTTACTGTAAAGGG - Intronic
934177551 2:89589685-89589707 TTACATAAACTTAAGGAAAGTGG - Intergenic
934186946 2:89755191-89755213 TTACATAAACTTAAGGAAAGTGG - Intergenic
934287848 2:91663987-91664009 TTACATAAACTTAAGGAAAGTGG - Intergenic
935000776 2:99012459-99012481 TCACATAAACTTAAGGTTAAAGG + Intronic
935007311 2:99091578-99091600 CCACATAAACTTAAGGTAAAGGG + Intronic
935610255 2:105015659-105015681 TCACATAAACTTAAGGTAAAGGG - Intergenic
935913569 2:107924132-107924154 TCATATATACTTAAGATAAATGG + Intergenic
936164648 2:110109326-110109348 TCAAATAAACTTAAAGTAAAAGG + Intronic
936555105 2:113489638-113489660 TCACATAAACTTAAGGTAAAGGG + Intronic
936815326 2:116453956-116453978 TCATATAAACTTAAGGTAAAAGG - Intergenic
936899113 2:117464293-117464315 TCACATGAACTTAAGGTAAAGGG - Intergenic
936900000 2:117472158-117472180 TCTTATAAACTCAAGGTAAAGGG - Intergenic
936910959 2:117593193-117593215 TCACATAAACTTAAGGTAAAGGG - Intergenic
937058065 2:118956267-118956289 TCACATAAACTTAAAATAAAGGG + Intronic
937461320 2:122089881-122089903 TCACATAAACTTTAGGTAAAGGG - Intergenic
937480502 2:122253433-122253455 TTACATAAACTTAAGGTAAAAGG + Intergenic
937663212 2:124454175-124454197 TCACATAAACTTAAGGTAAAGGG + Intronic
937716139 2:125035681-125035703 TCACAAAAACTTAAGGTAAAGGG - Intergenic
937798797 2:126057404-126057426 TCACATGAACTTAGGGTAAAGGG - Intergenic
938037842 2:128051056-128051078 TCATATAAACTTAAAGTAAAGGG - Intergenic
938175395 2:129122206-129122228 TCACATAAACTTAAGGTAAAGGG - Intergenic
938216352 2:129520698-129520720 TTACATAAACTTAAGGTAAAGGG - Intergenic
938216361 2:129520744-129520766 TTGCATAAACTTAAGGTAAAGGG + Intergenic
938497611 2:131809547-131809569 TTACATAAACTTAAGGAAAGTGG + Intergenic
938599633 2:132823832-132823854 TCACATAAACCTAAGGGATGGGG + Intronic
938674742 2:133620396-133620418 TCACATACACTTAAGGTAAAGGG + Intergenic
939219526 2:139283548-139283570 TAACATAAACTTAAGGTAAAGGG + Intergenic
939245576 2:139619413-139619435 TCACATAAACATCAGGTAAAGGG - Intergenic
939449403 2:142353630-142353652 TCACATAACCTTAAGGTAAAGGG + Intergenic
939769762 2:146300679-146300701 TCACATAAATTTAAAGTAAAGGG + Intergenic
939919331 2:148088979-148089001 TCATATAAACTTGAGGTAAAGGG + Intronic
940034508 2:149299912-149299934 TCATATAAAATTAAAGTAAAGGG - Intergenic
940157006 2:150667787-150667809 CCACATAAACTTAAAGTAAGGGG + Intergenic
940387302 2:153088835-153088857 TCACATAAACATAAGGTAAAGGG - Intergenic
940630513 2:156231984-156232006 TCACATAAACTTAAGGTAAAGGG + Intergenic
940709202 2:157142187-157142209 TCACATAAACTTAAAGTAAAGGG - Intergenic
940762550 2:157753087-157753109 TCAAATAAACTTAAGGTAAATGG + Intronic
940796618 2:158087354-158087376 TCACATAAACTTAAGGTAAAGGG - Intronic
941060862 2:160845023-160845045 TCACATAAACTTAAGGTAAAGGG + Intergenic
941260642 2:163292511-163292533 TAACACAGACTTAAGGTAGAAGG + Intergenic
941358173 2:164517640-164517662 TCACATAAACTTAAGGTAAAGGG + Intronic
941576917 2:167244279-167244301 TCACATAAAATAGAGGTGGAAGG + Exonic
941995508 2:171598140-171598162 AAACATAAACATAAGATAGAGGG + Intergenic
942146133 2:173028586-173028608 TCACCTAAACAGAAGGGAGAGGG - Intronic
943128001 2:183820481-183820503 TCATATAAATTTAAGGTAAAGGG - Intergenic
943149736 2:184097286-184097308 TCACATAAACTTAAGGTAAAGGG - Intergenic
943158889 2:184220588-184220610 TCATATAAACTCAAGGTGAAAGG - Intergenic
943199002 2:184794780-184794802 GCATATAAACTTAAGGTAAAGGG + Intronic
943449182 2:188026879-188026901 TCAAATAAACTTAAGATAAAGGG - Intergenic
943607665 2:189995480-189995502 TCATGTAAACTTAAGGTAAAAGG - Intronic
943654485 2:190493156-190493178 TCACATAAATTTAAGGTAAAGGG + Intronic
943891093 2:193288407-193288429 ACACATAAACTTAAAGTAAAGGG - Intergenic
943909490 2:193544518-193544540 TCATATAAACTTAAGGTAAAGGG + Intergenic
943943700 2:194031100-194031122 TCAAATAAACTTAAGGTAAAAGG + Intergenic
944485589 2:200201824-200201846 TCACATAAACTTAAAGTAAAGGG + Intergenic
944603185 2:201324133-201324155 TCAAATAAACTCAAGGGAAAAGG + Intronic
944804262 2:203265579-203265601 TTATATAAAATAAAGGTAGAAGG - Intronic
944926636 2:204472038-204472060 TCATATACACTTAACTTAGAGGG + Intergenic
945131873 2:206582406-206582428 TCACATAAACTTAAAGTAAAGGG - Intronic
945285889 2:208081071-208081093 TCAGATAAACTTACGGTAAAGGG + Intergenic
945337974 2:208615570-208615592 TCACATAAACTTAAGGTAAAGGG - Intronic
945362576 2:208909070-208909092 TCACATAAACTTAAGATATAAGG + Intergenic
945536361 2:211023230-211023252 TCACAAAAACTTAAGGTAAAGGG - Intergenic
945861469 2:215127659-215127681 TCACACAAACTTAAAGTAAAGGG - Intronic
946501492 2:220252016-220252038 TCACATAAACTGAAAGTAAAGGG + Intergenic
947146517 2:227071175-227071197 TCATATAAACTCAAGATAAAGGG + Intronic
947280267 2:228444621-228444643 TAGCATATGCTTAAGGTAGATGG - Intergenic
947456866 2:230263325-230263347 TCGCATAAACTTAAAGTAAAGGG - Intronic
947460694 2:230301906-230301928 TCACATAAACTTAAGGTAAAGGG + Intronic
948576924 2:238958424-238958446 TCAGAAAAACTTAAGGTAAAGGG + Intergenic
948679187 2:239620826-239620848 TCACATAAAATTCAGGGAGATGG - Intergenic
1169335941 20:4757351-4757373 TTACATAAACTTAAAGTAAAGGG - Intergenic
1169397719 20:5249187-5249209 TCACATAAACTTAAGGTAAAGGG - Intergenic
1169401525 20:5284790-5284812 TCACATAAACTTAAAGGAAAGGG + Intergenic
1169517242 20:6331220-6331242 TCACATAAACTTAAAGTAAAGGG - Intergenic
1169991116 20:11503726-11503748 TCATATAAATTCAAGGTAAAAGG - Intergenic
1170086427 20:12537427-12537449 TCACATAAACTTAAGGTAAAGGG + Intergenic
1170124996 20:12952988-12953010 TCACATTAACTTAAGGTAAAGGG - Intergenic
1170133733 20:13051217-13051239 TCACATAAACTTAAAGTAAACGG + Intronic
1170241522 20:14172202-14172224 TCACATAAACTTAAGGTAAAAGG - Intronic
1170375676 20:15697921-15697943 TCACATAAACTTAAAGTAAAGGG - Intronic
1170720828 20:18877457-18877479 TCACATAAACTTTAAGTAAACGG - Intergenic
1170726722 20:18935323-18935345 TCACATAAACTTAAGGTAAAGGG - Intergenic
1170741244 20:19058705-19058727 TCACATAAACTTAAGGTAAAAGG + Intergenic
1170862948 20:20126079-20126101 CCACATAAACCTAAAGTAAAGGG - Intronic
1171027982 20:21649798-21649820 TTGCACAAACTTAAGGTAAAGGG + Intergenic
1171066759 20:22024835-22024857 TCACATAAACTTAAGGTAAAGGG - Intergenic
1171080379 20:22176250-22176272 TCACATAAACTTAAGGTAAAGGG - Intergenic
1171165805 20:22969346-22969368 TCACATAAACTTAAAGTAAAGGG + Intergenic
1171242098 20:23579448-23579470 TTAAACAAACTTAAGGTAAAGGG - Intergenic
1171378455 20:24713018-24713040 TCTCATAAACTTAAGGTAAAGGG - Intergenic
1171577638 20:26351107-26351129 TCACATAAAATGAAGACAGAAGG + Intergenic
1172851233 20:37967295-37967317 TCACATAAACTTAAGGTAAAGGG - Intergenic
1173568548 20:44060030-44060052 ACACATAACCTTTAGGTAAAGGG + Intronic
1174131270 20:48344920-48344942 TCACATCAACTGCAGGAAGATGG - Intergenic
1176906283 21:14505372-14505394 TCACACAAACTTAAGGTACAGGG + Intronic
1177069419 21:16484833-16484855 TCACATAAACTTTAGGTAGAGGG - Intergenic
1177124478 21:17179110-17179132 TTACATAAACTTAAGGTTAAAGG + Intergenic
1177140771 21:17355409-17355431 TCACATAAACTTAAGATAAAGGG + Intergenic
1177249552 21:18575082-18575104 TCACATAAACTTAAGTCTAAGGG - Intergenic
1177847518 21:26307827-26307849 TTACATAAACTGAAAGTAAAGGG + Intergenic
1177934950 21:27333556-27333578 TCACATAAACTTAAGGTAAAGGG + Intergenic
1178733060 21:35122582-35122604 TCACATAAACTTAAGGTAAAGGG + Intronic
1178801875 21:35803193-35803215 TCACATAAACTTAAAGTAAAGGG + Intronic
1179083959 21:38200638-38200660 TCACATAAACTTAAGTTAAAGGG - Intronic
1179260471 21:39753847-39753869 TCACATAAACTCAAGGTGAAAGG - Intronic
1179467573 21:41587289-41587311 TCACATAAACTTAAGGTAAAGGG - Intergenic
1180040073 21:45272184-45272206 TCACACAAACTTAAGGTAAAGGG + Intronic
1180454713 22:15503276-15503298 TTACATAAACTTAAGGAAAGTGG - Intergenic
1180536780 22:16399861-16399883 TTACATAAACTTAAGGAAAGTGG + Intergenic
1181454474 22:23048907-23048929 TCACATAAACTTAAGATAAAGGG + Intergenic
1182199027 22:28550833-28550855 TCATATAAACTTAAGGCAAAGGG + Intronic
1182682823 22:32095717-32095739 TCACATAAATTTAAGGTAAAAGG - Intronic
1183048161 22:35238594-35238616 TCACGTAAACTTAAAGTAAAGGG - Intergenic
1184063791 22:42103282-42103304 TCACATAAACTTAAGGTAAAGGG - Intergenic
949145849 3:699231-699253 TCACATAAACTTAAGGTCAAGGG - Intergenic
949749515 3:7334694-7334716 TCACATAAACTTAAGGTAAGTGG + Intronic
950595175 3:13973811-13973833 TCATATAAACTCAAGGTAAAGGG - Intronic
950599019 3:14015289-14015311 TCACATAAACTTAAGGTAAAGGG - Intronic
951153541 3:19322053-19322075 TCATGTAAACTTAGGGTAAAGGG - Intronic
951198363 3:19849539-19849561 TCACATAAACGTAAGAGAAAGGG + Intergenic
951262043 3:20521819-20521841 TCACATAAACTTAAGGCGAAGGG - Intergenic
951294685 3:20919436-20919458 TCACATGAACTTAAGGTAAATGG + Intergenic
951302497 3:21015763-21015785 TCGTATAAACTTTAGGTAAAGGG - Intergenic
951326164 3:21304086-21304108 TCATATAAACTTAAGCTAAAGGG + Intergenic
951404816 3:22282960-22282982 ACTCATAAACTTAAGGTAAAGGG + Intronic
951467996 3:23022637-23022659 TCATGCAAACTTAAGGTAAAGGG + Intergenic
951656865 3:25018921-25018943 TAGCATAAACTTAAGTTGGATGG - Intergenic
951690823 3:25394765-25394787 TCACATAAACTTAAGGTAAAGGG - Intronic
951727101 3:25772505-25772527 TAACATAAACTTAAGGTAAAGGG - Intronic
951859086 3:27230644-27230666 TCAAATAAACTTAAAGGACAGGG + Intronic
952083072 3:29783821-29783843 TCACATAAACTTAAGGTAAAGGG + Intronic
952435041 3:33265208-33265230 TCACATAAACTTAAGGTAAAGGG - Intergenic
952528289 3:34236836-34236858 TCACATAAATTTAGGCTAAAAGG - Intergenic
952601700 3:35090856-35090878 TCATATAAACTTAAGGTAAAGGG + Intergenic
952689656 3:36190319-36190341 TCACACAAACTTAAGGTTAAGGG - Intergenic
952714726 3:36468954-36468976 TCACATAAACTTAAGGTAAAGGG - Intronic
952732683 3:36655247-36655269 TCACATAAATTTAAGGTAAAGGG + Intergenic
952993907 3:38858293-38858315 TCATATAAACTTAAGGTAAAGGG + Intronic
953382392 3:42482215-42482237 TCACATAAACTTAAGGTAAGGGG + Intergenic
953495341 3:43381342-43381364 TCACATAAACTTAAGGTAAAGGG + Intronic
953639343 3:44691222-44691244 TCACATAAACTTAAGGTAAAGGG + Intergenic
953723695 3:45379409-45379431 TCACATAAACTTAAAATAAAGGG - Intergenic
955450558 3:59062709-59062731 TGACATAAACTTAAGGTAAAGGG - Intergenic
955477345 3:59351656-59351678 TCATGTAAACTTAAAGTAAAGGG - Intergenic
956028610 3:65011512-65011534 TCACATAAATTTAAGGTACAAGG + Intergenic
956995468 3:74822499-74822521 TCACATAAAATTAAAGTAACAGG - Intergenic
957016198 3:75067663-75067685 TCACATAAACTTAAAGTACAGGG - Intergenic
957281658 3:78157747-78157769 TCATATAAACTCAAGGTTAAAGG + Intergenic
957433126 3:80139435-80139457 TCACATAAACTTAAGGTAAAGGG + Intergenic
957602115 3:82350711-82350733 TCACATAAACTTAAAGTAAAGGG + Intergenic
957971893 3:87392537-87392559 TCACATAAACTTAAGGTAAAGGG + Intergenic
958003102 3:87776497-87776519 TCAGATAAACTTAAAGTAAAGGG - Intergenic
958014019 3:87916505-87916527 TCACATAATCTTAAAGTAAAGGG + Intergenic
958064357 3:88524181-88524203 TCACATAAACTTAAGGTAAAGGG - Intergenic
958505808 3:94975413-94975435 TCACATAAACTTAAAGTAAAGGG + Intergenic
958509917 3:95035080-95035102 TCACATAAACTTAAGGTAAAGGG - Intergenic
958646939 3:96886542-96886564 TCACACAAACTTAAAGTATAAGG - Intronic
958768534 3:98399156-98399178 TCATATAAACTCAAGGTAAAGGG + Intergenic
958770859 3:98423780-98423802 TCACATAAACTTAAGGTAAAGGG + Intergenic
958787171 3:98610890-98610912 TCACATAAACTTAAGGTAAAGGG - Intergenic
958790008 3:98641571-98641593 TCATATAAACTTAAGGTAAAGGG - Intergenic
958818845 3:98949633-98949655 TCACATAAACTTAAGGTAAAGGG - Intergenic
958969733 3:100598851-100598873 TCAGATAAACTTAAAGTAAAGGG - Intergenic
959011905 3:101087479-101087501 TCACATAAATTAAAGGTATTTGG + Intergenic
959047164 3:101486892-101486914 TCACATAAACTTAAGGTAAAGGG + Intronic
959424013 3:106163531-106163553 TCACATAAACTTAAGGTAAAGGG + Intergenic
959436370 3:106319461-106319483 TCACATAAACTTAAGATAAAGGG + Intergenic
959666335 3:108926291-108926313 TCACATAAACTTAAGGTAAGGGG - Intronic
959715540 3:109429335-109429357 TCACATAAACTTAAGGTAAAAGG - Intergenic
959716164 3:109435047-109435069 TAAGATAAAATTAAAGTAGAGGG - Intergenic
959722104 3:109503714-109503736 TCACACAAATTTAAAGTAAAGGG - Intergenic
959727177 3:109557690-109557712 TTATATAAACTCAAGGTAAAGGG - Intergenic
959877995 3:111408790-111408812 TCACATAAACTTAAGGTAAAGGG + Intronic
959899257 3:111641272-111641294 TCATATAAACTTAAAGTAAAGGG + Intronic
959998274 3:112702002-112702024 TCACATAAACTTAAAGTAAAGGG + Intergenic
960152877 3:114268997-114269019 TCACATAAACTTAAGGTAAAGGG - Intergenic
960516731 3:118610092-118610114 TCACATAAACTTAAGGTAAGGGG + Intergenic
960578311 3:119248904-119248926 TCACATAAACTTAAGGTAAAGGG + Intergenic
960712145 3:120542157-120542179 TCACATAAACTTAAGGTAAAGGG - Intergenic
960756655 3:121021044-121021066 TCACATAAACTTAAGATAAAGGG + Intronic
960769902 3:121181830-121181852 TCACATAAACTTCAGGTAAAGGG + Intronic
961407370 3:126690517-126690539 TCACATAAGTTTAAGGTAAAGGG + Intergenic
961977900 3:131045972-131045994 TCATGTAAACTTAAGGTAAAGGG - Intronic
962013106 3:131412645-131412667 TCACATAAACTTAAGGTAAAGGG + Intergenic
962034636 3:131638316-131638338 TCACATAAACTTAAGGTAAAGGG + Intronic
962065811 3:131979547-131979569 TCACATAAGTTTAAAGTAAAGGG - Intronic
962147232 3:132853414-132853436 TCACATCAACTTAAGGTAAAGGG - Intergenic
962503175 3:136016678-136016700 TCACAGAGACTTAAGGTAAAGGG - Intronic
962530280 3:136273993-136274015 TCATATAACCTCAAGGTAAAGGG - Intronic
962709622 3:138074927-138074949 TCACACAAACTTAAGGTAAAGGG + Intronic
962861980 3:139412582-139412604 TCATATAAACTTAAGGTAAAGGG - Intergenic
962899693 3:139749527-139749549 ACACATAAATTGAAGGTAAAGGG - Intergenic
963023401 3:140895213-140895235 TCACATAAACTTGAGGTAAAGGG - Intergenic
963176284 3:142300814-142300836 TTACATAAACTTAAGGTAAAGGG + Intergenic
963213409 3:142719004-142719026 TTGCATAAACTTAAGGTAAAGGG + Intergenic
963373682 3:144436268-144436290 TCACGTAAACTTAAGGTAAAGGG - Intergenic
963832662 3:150024838-150024860 TCATATAAACTTAAGGTAAAGGG + Intronic
964075853 3:152690563-152690585 TCACATAAACTTAAGGGAAAGGG + Intergenic
964160840 3:153642900-153642922 TCACATAAACTTAAAGTAAAGGG + Intergenic
964252945 3:154741158-154741180 TCACATAAACTTAAGGTAAAAGG + Intergenic
964325172 3:155537521-155537543 ACTCATAAACTTAAAGTAAAGGG + Intronic
964331796 3:155610989-155611011 ACATGTAAACTTAAGGTAGAGGG + Intronic
964342675 3:155724607-155724629 TCACATAAACTTAAGGTAAAGGG - Intronic
964393558 3:156222201-156222223 TCACGTAAACTTAAGGTAAAGGG + Intronic
964457485 3:156884137-156884159 TGACATAAATTTAAGGCAAAGGG - Intronic
964601047 3:158501715-158501737 TCACACAAATTTAAAGTAAAGGG - Intronic
964644039 3:158938749-158938771 TCACATAAACTTAAGGTAAAGGG + Intergenic
964772830 3:160242138-160242160 TCACATAAACTTAAGGTAAAGGG + Intronic
964916148 3:161844603-161844625 TCACATAAACTTAAAGTAAAGGG - Intergenic
965154222 3:165026109-165026131 TCACACAAACTCAAGATAAAGGG + Intronic
965184753 3:165448397-165448419 TCATATAAACTTAAGGTAAATGG + Intergenic
965216678 3:165873056-165873078 TCACATAAACTTAAAGTAAGGGG - Intergenic
965291187 3:166883338-166883360 TCATATAAATTTAAGATAAAGGG + Intergenic
965296429 3:166953361-166953383 TCACATAAACTTAAGGTAAAGGG - Intergenic
965345346 3:167541825-167541847 ACTCATAAACTTAAGGTAAAGGG + Intronic
965745618 3:171922055-171922077 ACACATAAACTTAAGGTAAAGGG + Intronic
965874189 3:173297637-173297659 TCACACAAACTTAAGGTAAAGGG - Intergenic
966092930 3:176161677-176161699 TCACATAAAGTTAAGGTAAAGGG + Intergenic
966122601 3:176538834-176538856 TCACATAAACTCAAGTTAAAGGG + Intergenic
966229725 3:177638931-177638953 TCACATAAACTTAAGGTAAAGGG - Intergenic
966352828 3:179048947-179048969 TCACATAAACTTAAGGTAACAGG + Intronic
966553087 3:181227762-181227784 TCACATAAACTTAAGGTAAAAGG - Intergenic
967167227 3:186792357-186792379 TCAGACAAACTTAAGCTAAAGGG - Intronic
967209283 3:187152421-187152443 TCACATAAACTTAAAGTAAAGGG + Intronic
967257316 3:187607176-187607198 TCACATAAACTTAAAGTAAAGGG - Intergenic
967559143 3:190897605-190897627 TCACATAAACTTAAGTAAAGGGG + Intergenic
967651593 3:191992430-191992452 TCACATAAACTTAAGGTAAAGGG + Intergenic
967741383 3:193006603-193006625 TCACATAAACTTAAAGTAAAGGG - Intergenic
968191370 3:196670251-196670273 TCTCATAATCTTAAGAGAGATGG + Intronic
968807276 4:2782818-2782840 TCACATAAACTTAAGGTAAAGGG - Intergenic
969165461 4:5306505-5306527 ACACATAAACTTAAGGTAAAGGG - Intronic
969947124 4:10795218-10795240 TCACATAAACTTAAAGTAAAGGG - Intergenic
970215629 4:13757016-13757038 TCACATAAACTGCAGGTAAAAGG - Intergenic
970217321 4:13773408-13773430 TCACATAAACTTAACGTAAAGGG - Intergenic
970283154 4:14480406-14480428 TCCCATAAACTTAAGGTAAAGGG + Intergenic
970549105 4:17161782-17161804 TCACATAAACCTAAGGTAAAGGG - Intergenic
970658431 4:18258394-18258416 TCACATAAACTTAAAGTAAAGGG - Intergenic
970671872 4:18405965-18405987 TCACAGACATTGAAGGTAGAGGG + Intergenic
970856423 4:20653702-20653724 TCACATAAACTTAAGGTAAAGGG + Intergenic
970996291 4:22270771-22270793 TCACATAAATTTAAAGTAAAAGG + Intergenic
971050218 4:22853671-22853693 TCACATAAACTTAAGGTAGAGGG - Intergenic
971153001 4:24053528-24053550 TCACAAACATTTAGGGTAGATGG - Intergenic
971155625 4:24078621-24078643 GCTCATAAATTGAAGGTAGAAGG - Intergenic
971182917 4:24347621-24347643 TCACATACACTTAAAGTAAAGGG - Intergenic
971720732 4:30242659-30242681 TAACATAAACTTAAGGTAAAGGG - Intergenic
971721691 4:30253567-30253589 TCATATAAACTCAAGGTAAAGGG - Intergenic
971777399 4:30984479-30984501 ACACATAAACATAAGGAAGTTGG + Intronic
971797469 4:31246553-31246575 ACACATAGACTGAAGGTAAAGGG + Intergenic
971900859 4:32656663-32656685 TCACATAAACTTAAAGTAAAGGG - Intergenic
971908135 4:32755946-32755968 TCATATAAACTCAAGGTAAAAGG + Intergenic
972059245 4:34847474-34847496 TTACATAAACTTGAAGAAGATGG - Intergenic
972097147 4:35362601-35362623 TCACATAAACTTAAGGTAAAAGG - Intergenic
972873349 4:43327972-43327994 ACACATAATCTGAAAGTAGAAGG + Intergenic
972980894 4:44699594-44699616 TCCTTTAAACTTAAAGTAGATGG - Exonic
973068960 4:45833847-45833869 GCACATAACCTTAAGGTAAAGGG - Intergenic
973070655 4:45854511-45854533 CTACATAAACTTAAGGTAAAGGG - Intergenic
973179379 4:47249793-47249815 TCACATAAACTTAAAGTAAAAGG - Intronic
973244323 4:47994535-47994557 TCACATAAACTTAAGATAAAGGG - Intronic
973342870 4:49024209-49024231 TCACCTAAACTTAAGGTAAAGGG - Intronic
973675855 4:53262117-53262139 TCACATAAACTTAAGGTAAAGGG - Intronic
973831314 4:54762684-54762706 TCCCACAAACTTAAGGTAAAGGG - Intergenic
973920337 4:55677719-55677741 TCACACAAAGTTAAGATAAAGGG + Intergenic
973973527 4:56239553-56239575 TCAGCTAAACTTAGGGGAGAGGG - Intronic
974583283 4:63835307-63835329 TCACATAAACTTAAGGTAAAGGG - Intergenic
974708114 4:65549720-65549742 TCACAGAAGCTTAAACTAGAGGG + Intronic
975061896 4:70013726-70013748 TCACAAAAACATAAGATAAAGGG - Intergenic
975243614 4:72092703-72092725 CCATATAAACTTAAGGTAAAGGG - Intronic
975509969 4:75183169-75183191 TCACATAAACTTAAGGTAAAGGG + Intergenic
975613914 4:76227894-76227916 TCACGTAAACTTAATGTAATGGG - Intronic
975623426 4:76317256-76317278 TCACATAAACTTAAGGTAAAGGG + Intronic
975748624 4:77499632-77499654 GCACATACATTTAAGGAAGAAGG + Intergenic
975943009 4:79670229-79670251 TAACATAAACTTAAGGTAAAGGG + Intergenic
975944836 4:79693859-79693881 TCACATAAACTTAAGGTAAAGGG - Intergenic
976132206 4:81896605-81896627 GAACATAAACGTAAGGTGGAAGG + Intronic
976157221 4:82159282-82159304 TCACAAAAACTTAAGGTAAAGGG + Intergenic
976367773 4:84249037-84249059 TCACATAAAATAAAGGTTCAGGG - Intergenic
976464957 4:85356599-85356621 TCAGGTAAACCTAAGGTAAAAGG - Intergenic
976513333 4:85935433-85935455 TCACATAAACTAAAGGAAATCGG + Intronic
976556394 4:86455430-86455452 TCACATAAATTTAAGGTAAAGGG + Intronic
976562589 4:86519486-86519508 TCACATAAACTTAAGGTAAAGGG - Intronic
976654419 4:87473210-87473232 ACACACACACTTAAGGTAGTAGG + Intergenic
976686133 4:87817596-87817618 TCACATAAACTTAAAGTAAAGGG - Intergenic
976791453 4:88882790-88882812 TCACATAAACTTAATGTAAAGGG + Intronic
976856676 4:89612052-89612074 TCACATAAACTTAAAGTCAGGGG + Intergenic
976869762 4:89776752-89776774 TCACATAAACTTAAGGTAAAGGG + Intronic
976888051 4:90009657-90009679 CCACATAAACTTAAGGTAAAGGG + Intergenic
976907673 4:90260621-90260643 TCACATAAACTCAAGGTCAAAGG - Intronic
976918331 4:90406137-90406159 TCACATGAACTTAAGATAAAGGG + Intronic
976962913 4:91001620-91001642 TCAAATAAATTTAAGGTAAAGGG - Intronic
977016988 4:91703295-91703317 TCAATTTAACTTAATGTAGAAGG - Intergenic
977474126 4:97483348-97483370 TCACATAAACTTAAAGTAAAGGG + Intronic
977489425 4:97693312-97693334 TCACATAAACTTAAGGTAAAAGG + Intronic
977509832 4:97949283-97949305 TTATATAAACTCAAGGTAAAAGG - Intronic
977510701 4:97958517-97958539 TCATATAAACTTAAGGTAAAGGG + Intronic
977624642 4:99176990-99177012 TCATATAAACTCAAAGTAAAGGG - Intergenic
977635718 4:99295584-99295606 TCACATAAACTTAAGGTAAAGGG + Intergenic
977762956 4:100761156-100761178 TCCCATAAACTTAGGGTAAAGGG + Intronic
977813687 4:101388556-101388578 TTACATAAATGTAAGGTAAAGGG - Intergenic
977905888 4:102477535-102477557 TAACATAAGCTTAAGGTGAAGGG + Intergenic
978316746 4:107446509-107446531 TCACTCAAACTTAAGGTAAAGGG - Intergenic
978726483 4:111975790-111975812 TCATATAAACTTAAAGTAAAGGG - Intergenic
978762027 4:112363332-112363354 TCACATAAACTTAAGGTAAAGGG + Intronic
978916320 4:114129643-114129665 TTGCATAAACTTAGGGTAAAGGG + Intergenic
978925115 4:114233443-114233465 TCACATAAACTTAAGGTAAAGGG + Intergenic
978999237 4:115197602-115197624 TCACATAAACTTAAACTAAAGGG - Intergenic
979020518 4:115491001-115491023 TCACATAAACTTAAGGTAAAGGG + Intergenic
979195235 4:117913400-117913422 TCATATAAACTCAAGGTAAAGGG - Intergenic
979357180 4:119717989-119718011 TCACATAAACTTAAGGTAAGGGG + Intergenic
979381895 4:120016558-120016580 TCACATAAACTTAAAGTAAAAGG - Intergenic
979461733 4:120991505-120991527 TCACAGAAACTTAAGGTAAAGGG - Intergenic
979498932 4:121417001-121417023 TCACATGAACTTAAGGTAAAGGG - Intergenic
979705084 4:123711348-123711370 TCACATAAACTAAAAGTTAAGGG + Intergenic
979712489 4:123796496-123796518 TCACATAAACTTAAGGTAAAGGG - Intergenic
979794732 4:124832928-124832950 TCACATAAACTTAAAATAAAGGG - Intergenic
979794742 4:124833093-124833115 TCACATAAACTTAAAATAAAGGG - Intergenic
979984662 4:127298637-127298659 TCACATAAACTTAAGGTAAAGGG + Intergenic
980087013 4:128401966-128401988 TCACATAAACTTAAAGTAAAGGG - Intergenic
980087597 4:128407753-128407775 TCACATAAACTTAAGGTAAAGGG - Intergenic
980153018 4:129071663-129071685 TCACATAAACTTAAAGTGAAGGG - Intronic
980186879 4:129473503-129473525 TCACGTAAGCTTAAGATAAAGGG - Intergenic
980519126 4:133908327-133908349 TCCAGTAAACTTAAGGTATAGGG - Intergenic
980536392 4:134128950-134128972 TCATATAAACTTAAGGTAAAGGG + Intergenic
980580312 4:134741918-134741940 TCACATAAACTTAAAGTAAAGGG - Intergenic
980644905 4:135631271-135631293 TCACATAAACTTAAGATAAAGGG - Intergenic
981167884 4:141583320-141583342 TCACATAAACTTAAGATAAAGGG + Intergenic
981367113 4:143916250-143916272 TCACATAAACTTAAGGTAAAGGG + Intergenic
981376907 4:144026485-144026507 TCACATAAACTTAAGGTAAAGGG + Intergenic
981387410 4:144147835-144147857 TCACATAAACTTAAGGTAAAGGG + Intergenic
981760590 4:148190838-148190860 TCATATAAACTTAAAGTAAAGGG - Intronic
981825040 4:148930401-148930423 TCCCATAAACTTAAAGTAAAGGG + Intergenic
982050068 4:151491768-151491790 TCACATAAACTTAAGGTAAAGGG + Intronic
982119412 4:152127206-152127228 TCTCACAAACTTAAGGTAAAGGG - Intergenic
982299333 4:153863274-153863296 TCACATAAACTTAAGGTAAAGGG - Intergenic
982451239 4:155554381-155554403 TCACATAAACCTAAGGTAAAGGG + Intergenic
982451248 4:155554476-155554498 TCACATAAACCTAAGGTAAAGGG + Intergenic
982451257 4:155554571-155554593 TCACATAAACCTAAGGTAAAGGG + Intergenic
982487156 4:155979767-155979789 TCCCACAGACTTAAGGTAAAGGG - Intergenic
982491953 4:156040504-156040526 TCACAGAAACTTAAGGTAAAGGG + Intergenic
982679947 4:158417249-158417271 TCACATAAACTTAAAGTGGTGGG - Intronic
982829944 4:160046447-160046469 TCTCATAAACTTAAGGTAAAGGG + Intergenic
982960209 4:161826756-161826778 TCACATTAACTTAAGGTTAAGGG - Intronic
982991989 4:162287984-162288006 TCACGTAAACTTAAGGTAAATGG + Intergenic
983036036 4:162866936-162866958 TCACATAAACTTAAGGTAAAGGG + Intergenic
983072570 4:163286624-163286646 TCACATAAGCTTAAGGTAAAGGG - Intergenic
983277644 4:165637529-165637551 TCATATAAACTTAAGGTAAAGGG + Intergenic
983329276 4:166303610-166303632 TCACATAAACCTAAGGAAAAGGG + Intergenic
983406814 4:167341678-167341700 TGACATAAATTTAAGTTAAACGG + Intergenic
983477338 4:168229996-168230018 TCACATAAATTTAAGGGAAAGGG + Intronic
983749703 4:171251191-171251213 ACACATAAACTTAAGGTAAAGGG - Intergenic
983807639 4:172015411-172015433 TCATACAAACTTAAGGTAAAGGG - Intronic
983826076 4:172262488-172262510 TCACATAAATTTAAGGTAAAGGG - Intronic
983845401 4:172512304-172512326 TCATATAAACTTAAGGTAAGGGG - Intronic
984474937 4:180224077-180224099 TCACATAAACTTAAGGTAAAGGG - Intergenic
984721924 4:182980524-182980546 TCACATAAACTTAAAGTAAAGGG + Intergenic
985093102 4:186383711-186383733 TCACATACACTTGAAGTAAAGGG + Intergenic
985108073 4:186518644-186518666 TCACATAAACTTAAGGTGAATGG - Intronic
985240607 4:187927617-187927639 ACACATCAACTTAAGGTAAATGG - Intergenic
985355939 4:189118933-189118955 TCACATAAACTTAAGGTAAATGG + Intergenic
986259194 5:6128093-6128115 ACACGTAAACTTAAGGTAAAGGG + Intergenic
986513584 5:8535585-8535607 TACCATAAACTTGAGCTAGAAGG + Intergenic
986634227 5:9804015-9804037 TCACATAAACTTAAGGTAAAGGG + Intergenic
986870424 5:12038608-12038630 TTACATCAACTTAAAGTACAGGG + Intergenic
987030214 5:13970158-13970180 TCACATACATTTAAGGTAAAGGG - Intergenic
987436666 5:17903752-17903774 TCACATAAACTTAAGGTAATGGG - Intergenic
988002389 5:25365013-25365035 TCACATAAACATAAGGTAAAGGG + Intergenic
988278256 5:29111694-29111716 TCACATAAACTTAAGGTAAAGGG - Intergenic
988344803 5:30022942-30022964 TCACATAAACTTAAAGTAAAGGG + Intergenic
988361676 5:30243649-30243671 TCACTTAAAGTAAAGGAAGAGGG + Intergenic
988421011 5:31006262-31006284 TCACATAAACTTAAGGTAAAGGG - Intergenic
988652179 5:33164985-33165007 TCACATAAACTTAAGATAAAGGG - Intergenic
989027541 5:37084885-37084907 TCATATAAACTTAAGGTAAAGGG + Intergenic
989355288 5:40537514-40537536 TCACATAAACTTAAGGTAAAGGG - Intergenic
989533610 5:42538023-42538045 TCACATAAACTTAAAGTAAAGGG - Intronic
989534732 5:42550458-42550480 TGACATTAACTTAAGATAAATGG - Intronic
989694179 5:44180514-44180536 TCACATAAACTTAAGGTAAAGGG - Intergenic
990233537 5:53741125-53741147 TCACATAAGCTTAAAGTAAAGGG + Intergenic
990572965 5:57097200-57097222 TCACACAAACTTAACGTAAAGGG + Intergenic
990775933 5:59306254-59306276 CAACATAAACTTAAAGTAAAGGG - Intronic
990891653 5:60657156-60657178 TCATATAAACTAAAGGTAACGGG - Intronic
990899543 5:60735728-60735750 TCACATAAACTTAAGGTAAAGGG - Intergenic
991279306 5:64893516-64893538 GCACATAAACTCCAGGCAGATGG + Intronic
991414932 5:66382306-66382328 TCACATAAACTTAAGGTAAAGGG + Intergenic
991543357 5:67753925-67753947 TCACATAAACTTAAGGTAAAGGG + Intergenic
991623174 5:68567445-68567467 TCACATAAACTTAAGATAAAGGG + Intergenic
991924075 5:71686211-71686233 TCACATAAACTTGAGGTGAAGGG + Intergenic
992239678 5:74754487-74754509 TCAAATAAACTTAAGGTAAAGGG + Intronic
992335848 5:75768694-75768716 TCATGTAAACTTAAGGTAAAGGG - Intergenic
992339892 5:75812726-75812748 TCACATAAACTTAAGGTAAAGGG - Intergenic
992520353 5:77544443-77544465 TCACACAAACTTAAGGTAAAGGG + Intronic
993437076 5:87910889-87910911 TCAGATAAATTTAAAGGAGATGG - Intergenic
993606917 5:90002332-90002354 TCACATTAATTTAAGGTGAAGGG + Intergenic
993613968 5:90087031-90087053 GCACATAAACTTAAGATGAAGGG + Intergenic
993646295 5:90467539-90467561 TCACATGAACTTAAGGTAAAAGG - Intronic
993743474 5:91566803-91566825 TCACATGAACTGAAGGTAAAGGG + Intergenic
993883690 5:93392953-93392975 TCACATAAACTTAAAGTAAAGGG - Intergenic
993964943 5:94348591-94348613 TCACAGAAACTTAAAGAAAATGG + Intronic
994051116 5:95363866-95363888 TCACATAAACTTAAGGTAGAGGG - Intergenic
994304233 5:98182510-98182532 TCACATAAACTTAAAGTAAAGGG + Intergenic
994330070 5:98494101-98494123 TCACATAAACTTAAAGTAAAGGG + Intergenic
994358168 5:98818592-98818614 TCACATAAACTTAAGGTAAATGG + Intergenic
994398900 5:99254700-99254722 TCACATAAACTTAAGGTAAAAGG - Intergenic
994496748 5:100522167-100522189 TAACATCAACTGAAGGTAAAGGG + Intergenic
994645900 5:102468697-102468719 TCACACAAACTTAAAGTAAAAGG - Intronic
994777971 5:104059644-104059666 TCACATACACTTAAGGTAAAGGG - Intergenic
994887547 5:105583596-105583618 TCACATGAACTTAAGATAAAGGG + Intergenic
995187229 5:109284361-109284383 TCATATAAACTCAAGGTAAAGGG + Intergenic
995317706 5:110795491-110795513 TCAAAGAAACTTAAAGTAAAGGG - Intergenic
995450952 5:112300010-112300032 TCACATAAACTTGAGATAAAGGG - Intronic
995587735 5:113665820-113665842 TCACATAAACTTAAGGTAAAGGG + Intergenic
995694397 5:114863933-114863955 TCACATAAACTTAAGGTAAAGGG - Intergenic
995699123 5:114914196-114914218 TCATGTACACTTAAGGTAAAGGG + Intergenic
995722711 5:115153162-115153184 TCACAAAAACTTAAGGTAAAGGG + Intronic
995818020 5:116193450-116193472 TCACATAAACTGAAAGTAAAGGG + Intronic
996010957 5:118480968-118480990 TCACATAAACTTAAAGTAAAGGG + Intergenic
996110362 5:119558650-119558672 TCACATAAACATAAGGTAAATGG + Intronic
996141130 5:119911139-119911161 TCACATAAACTTAAGGTAAAGGG - Intergenic
996197992 5:120633496-120633518 TCACATAAACTTAAGGTAAAGGG + Intronic
996279625 5:121712942-121712964 TCACATAAACTTAAGGTAAAGGG + Intergenic
996304549 5:122032176-122032198 TCACATATACTGAAGGGAGGAGG - Intronic
996325605 5:122269317-122269339 TCACATAAACTTAAAGTAAAGGG + Intergenic
996326809 5:122284650-122284672 TCACATAAACTTAAGGTAAAAGG - Intergenic
996608817 5:125355659-125355681 TCACATAGACTTAAGGTAAAGGG - Intergenic
996632030 5:125644528-125644550 TCACATGAACTCAAGGTAAAGGG + Intergenic
996657289 5:125956204-125956226 TCACATAAACTCAAGGTAAAGGG + Intergenic
996678532 5:126204113-126204135 TCACATAAACTTAAGGTAAAGGG + Intergenic
996694726 5:126381554-126381576 TCACATAAACCCGAGGTAAAGGG - Intronic
996780059 5:127175670-127175692 TCACATAAACTTAAGGTAAAGGG - Intergenic
996835203 5:127783999-127784021 TCTCATAAACTTAAGGTAAAGGG - Intergenic
997058634 5:130475244-130475266 TCATAGAAATTTAAGGTAAAGGG - Intergenic
997105771 5:131017938-131017960 TCACATAAACTTAAGAAAAAGGG - Intergenic
997798152 5:136832283-136832305 TCACATAAACTTAAGGTAAAGGG - Intergenic
998008406 5:138673248-138673270 GCAAATAAACTCAAAGTAGAGGG - Intronic
998256314 5:140591478-140591500 GCACATAAGATTAAGGAAGAGGG + Intronic
998746260 5:145262964-145262986 TCTCATAAACTTAAGGATAAGGG + Intergenic
998758794 5:145409497-145409519 TCACATAAACTTAAGGCAAAGGG + Intergenic
998777030 5:145615272-145615294 TCACATAAACTTAAAGTAAAGGG - Intronic
999086299 5:148893673-148893695 TCACATAAACTTAAGGTAAAGGG + Intergenic
999108865 5:149097764-149097786 TCACATAAACTTAAGGTAAAGGG + Intergenic
999337712 5:150736890-150736912 TCACATAAACTTATGGTAAAGGG + Intronic
999490945 5:152051230-152051252 TCACATAAACTTAAGGTAAAGGG - Intergenic
999599686 5:153248422-153248444 TCACGTAAACTTAAGGTAAAGGG - Intergenic
999677287 5:154016903-154016925 TCACGTAAGCTTAAGGTAAAGGG + Intronic
999839116 5:155405129-155405151 CCACATAAACTTATGGTAAAGGG + Intergenic
999930602 5:156429376-156429398 TCACATAAATATAAGGTAAAGGG - Intronic
1000158861 5:158580032-158580054 TCACATAAAGTTAAGGTAAAGGG - Intergenic
1000237863 5:159379416-159379438 TCACATAAACTTAAGGTAAAGGG + Intergenic
1000264680 5:159623591-159623613 TCACACAAACTTAAGATAAAGGG + Intergenic
1000394841 5:160762838-160762860 TCACATAAACTTAAGATAAAGGG + Intronic
1000511419 5:162188366-162188388 TCACATAAACTTAAGGTAAAGGG - Intergenic
1000584624 5:163081692-163081714 TCGCATAAACTTAAGGTAAAGGG + Intergenic
1001166874 5:169376654-169376676 TCACATAAACTTAAGGTAAAGGG + Intergenic
1001176968 5:169479181-169479203 TCACATAAACTTAAGGTAAAGGG - Intergenic
1001290904 5:170458985-170459007 ACAAATAAACTTAAGGTAAAGGG + Intronic
1001693575 5:173652177-173652199 TCATATAAACTTAAGGCAAATGG - Intergenic
1001821492 5:174713800-174713822 ACACACATACTTAAGGAAGAAGG + Intergenic
1002814065 6:661928-661950 TCACATAAAGTTAAAGTAAAGGG + Intronic
1002893064 6:1353880-1353902 TCACATAAACTTAAGGTAAAGGG + Intergenic
1003029227 6:2587438-2587460 TCACATAAACTTAAAGTAAAAGG - Intergenic
1003297276 6:4842632-4842654 TCACATAAACTTAAGGTAAACGG - Intronic
1003465147 6:6372373-6372395 TCACATAAACTTAAGGCTAAGGG + Intergenic
1003582216 6:7350033-7350055 TCACATAAACTTAAAGTAAAGGG + Intronic
1003711780 6:8600926-8600948 TCACATAAACTTAAAGTACAGGG - Intergenic
1003934586 6:10962224-10962246 TCACAGAAATTTAAGGCACATGG + Intronic
1004096772 6:12562791-12562813 TCACATAAACTTAATATAAAGGG + Intergenic
1004888735 6:20076706-20076728 CCACATAAACTTAAGGTAAAGGG + Intergenic
1005072702 6:21876467-21876489 TCATACAAACTTAAAGTAAAGGG + Intergenic
1005107538 6:22240731-22240753 TCACATAAACTTAATGTAAAGGG + Intergenic
1005168135 6:22949523-22949545 GAACATAAACTTTAGGAAGATGG - Intergenic
1005244291 6:23863949-23863971 TCACATAAGCTTAAGGTAAAGGG + Intergenic
1005305542 6:24510669-24510691 TCACAGAAACTTAAGGTAAAGGG - Intronic
1005435356 6:25804659-25804681 TCATATAAACTCAAGGTAAAAGG + Intronic
1005691337 6:28309594-28309616 TCACATAAACTTAAGGTAAAGGG - Intergenic
1006062781 6:31437586-31437608 TCACATAAACTGAAGGTAAAGGG - Intergenic
1007191332 6:40021416-40021438 TTAGATAAGCTTTAGGTAGAAGG - Intergenic
1007891096 6:45292609-45292631 TCACACAAACTTAAGGCAGAGGG + Intronic
1008171887 6:48217966-48217988 TCACATAAATTTAAGGTAAAGGG + Intergenic
1008185588 6:48386717-48386739 TCACATAAACATAAAGTATAGGG - Intergenic
1008190478 6:48450618-48450640 TCACATAAACTTAAGGTAAAGGG - Intergenic
1008305515 6:49894177-49894199 TCACATAAACTTAAAGTAAAGGG + Intergenic
1008402140 6:51076439-51076461 TCACATAAAATTAAGGTGTGGGG - Intergenic
1008528428 6:52432062-52432084 TCATGTAAATTTAAGGTAAAGGG - Intronic
1008551473 6:52636336-52636358 TCACAAAAACTTGGGGTTGAGGG - Intergenic
1008667169 6:53727578-53727600 TCACATAATATTAAAGTAGAAGG + Intergenic
1008736108 6:54545995-54546017 TCACTTAAACTTAAGGTAAAGGG - Intergenic
1008775219 6:55030233-55030255 TCCCATAAACTTAAGGTAAAGGG - Intergenic
1008882719 6:56397093-56397115 TCATATAAACTCAAGGTAAAGGG + Intergenic
1008973379 6:57396516-57396538 TCACATAAACTTAAAGTGAGGGG - Intronic
1008974859 6:57413240-57413262 TAACAGAAACTTAGGGGAGAAGG + Intronic
1009163744 6:60314746-60314768 TAACAGAAACTTAGGGGAGAAGG + Intergenic
1009267278 6:61571195-61571217 TCACATAAACTTATGGTAAAGGG + Intergenic
1009332313 6:62439365-62439387 TCACATAAACTTAAGGTGAAGGG - Intergenic
1009360104 6:62801054-62801076 TCACATAAACTTAAGGTAAAGGG - Intergenic
1009389517 6:63129102-63129124 TCACATAAACTTAAGGTAAGGGG - Intergenic
1009495089 6:64336260-64336282 TCACATAAACTTAAAGGTGTAGG + Intronic
1009644569 6:66381537-66381559 TTACATAAACTTGAGGTAAAGGG - Intergenic
1009800061 6:68525992-68526014 TCACATAAACTTAAGGTAAAGGG - Intergenic
1009969039 6:70606797-70606819 TCACATAAACTTAAAGTAAAGGG + Intergenic
1010008806 6:71027052-71027074 TCACATAAACTGACAGTAAAGGG - Intergenic
1010045498 6:71438169-71438191 TCACATAAACTTAAGGTAAAGGG + Intergenic
1010054960 6:71554759-71554781 TCACATAAACTTAAGGTAAAGGG - Intergenic
1010076166 6:71801535-71801557 TCACATAATCTTAAAGTAAAGGG - Intergenic
1010220148 6:73441866-73441888 TCAAAAAAAAGTAAGGTAGATGG - Intronic
1010479674 6:76336232-76336254 TCACATAAACTTAATGTAAAAGG - Intergenic
1010492593 6:76493265-76493287 CCACCGAAACTTAAGGTAAAGGG + Intergenic
1010633493 6:78229203-78229225 TCACATAAACTTAAGGTAACAGG - Intergenic
1010707574 6:79133291-79133313 TCACGTAAACTTAAGGTAAAGGG - Intergenic
1010801689 6:80184307-80184329 TCACATAAACTTAAGGTAAAGGG - Intronic
1010817301 6:80373871-80373893 TCACATAAACTTAAGGTAAAGGG - Intergenic
1010862863 6:80935624-80935646 TCACATAAACTTAAGGTAAAAGG - Intergenic
1011005445 6:82639389-82639411 TCATATAAACTTCAGGTGAAGGG + Intergenic
1011093309 6:83631700-83631722 TCACACAAACTTAAGGTAAAGGG - Intronic
1011132932 6:84070929-84070951 TCACAAAAACTTAAAGTAAAGGG - Intronic
1011168834 6:84481269-84481291 TCACATAAACTTAAAATAAAGGG + Intergenic
1011210338 6:84949255-84949277 TCACATGAACTTAAGGTAAAGGG - Intergenic
1011225373 6:85099161-85099183 TCACATTAACTTAAGGTAAAGGG + Intergenic
1011233514 6:85189728-85189750 TCACATAAACTTAAAGTAAAGGG + Intergenic
1011319782 6:86078671-86078693 TCATAAAAACTTCAGGTAAAGGG - Intergenic
1011321012 6:86093592-86093614 TCACATAAGCTTAAAATAAAGGG - Intergenic
1011327348 6:86163739-86163761 TCACATAAACTTAAAGTATAGGG + Intergenic
1011328880 6:86182042-86182064 TCACATAAACTTAAAGTAGAGGG - Intergenic
1011365903 6:86582461-86582483 TCACATAAACCTAAGCTAAAGGG - Intergenic
1011373273 6:86663590-86663612 ACACATAAACTTAAGGTAAAGGG - Intergenic
1011394816 6:86895132-86895154 TCACAGAAACTTAAGGTAAAGGG + Intergenic
1011589150 6:88954260-88954282 TCACATAAACTTAAGGTAAAGGG + Intronic
1011620182 6:89235291-89235313 TCACATAAACTTAAGGTAAAGGG - Intergenic
1011696177 6:89915410-89915432 ACACATAGACTGAAAGTAGAGGG - Intergenic
1011789524 6:90883640-90883662 TCACATAAACTTAAAGTAAAGGG - Intergenic
1011833912 6:91406319-91406341 TTACATAAACTTAAGGTAAAGGG + Intergenic
1011923780 6:92616450-92616472 TCACATAAACTTAAAATAAAGGG - Intergenic
1012055355 6:94400154-94400176 TCACAAAAATTAAAAGTAGATGG - Intergenic
1012079632 6:94739040-94739062 TCAGATAAAAGTAAGGTAAATGG + Intergenic
1012156158 6:95821813-95821835 TCACATAAACATAAAGTAATGGG + Intergenic
1012204574 6:96444508-96444530 TCACATAATCTTAAGGTAAAGGG + Intergenic
1012208171 6:96487599-96487621 TCACATAAACTTAAGGTAAAGGG - Intergenic
1012684796 6:102232556-102232578 TCACATAAACTTAAAGTAAAGGG - Intergenic
1012793996 6:103736539-103736561 TCACATAAACTTAAAGTAAAGGG + Intergenic
1012848808 6:104423341-104423363 TCAAATAAACTTTAGGGAGAAGG + Intergenic
1012870042 6:104661494-104661516 ACACATAAATTTAAGGTAAAGGG + Intergenic
1012965840 6:105671693-105671715 TCACATAAACTTAAGGTAAAGGG + Intergenic
1013686251 6:112587450-112587472 TCACATAAACTTAAGGTAAAGGG - Intergenic
1013720865 6:113026763-113026785 TCACACAAACTTAAAGCAAAGGG - Intergenic
1013852445 6:114532797-114532819 TCACATAAACTTAAAGTAAAGGG - Intergenic
1013940885 6:115660433-115660455 TCACATAAACTTAAAGTAAAGGG + Intergenic
1013946246 6:115726435-115726457 TCACATAAACTTAAGGTAAAGGG - Intergenic
1013985347 6:116185731-116185753 TCACACAAACTAAAGGTAAAGGG - Intronic
1014235182 6:118946292-118946314 TCACATAAACTTAAGGTAAAGGG + Intergenic
1014278411 6:119414610-119414632 TTACATAAACTTAAGGGAGAGGG - Intergenic
1014284894 6:119486242-119486264 TCACAGAGACAGAAGGTAGAAGG + Intergenic
1014285240 6:119489449-119489471 TCACATAAACTTAAAGTAAAGGG + Intergenic
1014304645 6:119725641-119725663 TCACATAAACCTAAAGCAAAGGG - Intergenic
1014337028 6:120149326-120149348 TCACATAAACTTAAAATAAAGGG + Intergenic
1014420109 6:121233573-121233595 TCACATAAACTTAAGATAAAGGG - Intronic
1014421213 6:121247589-121247611 TCACATAAACTTGAGGTAAAGGG + Intronic
1014531188 6:122561780-122561802 TCACATGAACTTAAAGTAAAGGG - Intronic
1014532226 6:122572014-122572036 TCACATAAACTCATGGTTAAGGG + Intronic
1014532234 6:122572070-122572092 ACACATAAACTCATGGTAAAGGG + Intronic
1014581572 6:123143867-123143889 TCACATAAACTTAAGGTAAAGGG + Intergenic
1014604101 6:123450360-123450382 ACACATAAACTTAAAGGAAAGGG + Intronic
1014607733 6:123498659-123498681 AGACATAAGGTTAAGGTAGAAGG + Intronic
1014658441 6:124135400-124135422 TCACATAAACTTAAGGTAAAGGG + Intronic
1014739233 6:125127723-125127745 TCACATAAACTTAAAGAAAAGGG + Intronic
1015348058 6:132182518-132182540 TCACATAAACTTAAGCTAAAGGG + Intergenic
1015362171 6:132353005-132353027 TCACATAAACTTAAAGTAAAGGG - Intronic
1015565781 6:134569196-134569218 TCACATAAACTTAAAGTAAAGGG + Intergenic
1015663111 6:135598590-135598612 TCACATAAACTTAAAGTAAAGGG - Intergenic
1015849595 6:137558313-137558335 TCACATAAACTTAAAGGGGTGGG - Intergenic
1015877768 6:137841217-137841239 TCACATAAACTTAAAGTAAAGGG - Intergenic
1016018113 6:139206772-139206794 TCACATAGACTTAAGGTAAAGGG + Intergenic
1016176081 6:141078989-141079011 TCACATAAATTTTAGGTAAAGGG + Intergenic
1016197255 6:141359659-141359681 TCACATAAACTTAAAGTAAAGGG - Intergenic
1016351555 6:143174565-143174587 TCACATAAACTTAAGGTAAAGGG - Intronic
1016484851 6:144526546-144526568 TCACATAAACTTAAGGCAAAGGG - Intronic
1016909934 6:149188649-149188671 TCACATAAACTTAAGGTAAAAGG - Intergenic
1017190286 6:151646547-151646569 TCACATAAACTTAAAGTAAGGGG - Intergenic
1017310443 6:152969923-152969945 CAACAAAAACCTAAGGTAGAGGG - Intergenic
1017337434 6:153278294-153278316 TCACATAAACTTAGAGGTGATGG + Intergenic
1017556114 6:155571148-155571170 TCACATAAACTTAAGGTAAAGGG - Intergenic
1017704123 6:157105172-157105194 TCAAATAAACTCAAGGGAGATGG + Intronic
1018113481 6:160559697-160559719 TCACATAAACTTAAAGTAAATGG - Intronic
1018596962 6:165491027-165491049 TCACATAAACTTAGAGTAAAGGG + Intronic
1018781586 6:167072371-167072393 TCATATAAACTTATGATAAAGGG - Intergenic
1019122902 6:169818754-169818776 TCACATAAACTTAAGGTAAATGG - Intergenic
1020358386 7:7301771-7301793 GCTCATAAACTTAAAGTAAAGGG - Intergenic
1020596668 7:10214667-10214689 TAACATGAATTTAAGGTAGAAGG + Intergenic
1020613029 7:10424728-10424750 ACACATAAACTGAAAATAGAGGG - Intergenic
1020635100 7:10686834-10686856 TCATATAAACTTAAGGTAAATGG + Intergenic
1020995644 7:15260290-15260312 TTACATAAACTTAAGAGAAAGGG + Intronic
1021204487 7:17763673-17763695 TCACATAAACTTAAAGTAAAGGG + Intergenic
1021473895 7:21038559-21038581 TCACATAAACTTAAGTAAAGGGG - Intergenic
1023144566 7:37137043-37137065 TCACATAAATTTCAGGTAAAGGG + Intronic
1023516485 7:41007007-41007029 TGACATAAATTTAAAGAAGAAGG + Intergenic
1023657442 7:42439085-42439107 CCACATTAACTTAAGGTAAAGGG - Intergenic
1023692645 7:42807363-42807385 TCACATAAACTTAAGGTAAGGGG + Intergenic
1024174939 7:46829479-46829501 TCACACAAACTTAAGGTAAAGGG + Intergenic
1024327814 7:48125378-48125400 TGACATAAACTTAAGGTAAAGGG - Intergenic
1024367110 7:48533861-48533883 ACACATAAGCTTAAGGTAAAGGG - Intronic
1024419459 7:49146087-49146109 TCACATAAATTTAAGGTAAAGGG + Intergenic
1024455949 7:49606852-49606874 TCACATAATCTCAAGGTAAAGGG + Intergenic
1024669093 7:51575663-51575685 TCACATAAACATAAAGTAAAAGG - Intergenic
1024745166 7:52398113-52398135 TCACATAAACTTAAAATAAAGGG - Intergenic
1024782507 7:52867411-52867433 TTACATAAACTCAAGGTAAATGG + Intergenic
1024847617 7:53666457-53666479 TCACATAAACTTAAGGTAAAGGG - Intergenic
1024863243 7:53871245-53871267 TCATATAGACTCAAGGTAAAGGG + Intergenic
1024893501 7:54229473-54229495 TCCTATAAACTCAAGGTAAAAGG + Intergenic
1024900417 7:54312914-54312936 TCCTATAAACTCAAGGTAAAAGG - Intergenic
1025772971 7:64530437-64530459 TCACATAAAATTAAAGTAAAGGG + Intronic
1025820805 7:64961270-64961292 TCACATAAACTTAAGGTATTGGG + Intergenic
1027295575 7:76766027-76766049 TCACATAAACTTCAAGTAAAGGG + Intergenic
1027328834 7:77069868-77069890 TCACATAAACTTAAGGTAAAGGG - Intergenic
1027562997 7:79755978-79756000 TCACATAAACTTAAGGTGAAGGG - Intergenic
1027691518 7:81352818-81352840 TTGAATAAACTTAAGGTAAAGGG - Intergenic
1027699421 7:81451199-81451221 TCACATAAACTTAAAGTAAAGGG + Intergenic
1027948316 7:84779893-84779915 TCACGTAAATGTAAGGTAAAGGG + Intergenic
1027963677 7:84979199-84979221 TTGCACAAACTTAAGGTAAAGGG - Intergenic
1028182818 7:87746679-87746701 TCACATAAACTTAAAGTAAAGGG - Intronic
1028197376 7:87922533-87922555 TCACATAAACTTAAGGGAAAGGG + Intergenic
1028197990 7:87929028-87929050 TCACATAAACTTAAGGTAAAGGG + Intergenic
1028261866 7:88676049-88676071 TCACATAAACTTAAGGTAAAGGG + Intergenic
1028422124 7:90644936-90644958 AGACAAAACCTTAAGGTAGATGG + Intronic
1028529451 7:91822803-91822825 TTCCATAAACCTAAGGTAAAGGG - Intronic
1028792733 7:94871820-94871842 TCACATAAACTTAAGATGAAGGG - Intergenic
1028819321 7:95188348-95188370 TCACATAAACTTAAGGTAAAGGG - Intronic
1028822732 7:95231032-95231054 TCACATAAACTTAAGGTAAAGGG + Intronic
1028936673 7:96472604-96472626 TCACATAAACTTAAGGTAAAGGG - Intergenic
1028993255 7:97073330-97073352 TTGCATAAACTTAAAGTAAAGGG - Intergenic
1029786934 7:102801513-102801535 TCACATAAACTTAAGGTAAAGGG + Intronic
1029815745 7:103092706-103092728 GCACATCAACTTAAGATAGGTGG - Intronic
1030390251 7:108919204-108919226 TCACACAAACTTAAGGTAAAGGG - Intergenic
1030456064 7:109775082-109775104 TCACATAAACTTAAGGTATAGGG + Intergenic
1030533640 7:110739339-110739361 TCACATAAACTTAAGGTAAAGGG + Intronic
1030936198 7:115587165-115587187 TCACATAAACTTAAAGTAAAGGG + Intergenic
1030936623 7:115592946-115592968 ACACAGAAATTTGAGGTAGAGGG + Intergenic
1030972514 7:116077550-116077572 TCATATAAACTTAAGGTAAAGGG + Intronic
1031090241 7:117346111-117346133 TCACATAAACTTAAGGTAAAGGG - Intergenic
1031139070 7:117921155-117921177 TCACATAAACTTAAGGTAAAGGG + Intergenic
1031169263 7:118271832-118271854 TCACATAAACTTCAGGTAAAGGG - Intergenic
1031611762 7:123836445-123836467 TCATATAAACTTAAGGTAGAGGG - Intronic
1031740184 7:125419640-125419662 TCACATAAACTTAAGATAAAGGG + Intergenic
1031761064 7:125714184-125714206 TCACATAAACTTAAAGTAAAGGG - Intergenic
1031796725 7:126184604-126184626 TCATGTAAACTGAAGGTAAAGGG - Intergenic
1032288899 7:130568338-130568360 TCACATAAACTTAAGGTAAAGGG + Intronic
1032448719 7:132008029-132008051 TCACATAAATTTAAGGTAAAGGG - Intergenic
1032605083 7:133341898-133341920 TCACATAAATCTAAGGTAAAGGG - Intronic
1032661009 7:133983603-133983625 TTACATATACTTAAGCTAGAAGG + Intronic
1032999893 7:137492582-137492604 CCACAGAAACTTAAGCTGGAAGG + Intronic
1033027020 7:137784247-137784269 TCAGATAAATTTAAGGCAAAGGG + Intronic
1033259174 7:139827325-139827347 TCATGTAAACTTAAAGTAAAGGG - Intronic
1033623088 7:143079849-143079871 TCACATAAACTTAAGGTAAAAGG + Intergenic
1033961392 7:146918047-146918069 TTGCATAAACTTAAGGTAAAGGG - Intronic
1034019753 7:147628750-147628772 TCACATAAACTTAAGGTAAAGGG + Intronic
1034036011 7:147823157-147823179 GCACATGAATTCAAGGTAGAAGG - Intronic
1034247633 7:149660510-149660532 TCACATAAGCTTAAGGTAAAAGG - Intergenic
1034401945 7:150868148-150868170 TAACATCAACTGAAGGGAGAAGG + Intergenic
1034526042 7:151663233-151663255 TAACATAAAGTGAAGGTGGAAGG - Intronic
1034682993 7:152945177-152945199 TCATATAAACTTAAGGTAAAGGG - Intergenic
1034705305 7:153137711-153137733 TCACATAAACTTAAGGTAAAGGG - Intergenic
1035121743 7:156574040-156574062 TCACATAAACTTAAGATAAAGGG - Intergenic
1035343650 7:158183153-158183175 GCATATAAAGTTAAGGTAAAGGG - Intronic
1035451184 7:158977896-158977918 TCACAGAGACAGAAGGTAGAAGG - Intergenic
1035591254 8:816074-816096 TCACATAAACTTAAAATAAAGGG - Intergenic
1036076151 8:5503076-5503098 TCACAGAAACAGAAGGTAAAAGG - Intergenic
1036108600 8:5873357-5873379 TCACATAAACTCAAGGTAAAGGG - Intergenic
1037320634 8:17639127-17639149 TAACATAAACTTATGGTAAAGGG - Intronic
1038908947 8:31939696-31939718 TCACATCAACTTAAGATAAAGGG + Intronic
1039030294 8:33301461-33301483 TCACATAAACTTAAGGTAAAAGG + Intergenic
1039112368 8:34054152-34054174 TCACATAAACTTAGGGGTAAAGG + Intergenic
1039123783 8:34177479-34177501 TCACATAAACTTAAAGTAAAGGG + Intergenic
1039641676 8:39229473-39229495 TCATATACACTTAAAGTAAAGGG + Intronic
1039642550 8:39239701-39239723 TCACATAAACTTAAGGTAAAGGG + Intronic
1039763681 8:40606038-40606060 TCACATAAACTGAAGGTAAAGGG - Intronic
1039810310 8:41042174-41042196 TCACATAAACTTAAGGTAAAGGG - Intergenic
1039811332 8:41051274-41051296 TCACATAAACTTAAAGTAAAGGG + Intergenic
1040013672 8:42682943-42682965 TCACAGAAACAGAAAGTAGAAGG + Intergenic
1040352669 8:46584396-46584418 TCACCAAACCTTGAGGTAGAAGG - Intergenic
1040442634 8:47460527-47460549 TCAGATAAACTTAAGGTAAAGGG - Intronic
1040529164 8:48251988-48252010 TCATGTAAACTTAAGGTAAAGGG - Intergenic
1040635472 8:49268642-49268664 TCACATAAACTTAAAGTAAAGGG - Intergenic
1040800445 8:51333623-51333645 TCACATAAACTTAAAGTAAAGGG + Intronic
1040820340 8:51548953-51548975 TCACATAAACTTAAGGCAAAGGG + Intronic
1040867810 8:52068436-52068458 TTACATAAACTTAAGGTAAAGGG - Intergenic
1040989365 8:53333288-53333310 TCACATAAACTTAAGGTAAAGGG - Intergenic
1041150513 8:54927701-54927723 TCACATAAACTTAAGGTAAAGGG + Intergenic
1041227976 8:55718999-55719021 TCACATAAACTTAAAGTAAAGGG + Intronic
1041570343 8:59331266-59331288 TCACATAAACTTAAAGTAAAGGG - Intergenic
1041832221 8:62166824-62166846 TCACATAAACTGAATGTAAAGGG + Intergenic
1041877778 8:62710586-62710608 TCACATGAACTTAAAATAAAGGG - Intronic
1042084386 8:65091679-65091701 TCACATAAACTTAAGGTAAAGGG + Intergenic
1042122623 8:65505242-65505264 TCACATAAACTTAAAGTAAAGGG - Intergenic
1042160779 8:65892218-65892240 TCACATAAACTTAAGGAAAGGGG + Intergenic
1042431590 8:68712465-68712487 TCATATAAACTTAAGGTAAAGGG + Intronic
1042608177 8:70567578-70567600 TCACATAAACTTAAGTAAAGGGG + Intergenic
1042728835 8:71908705-71908727 TCACGTAAACTTAAGGTAAATGG - Intronic
1042740756 8:72042864-72042886 TCACAGAAACAAAAAGTAGAAGG + Intronic
1042768241 8:72350863-72350885 TCACATAAACTTAAGGTAAAGGG - Intergenic
1042897037 8:73681751-73681773 TCACATAAACTGAAGGTAAAGGG + Intronic
1042995716 8:74695585-74695607 TTACATAAATTTAAGGTAAAGGG + Intronic
1043040976 8:75261461-75261483 TCACACAAACTTAAGGTAAAGGG + Intergenic
1043048863 8:75360284-75360306 TCTCACCAACTTAAGGTAAAGGG + Intergenic
1043121479 8:76330877-76330899 ACACATAAACCTAAAGTAAAGGG - Intergenic
1043270899 8:78331554-78331576 TCACATAAACTTAAAGTAAAGGG + Intergenic
1043616568 8:82132240-82132262 TTACATAAACTTAAGGTAAAGGG + Intergenic
1043679100 8:82998918-82998940 TCACATAAAGTTAAGGTAAAGGG + Intergenic
1043816683 8:84810855-84810877 TCACATAAACTTAAAGTAAAGGG - Intronic
1043876176 8:85489397-85489419 TCACATAAACTTAAGGTAAAGGG - Intergenic
1043985648 8:86692592-86692614 TCACATAAACTTAAGGTAAAGGG - Intronic
1043988037 8:86716994-86717016 TCACATAAACTTAAGGTAAAGGG + Intronic
1044227799 8:89738799-89738821 TCACATAAACTTAAAGTAAAGGG + Intergenic
1044584469 8:93856717-93856739 TTAGATAAACAGAAGGTAGAAGG - Intergenic
1044651123 8:94497038-94497060 TCACATACACTTATGGTAGAGGG + Intronic
1044657144 8:94560736-94560758 TCACATAAACTTAAGGTAAAGGG - Intergenic
1044788058 8:95817294-95817316 CTACATAAACTTAAGGCAAAGGG - Intergenic
1044879665 8:96711190-96711212 TCTAATAAACTCAAGGTAAAGGG - Intronic
1044903526 8:96974145-96974167 TCACGTAAACTTAAGATGAAGGG + Intronic
1044907438 8:97019501-97019523 TCACATAAACTTAAGGTAAACGG + Intronic
1044947685 8:97406225-97406247 TCACATAAACTTAAAGTAAAGGG - Intergenic
1045095045 8:98788552-98788574 TCACATAAACTTAAGCTAAAGGG + Intronic
1045122109 8:99049026-99049048 TCACATAAACTTAAGGTAAAGGG - Intronic
1045700003 8:104855169-104855191 TTACATAAAGTTGAGATAGAAGG + Intronic
1045780023 8:105851646-105851668 TCACATAAACTTAAAGTAAAGGG + Intergenic
1045814095 8:106259665-106259687 TCACGTAAACTTAAGGTAAAGGG - Intergenic
1045878129 8:107006333-107006355 TCACATAAACTTAAGGTAAAGGG + Intergenic
1046033711 8:108815605-108815627 TCACATAAACTTAAGGTGAAAGG - Intergenic
1046075565 8:109307748-109307770 TCACATAAACTTAAGGTAAAAGG + Intronic
1046448837 8:114360320-114360342 CCACATAAACTTAAGGTAAAGGG + Intergenic
1047383998 8:124392406-124392428 TCTTATAAACTCAAGGTAAAGGG - Intergenic
1047592204 8:126338479-126338501 TCACATAAACTTAAGGTAAAGGG + Intergenic
1047607094 8:126486133-126486155 TCACATAAACTTAAGGTAAAGGG - Intergenic
1047798161 8:128279257-128279279 TCACATAAACTTAAGGTAAATGG + Intergenic
1047890252 8:129301084-129301106 TCACATAAACTTAAGGTAGAGGG - Intergenic
1047937227 8:129794615-129794637 TCACATAAACTCAAGGTAAAGGG - Intergenic
1048120241 8:131572487-131572509 TCATGTAAACTTAAGGTAAAGGG - Intergenic
1048530847 8:135248982-135249004 TCACATAAACTTAAGGTAAAGGG - Intergenic
1049295782 8:141836237-141836259 TCCCATAAACTTAAAGTAAAGGG - Intergenic
1049897899 9:127544-127566 TCACATAAACTTAAGGTAAAGGG - Intronic
1050133419 9:2437388-2437410 TCACATAAACTTAAAGTAAAGGG - Intergenic
1050147583 9:2585476-2585498 TCACATAAACTTAAAGTAAAGGG + Intergenic
1050502893 9:6317133-6317155 TCACATAAAATTAAAGTAAAGGG + Intergenic
1050936088 9:11397220-11397242 TCACATAAACTTAAGGTTAAGGG + Intergenic
1050972124 9:11891412-11891434 TCACATAAACTTAAGATAAATGG - Intergenic
1050987945 9:12106439-12106461 TCACATAAACTTAAGGTAAAGGG + Intergenic
1051277731 9:15413651-15413673 TCACATAAACTTTAGATAAAGGG - Intergenic
1051362886 9:16296716-16296738 TCACAAAACCTTAAAGTAAAGGG + Intergenic
1051601160 9:18876106-18876128 TCACATAAACTTAAGGTAAAGGG - Intronic
1051651152 9:19326535-19326557 CCAAGAAAACTTAAGGTAGAGGG + Intronic
1051733391 9:20171491-20171513 TCACATAAACTTAAGGCAAAGGG + Intergenic
1051816752 9:21117623-21117645 TCACATAAACTTCAGGTAAAGGG - Intergenic
1051881356 9:21843040-21843062 TCACAAAAACTTAAGGTAAAAGG + Intronic
1052006470 9:23355811-23355833 TCACATAAACTTAAGGTAAAGGG - Intergenic
1052053019 9:23870052-23870074 TTACATAAACTTATGGTAATGGG + Intergenic
1052218511 9:25994471-25994493 TCACATAAACTTAAGGTAAAGGG + Intergenic
1052307428 9:27026111-27026133 TCACATAAACTTAAGGTAAAAGG + Intronic
1052537327 9:29763424-29763446 TCACATAAACTTAGAGTAAAGGG + Intergenic
1052550072 9:29937071-29937093 TCACATAAACTTAAGGTAAAAGG - Intergenic
1052695613 9:31873487-31873509 GCACATTAACTTAATGTTGAAGG - Intergenic
1052731271 9:32289418-32289440 TCATATAAACTTAAAGTAAAGGG - Intergenic
1053107070 9:35418963-35418985 TTATATAAACTCAAGGTAAAGGG + Intergenic
1053126752 9:35587290-35587312 TCACATAAACTTAAGGTAAAGGG + Intergenic
1053559365 9:39174168-39174190 GGACAGAAACTTTAGGTAGAGGG + Intronic
1053740979 9:41137837-41137859 TCACATAAACTTAAGGTAAAGGG - Intronic
1053823480 9:41994408-41994430 GGACAGAAACTTTAGGTAGAGGG + Intronic
1054137746 9:61444778-61444800 GGACAGAAACTTTAGGTAGAGGG - Intergenic
1054443967 9:65293980-65294002 TCACATAAACTTAAGGTAAAGGG - Intergenic
1054486306 9:65727526-65727548 TCACATAAACTTAAGGTAAAGGG + Intronic
1054607093 9:67192957-67192979 GGACAGAAACTTTAGGTAGAGGG - Intergenic
1054687370 9:68293460-68293482 TCACATAAACTTAAGGTAAAGGG + Intronic
1054711514 9:68515784-68515806 GCAAATAAACTTAAGCTAGAAGG + Intronic
1054714494 9:68543497-68543519 TCACATAAATTTTATGTAAAGGG - Intergenic
1054844620 9:69780760-69780782 TCACATAAACTTAAGGTAAAGGG - Intergenic
1055125137 9:72710708-72710730 TCACATAAAGTTGAGGTAAAAGG - Intronic
1055138104 9:72846196-72846218 TCACATAAACTTAAGGTAAAGGG + Intergenic
1055156503 9:73068833-73068855 TCACATAAACTTAAGGTAAACGG + Intronic
1055186954 9:73468843-73468865 TCACATAAACTTAGAGTAAAGGG - Intergenic
1055493672 9:76832649-76832671 TCACCTAAAAAAAAGGTAGAAGG + Intronic
1055846726 9:80573894-80573916 TCACATAAACTTAAGGCAAATGG + Intergenic
1055855393 9:80680159-80680181 TCATTTAAACTTAATGTAGCTGG + Intergenic
1055905601 9:81290627-81290649 CCACATAAACTTAAAGAAAAAGG - Intergenic
1056025807 9:82494192-82494214 TCACATAAACTTAGGGTAAAGGG - Intergenic
1056026874 9:82506900-82506922 TCACATAAACTTAAGGTAAAGGG + Intergenic
1056309632 9:85326302-85326324 TCACATAAACTTAAGGTAAAGGG + Intergenic
1056339448 9:85611066-85611088 TCTATTAAACTTAAGGCAGATGG + Intronic
1056396895 9:86189476-86189498 TCACATAAACTTAAGGTAAGGGG + Intergenic
1056671871 9:88636915-88636937 TCCTATAAACTTAAGATAAAAGG - Intergenic
1056696395 9:88858152-88858174 TCACATAAACTTAAGGTAAAGGG + Intergenic
1056698843 9:88885266-88885288 TCACATAAACTTAAAGTAAAGGG - Intergenic
1056874062 9:90311167-90311189 TCACATAAGTTTAAGGAAGAAGG - Intergenic
1056948265 9:91019598-91019620 TCACATAAACTTAAGGTAAAGGG + Intergenic
1057004021 9:91539825-91539847 TCGCATAAACTTAAAGTAAAGGG + Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057119255 9:92556699-92556721 TCACATACACTTAAAGTAAAGGG - Intronic
1057285518 9:93750377-93750399 TCATATAAACTCAAAGTAGAGGG - Intergenic
1057340331 9:94195454-94195476 TCATATAAACTCAAGGTAAAGGG - Intergenic
1057475907 9:95401281-95401303 TCACATAAACTTAAGGTAAAGGG + Intergenic
1057643079 9:96846468-96846490 TCATATAAACTCAAGGTAAAGGG + Intronic
1058198082 9:102003310-102003332 GCCCATAAACTTCAGGCAGAAGG - Intergenic
1058540501 9:106007498-106007520 TTGCACAAACTTAAGGTAAAGGG - Intergenic
1058784369 9:108372606-108372628 TCACATAAACTTAAGGTAAAGGG - Intergenic
1059032880 9:110719363-110719385 TAACATAAACTTAAGGTAAAGGG + Intronic
1059609384 9:115876481-115876503 CCACATAAACTTAAAGTAAATGG - Intergenic
1060311005 9:122462282-122462304 TCACATACACTTAAGGTCAAGGG - Intergenic
1060314262 9:122494547-122494569 TCACATACACTTAAGGTAAAGGG - Intergenic
1186238367 X:7539244-7539266 ACACATAAACTGAAAGTAAAGGG + Intergenic
1186308617 X:8292086-8292108 TCATATAAACTTAAGGTAAAAGG + Intergenic
1187109089 X:16277465-16277487 TCACATAAACTTAGGGTAAAGGG - Intergenic
1187589048 X:20695429-20695451 TCACATAAACTTAAGGTAAAGGG + Intergenic
1187748576 X:22435393-22435415 TCACATAAACTTAAAGTAAAGGG + Intergenic
1187752002 X:22477082-22477104 TCACATAAACTTAAGGTATGGGG - Intergenic
1188040326 X:25364459-25364481 TCACACAAACTTAAGGTAAAGGG - Intergenic
1188045689 X:25424215-25424237 TTGCATAAACTTAAAGTAAAGGG - Intergenic
1188389168 X:29598896-29598918 TCACATAATCTTAAGGTAAAGGG - Intronic
1188956412 X:36439475-36439497 TCATATAAACTTAAGGTAAAAGG + Intergenic
1189218367 X:39346885-39346907 TCACATAAACTTAAAGTAAAGGG + Intergenic
1189603346 X:42650394-42650416 TCATATAAACTTAAAGTAAAGGG + Intergenic
1189639127 X:43048894-43048916 TCACATAAACTTAAGGAAAAGGG - Intergenic
1189663058 X:43324398-43324420 TCACATAAACTTAAGGTAAAGGG - Intergenic
1189878954 X:45469337-45469359 TCACATAAACTTAAAGTAAGGGG - Intergenic
1189931913 X:46021365-46021387 TCACATAAACTTAAGTAAAAGGG + Intergenic
1189945807 X:46177436-46177458 TCACATAAACTTAAGGTAAAGGG - Intergenic
1189954514 X:46263645-46263667 TCAAATAAACTCAAGGAAAACGG + Intergenic
1189962243 X:46334765-46334787 TCACATAAACTTAAAGGAAAGGG + Intergenic
1190449136 X:50559999-50560021 TCACATAAACTTAAAGTAAAGGG + Intergenic
1190897129 X:54631631-54631653 TCACATAAACTTAAGGTAAAGGG - Intergenic
1190955733 X:55191334-55191356 TCATATAAATTCAAGGTAAAAGG - Intronic
1191008348 X:55735479-55735501 TCTTATAGACTTAAGGCAGATGG - Intronic
1191045513 X:56131760-56131782 ACACATAAACTTAAGGTAAAAGG + Intergenic
1191067505 X:56366294-56366316 TCACATAAACTTAAAGTAAAGGG - Intergenic
1191077106 X:56466938-56466960 TCACAGAAACTTAAGGTAAAGGG - Intergenic
1191100469 X:56721206-56721228 ACAAATAAACTTAAGGTAAAGGG + Intergenic
1191179781 X:57548701-57548723 ACACATAAATTTAAGGTAAAGGG + Intergenic
1191270736 X:58464678-58464700 TCACATAAACACTAGATAGAAGG + Intergenic
1191741711 X:64442953-64442975 TCATATAGACTTAAGGTAAAGGG + Intergenic
1191784348 X:64901660-64901682 ACTCATAAACTTAAGGTAAAGGG - Intergenic
1191787445 X:64932223-64932245 TCATGTAAGCTTAAGGTAAAGGG - Intronic
1191804950 X:65125834-65125856 TCACATAAACTTAAGATAAAGGG - Intergenic
1191806856 X:65145334-65145356 TCACACAAACTTAAGGTAAAGGG - Intergenic
1191819953 X:65294625-65294647 TCACATAAAGTTAAGGTAAAGGG + Intergenic
1191879497 X:65830659-65830681 TTATATAAACTTAAGGTAAAGGG + Intergenic
1191903383 X:66062543-66062565 TCACATAAACTTAAAATAAAGGG - Intergenic
1191909246 X:66130247-66130269 CCATATAAACTTTAGGTAAAGGG - Intergenic
1191913766 X:66179947-66179969 TCACATAAACTTAAAGTCAAGGG - Intronic
1191917421 X:66217811-66217833 TCACATAAACTTAAGGTAAAAGG + Intronic
1191945021 X:66524182-66524204 TCACATAAACTTAAGGTAAAGGG - Intergenic
1191954357 X:66627405-66627427 TCACATAACCTTAAAGAAAAGGG + Intronic
1191970746 X:66813521-66813543 TTACATAAAATTAAGGTAAAGGG - Intergenic
1191994270 X:67074065-67074087 TCACATAAACTTAAAGTAAAGGG + Intergenic
1192009136 X:67249685-67249707 TTGCATAAACTTAAGGTAAAAGG + Intergenic
1192013547 X:67301928-67301950 TCACATAGACTGAAGGTGAAGGG + Intergenic
1192014429 X:67314144-67314166 TCACATAAACTTAAAGTAAAGGG - Intergenic
1192021755 X:67400887-67400909 TCACATAAACTTACAGTAAAGGG - Intergenic
1192065297 X:67879008-67879030 TCACATGAAATTAAGGTAAGTGG + Intergenic
1192164166 X:68814844-68814866 TCACAAAAACTTAAGGTAAAAGG + Intergenic
1192193579 X:69014074-69014096 TCACATAAACTAGAAGTACAAGG + Intergenic
1192609845 X:72556527-72556549 TTACATAAACTGAAGGTAAAGGG + Intronic
1192673828 X:73173891-73173913 TTATATACACTTAAGGTAAAGGG - Intergenic
1192688458 X:73333003-73333025 TTACATAAACTTGAGGTAAAAGG - Intergenic
1192820426 X:74638928-74638950 TCACATAAACTTAAAGTAAAGGG + Intergenic
1192869244 X:75170441-75170463 TCACATAAACTTAAGATAAAGGG - Intergenic
1192878330 X:75255636-75255658 TCACATAAAATGAAGGTAAAGGG + Intergenic
1192885431 X:75332673-75332695 TCATATAGACTCAAGGTACAAGG - Intergenic
1192904762 X:75539510-75539532 TCACATAAACATAAGGTAAAGGG - Intergenic
1192913451 X:75630243-75630265 TCACAAAAATTTAAAGTAAAGGG - Intergenic
1192970096 X:76219471-76219493 TCACAAAAACTTAAAGTAAAAGG - Intergenic
1192978810 X:76316956-76316978 TCTCATAAACTTAAAGTAAAAGG - Intergenic
1192991676 X:76465735-76465757 TCACAGAAACTTAAGGTAAAGGG - Intergenic
1192994936 X:76503616-76503638 TCACATAAACTTAGAGTAGAGGG - Intergenic
1193062933 X:77225305-77225327 GCACATATACTTAAGGTAAAGGG + Intergenic
1193077212 X:77366821-77366843 TCACATAAACTTAAAGTAAAGGG + Intergenic
1193078148 X:77377122-77377144 TCACATAAACTTAAGGTAAAGGG + Intergenic
1193154863 X:78161157-78161179 TTACATAAACTTAAAGTAAAGGG + Intergenic
1193185724 X:78509763-78509785 TCACATAAACTTAAGATAAAAGG + Intergenic
1193255562 X:79344465-79344487 TCATATAAACTTAAGGTAAAGGG + Intergenic
1193289856 X:79760081-79760103 TCACATAAACTTAAGGTTAAGGG - Intergenic
1193405080 X:81090880-81090902 TCATATAAACTTAAAGTAAAGGG + Intergenic
1193415511 X:81218116-81218138 TCATATGAACTTAAGGTAAAGGG - Intronic
1193469725 X:81885657-81885679 TCACATAAACTTAAAGGAAAGGG - Intergenic
1193590159 X:83379595-83379617 TCACATAAACTTAAAGTAAAGGG - Intergenic
1193590888 X:83387496-83387518 TCACAGAAACTTAAGGTAAAGGG + Intergenic
1193618869 X:83725957-83725979 TCACATAAACTTAAGGTAAAGGG + Intergenic
1193632038 X:83901353-83901375 TCACACAAACTTAAGGCAAAGGG + Intergenic
1193690605 X:84636773-84636795 TCACATAAACTTAAAGTAAAGGG + Intergenic
1193721778 X:84995417-84995439 ACACATAGACTGAAGGTAAAAGG + Intergenic
1193723412 X:85014188-85014210 TCACATATACTTAAGGTAAAGGG - Intronic
1193775765 X:85640128-85640150 TCACATAAACTTAAGGTAAAGGG - Intergenic
1193785820 X:85758761-85758783 TCACATACACTTAAGGTAAAGGG - Intergenic
1193791829 X:85823669-85823691 TCACACAAACTTAAGGTAAAGGG + Intergenic
1193817363 X:86120287-86120309 TCATATAAACTTAAGGTGAAGGG - Intergenic
1193918029 X:87390966-87390988 TCACATAAACTAGAAGTACAGGG - Intergenic
1193924634 X:87468380-87468402 TCAAATAAACTTAATGTAAAGGG + Intergenic
1194040114 X:88930339-88930361 TCATATAAACTTCAAGTAAAGGG - Intergenic
1194058587 X:89167610-89167632 TCACATAAACTTAAGGTAAAGGG + Intergenic
1194103425 X:89736696-89736718 TCACAAAAACTTAAGGTAAAGGG - Intergenic
1194144524 X:90246221-90246243 TCATATAAACTCAAGGTAAAGGG + Intergenic
1194168277 X:90549783-90549805 TCACATTAACTTAAGGTAAAGGG + Intergenic
1194181770 X:90718825-90718847 TCACATAAACTTAAGGTAAAGGG + Intergenic
1194191806 X:90846611-90846633 TCACATAAATTTCAGGTAAAGGG - Intergenic
1194232159 X:91337574-91337596 TCACATAAACTTAAGGTAAAGGG + Intergenic
1194237392 X:91401055-91401077 TCACTTAAACTTAAGGTAAACGG + Intergenic
1194262881 X:91718659-91718681 TCATATAAACTTAAGGTAATGGG + Intergenic
1194278402 X:91915464-91915486 TCACATAAACTTAAGGTAATGGG + Intronic
1194354051 X:92858471-92858493 TCACATGAACTTAAAGTAAAGGG + Intergenic
1194381297 X:93194416-93194438 TCATATAAACTTCAGGTAAAGGG + Intergenic
1194470067 X:94283485-94283507 TGACATAAACTTAAGGTAGAGGG - Intergenic
1194543270 X:95201657-95201679 TCACATAAACTTAAAATAAAAGG - Intergenic
1194547480 X:95255865-95255887 TCCCATAAACTTAAGATAAAGGG - Intergenic
1194553968 X:95334866-95334888 TCACAAAAACTTAAAGTAAATGG + Intergenic
1194557073 X:95372810-95372832 TCATATAAACTCAAGGTAAATGG + Intergenic
1194573921 X:95587843-95587865 TCTCTTCAATTTAAGGTAGAAGG - Intergenic
1194596557 X:95866272-95866294 TCATACAAACTCAAGGTAAAAGG + Intergenic
1194606420 X:95984658-95984680 TCACATAAACTTAAGGTAAAGGG - Intergenic
1194617099 X:96118422-96118444 TCATATAAACCTAAGGTAAAGGG + Intergenic
1194630465 X:96276423-96276445 TCACATAAACTTAAGGTAAAAGG + Intergenic
1194868084 X:99094351-99094373 TCACATAAACTTAAGGTAAAGGG - Intergenic
1194882382 X:99270194-99270216 TCACAGAAACTTAAAGTAAAGGG - Intergenic
1194926721 X:99834706-99834728 TCACATAAACTTAAAGGGGTGGG - Intergenic
1194967541 X:100305694-100305716 TCACATAAACTTAAGGTAAAGGG + Intronic
1195019313 X:100810877-100810899 TCACATAAACTTAAAATAAAGGG - Intergenic
1195231788 X:102857599-102857621 TCATATAAACTTAAGGTAAAGGG - Intergenic
1195237318 X:102913466-102913488 TCACATAAACTTAAGGTAAAGGG + Intergenic
1195818232 X:108911816-108911838 TCACATAAACTTACGGTAAAAGG + Intergenic
1195855429 X:109326866-109326888 TCACATAAACTTAAGGTTAAAGG + Intergenic
1195972558 X:110489680-110489702 TCATATAAACTTAAGGTAAAGGG - Intergenic
1195984973 X:110619905-110619927 TCACAAAAACTTAAGGTAAAGGG - Intergenic
1196024195 X:111022812-111022834 TCACATAAACTTAAGGTAAAGGG + Intronic
1196161517 X:112489285-112489307 TCACAGAAACTTAAAGTAAAGGG + Intergenic
1196171091 X:112589341-112589363 TCACATAAACTTAAAGTAAAGGG + Intergenic
1196219092 X:113090190-113090212 TCACATAAACTTAAAGTAAAGGG + Intergenic
1196224977 X:113156090-113156112 TCGCACAAACTTAAGGTAAAGGG - Intergenic
1196477873 X:116110175-116110197 TCACACAAACTTAAGGTAAAGGG - Intergenic
1196484701 X:116192131-116192153 ACACATAAACTTAAGGTGAAGGG - Intergenic
1196590301 X:117479693-117479715 TCACATAAACTTAAAGTAAAGGG - Intergenic
1196599147 X:117582047-117582069 CCATATAAACTCAAGGTAAAGGG - Intergenic
1196737715 X:118994310-118994332 TCACATAAACTTGAAGTAAAGGG + Intronic
1196948019 X:120848139-120848161 TCACACAAACTTAAGGTACAGGG - Intergenic
1196994496 X:121366796-121366818 TCACATAAGCTTAAGGTAAAGGG - Intergenic
1197054456 X:122099564-122099586 TCACATAAACTTAAGGTAAAGGG - Intergenic
1197055307 X:122111888-122111910 TCACATAAACTCAAGGCAAAGGG - Intergenic
1197066038 X:122235457-122235479 TCAAATAAACTTAAAGTAAATGG - Intergenic
1197081557 X:122424605-122424627 TCACATAAACTTAAGGTAAAGGG - Intergenic
1197132646 X:123022266-123022288 TTACATAAACTTAAAGTAAAGGG + Intergenic
1197363770 X:125538287-125538309 TCACATAAACTAAAGGTAAAGGG + Intergenic
1197393113 X:125893466-125893488 TCACATAAACTTAAAATAAAGGG - Intergenic
1197463601 X:126773466-126773488 TCACATAAACTTAAGGTAATGGG + Intergenic
1197471995 X:126875557-126875579 TTACATAAACTTAAGGTAAAGGG - Intergenic
1197504106 X:127280192-127280214 TCACATAAACTTAAGGTAAAGGG + Intergenic
1197515351 X:127421268-127421290 TCACATAAGCTTAAGGTAAAGGG - Intergenic
1197519112 X:127474999-127475021 TCACATAACCTTAAAGTAAAAGG + Intergenic
1197545458 X:127818158-127818180 TCACATAAACTTAAGGTAAAGGG + Intergenic
1197556607 X:127963471-127963493 GCACATAAACTTAATATAAAGGG - Intergenic
1197571982 X:128161359-128161381 TCACATAAACTTAAGGTAAAGGG - Intergenic
1197574264 X:128189848-128189870 TCACATAAACTTAAGGTAAAGGG + Intergenic
1197604040 X:128563507-128563529 TCACATAAACTTAACGTAAAGGG + Intergenic
1197664415 X:129208573-129208595 TCACATAAACTTAAGGTGAAGGG - Intergenic
1197668884 X:129254074-129254096 TCGCATAAATTTAAAGTAAAGGG - Intergenic
1197881950 X:131176218-131176240 TAACTCAAACTTAAGGCAGAAGG + Intergenic
1197911186 X:131483940-131483962 TCACATAAACTTAAGGTAAAGGG + Intergenic
1198559680 X:137836083-137836105 TCACATAAACTTAAGGTAAAGGG - Intergenic
1198583086 X:138088537-138088559 TGACATAAACTTAAGGTAAATGG + Intergenic
1198604300 X:138320299-138320321 TCACATAAACTTAAAGTAAAGGG - Intergenic
1198616643 X:138465130-138465152 TCATATAAACTTAAGGTAAAGGG + Intergenic
1198649816 X:138850074-138850096 ACACATAAGCTCAAGGGAGAGGG + Intronic
1198696057 X:139339542-139339564 TCACATAAACTTAAGGTAAAGGG - Intergenic
1198712666 X:139522831-139522853 TCACATAAACTTAAGGTAAAGGG + Intergenic
1198797082 X:140408776-140408798 TCACATAAACTTAAGGTAAAGGG - Intergenic
1198836646 X:140812847-140812869 TCGTATAAACTTAACGTAAAGGG - Intergenic
1198943060 X:141980094-141980116 TCACATAAACTTAAGATAAAGGG - Intergenic
1199057639 X:143317238-143317260 TCACATAAACTTAAAGTAAAGGG - Intergenic
1199065761 X:143416350-143416372 TCATATAAATTCAAGGTAAAGGG - Intergenic
1199077405 X:143539903-143539925 TCATATAAACTCAAGGTAAAGGG + Intergenic
1199121809 X:144063057-144063079 TCATATAAACTTAAGGTAAAGGG + Intergenic
1199218388 X:145288241-145288263 ACACATAAACTAAAAGTAAAGGG - Intergenic
1199306727 X:146275906-146275928 TCACAAAAAATTAAGGTGAAAGG - Intergenic
1199323126 X:146464150-146464172 TCATATAAACTCAAGGTAAAGGG - Intergenic
1199521306 X:148739497-148739519 CCACATAAACTTCAAGTAAAGGG - Intronic
1199821540 X:151454053-151454075 TCACATAAACCTAAAGTAAAGGG + Intergenic
1199926522 X:152472147-152472169 TCATAAAAACTTAAAGTAAAGGG + Intergenic
1200317907 X:155153690-155153712 TCACATCAACTTAAGGTAAAGGG - Intergenic
1200490280 Y:3815526-3815548 TCATATAAACTCAAGATAAAGGG + Intergenic
1200514523 Y:4127563-4127585 CCACATTAACTTAAGGTAAAGGG + Intergenic
1200528393 Y:4300741-4300763 TCACATAAACTTAAGGTAAAGGG + Intergenic
1200538449 Y:4429045-4429067 TCACATAAATTTCAGGTAAAGGG - Intergenic
1200595737 Y:5137544-5137566 TCACATAAACTTAAGGTAATGGG + Intronic
1201408748 Y:13676102-13676124 TCATAAAAACTTAAGGTAAATGG + Intergenic
1201475635 Y:14378107-14378129 TCACCAAAACTTGAGGTAAAGGG + Intergenic
1201934560 Y:19394183-19394205 TCACATAAACTTAAAGTAAATGG - Intergenic
1202036228 Y:20639439-20639461 TCACATAAACTTAAGGTTAATGG - Intergenic