ID: 1104526480

View in Genome Browser
Species Human (GRCh38)
Location 12:129528215-129528237
Sequence GTGTTTTTCTTAAGGATAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104526480_1104526483 13 Left 1104526480 12:129528215-129528237 CCAATTATCCTTAAGAAAAACAC 0: 1
1: 0
2: 0
3: 35
4: 326
Right 1104526483 12:129528251-129528273 CCATTCACTATCTGTAATCACGG 0: 1
1: 0
2: 0
3: 15
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104526480 Original CRISPR GTGTTTTTCTTAAGGATAAT TGG (reversed) Intronic
902162346 1:14541393-14541415 GTGTTTTTCTTAATAAAAATGGG - Intergenic
903584850 1:24405752-24405774 GGGTATTTCGTAATGATAATGGG - Intronic
903639002 1:24844855-24844877 GTTTTTTTCTGGAGGAGAATTGG + Intergenic
905882560 1:41474247-41474269 GTGTCTTTCTCAAGGACAATTGG - Intergenic
906150863 1:43586931-43586953 GTGGTTTCCTTAAAGACAATGGG + Intronic
906283890 1:44573265-44573287 TTGTTTATCTTGAGGATAATGGG + Intronic
906998525 1:50825447-50825469 GTCTTTTTCATAATGATAAAAGG + Intronic
908768831 1:67577606-67577628 CTGTTTAACTTAAGGAGAATGGG + Intergenic
909241097 1:73214326-73214348 CAGTTTTTATTAAGGGTAATTGG - Intergenic
909754819 1:79211954-79211976 GTCTTTATCTTAAGAACAATGGG + Intergenic
910424636 1:87108336-87108358 GTGCTTCTCTTAAGGATTCTAGG - Exonic
911682614 1:100734874-100734896 GTTTATTTCTTAAGGATTCTTGG + Intronic
914708698 1:150193156-150193178 TTGTTTTTCTTAAGCATTTTGGG - Intergenic
914898111 1:151695154-151695176 GTGTGTTTCTCAAGGTTAACAGG + Exonic
914995521 1:152540114-152540136 GAGTCATTCTTAAGGAAAATGGG + Intronic
915003008 1:152610788-152610810 AAGTTATTCTTAAGGAAAATGGG - Intergenic
915050136 1:153060523-153060545 GGGTTTTTTTTAAGCATTATTGG + Intergenic
915747522 1:158175931-158175953 GTATTTTTCTTCATGGTAATTGG + Intergenic
916150267 1:161781552-161781574 TTGTTTTTCTTAATGGCAATGGG + Intronic
917318246 1:173751685-173751707 GTGTTTTTCTTCAGGGTTATGGG - Intronic
918628463 1:186685979-186686001 GTGTTTTTTGAAAGGAGAATTGG + Intergenic
918905865 1:190492718-190492740 GAGTTTTTCTTAAACATTATGGG + Intergenic
919935806 1:202249954-202249976 GGCTTTGTCTTCAGGATAATTGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922773665 1:228205007-228205029 GTTTTTTTTTTAAGCATAAGGGG - Intronic
1063699959 10:8374754-8374776 TTGTTTTTCCTAAGGACTATTGG - Intergenic
1064069593 10:12215801-12215823 GTGTCTTTCCTAAGCTTAATTGG + Exonic
1064656947 10:17565919-17565941 CTGTTTTTCTTTATGATATTGGG - Intergenic
1065061334 10:21904604-21904626 CTTTTTTTCTTAAGGATGCTGGG - Exonic
1065097948 10:22301080-22301102 TTGTTTTTCTTCAGTATAAGAGG + Intergenic
1065420060 10:25533312-25533334 ATTTTTTTCTTAAGGTTAACAGG - Intronic
1068876811 10:62005817-62005839 GTTGTTTTGTTAAGGATCATGGG + Intronic
1070270524 10:74950167-74950189 ATTTTTTTCTAAAAGATAATTGG - Intronic
1070939378 10:80329867-80329889 CTGTTTTTATTAAGGATATGGGG - Intergenic
1071661842 10:87512026-87512048 CTGTTTTCCTAAAGGAAAATGGG - Intronic
1072173685 10:92893945-92893967 GTATTTTTCTTAAAGAAAGTTGG + Intronic
1073576131 10:104626408-104626430 GTTTTTTTTTTAAAGAAAATTGG - Intergenic
1074005839 10:109422253-109422275 TTGTTTTTCTTCAAGATCATAGG - Intergenic
1074021101 10:109584251-109584273 GTTTATTTCATAATGATAATAGG - Intergenic
1074697562 10:116064403-116064425 ATGTTTCTGTTAAAGATAATAGG + Exonic
1074934158 10:118161093-118161115 TTATTTTTTTTAAAGATAATGGG - Intergenic
1076623068 10:131805209-131805231 TTGTTATTATTAAGGATAAAGGG + Intergenic
1076901967 10:133343870-133343892 ATGTTTTCCCTAAGAATAATTGG + Intronic
1078275810 11:9844979-9845001 GTGATGTACTTAAGGATAAAGGG + Intronic
1079364690 11:19799062-19799084 GACTTTATCTTGAGGATAATAGG + Intronic
1079584388 11:22107691-22107713 GAGATTTTATTAAGGAGAATTGG - Intergenic
1079670280 11:23160326-23160348 GTGATTTTTTTCAGGCTAATAGG + Intergenic
1079748264 11:24160513-24160535 GGGAGTTTATTAAGGATAATTGG - Intergenic
1080319200 11:30986941-30986963 GTATTTTTCTTAGGGACAGTAGG - Intronic
1080415843 11:32069186-32069208 GCATTTTTCTTAAAGATAAATGG + Intronic
1083100532 11:60300877-60300899 GTGGTTTTCTTTAAGATAATTGG + Intronic
1083561631 11:63677619-63677641 GGCTTTGTCTTAAGAATAATGGG - Intergenic
1085224853 11:74910637-74910659 GAGTTTATCTTTAGGATAGTGGG + Intronic
1086852376 11:91825104-91825126 GTGTTTTTCAGATGGATCATAGG + Intergenic
1087810920 11:102608298-102608320 GTTTTTCCCTTAAGGAAAATTGG + Intronic
1089764951 11:120756459-120756481 GGGGTTTTCTTTAGGATACTAGG - Intronic
1094045991 12:26167743-26167765 GAGTTTTTCTGAAGTAGAATTGG + Intronic
1095846349 12:46749548-46749570 GTTAGTTTGTTAAGGATAATAGG - Intergenic
1096367098 12:51037299-51037321 GTCTTTTTCTTGAAGAGAATGGG - Intergenic
1096436846 12:51598895-51598917 ATGTATTTCTTAAGGAAAAGGGG - Intronic
1097589719 12:61559682-61559704 GTTTTTTTCTTACTGATTATAGG - Intergenic
1098928755 12:76384350-76384372 ATGTTTTTCTTATGTTTAATAGG - Exonic
1099023969 12:77442522-77442544 ATTTTTTTCTTAAAGATAATTGG - Intergenic
1099613701 12:84910286-84910308 GTGTTTTTTTTTAGGATGACAGG - Intronic
1100002317 12:89852094-89852116 GAGTGTATCTTAAGGATAAAAGG + Intergenic
1100675469 12:96861947-96861969 GTGTTTTTCTAAAGCTAAATTGG + Intronic
1101019292 12:100536249-100536271 GTGTATTTCTTAGGAATAAATGG - Intronic
1101463774 12:104925820-104925842 GAGTGTTTCTTCAGAATAATTGG + Intronic
1101556622 12:105816239-105816261 GTATTTTTCTTAAGAAAATTTGG - Intergenic
1104232440 12:126898405-126898427 GTGATTTTCTTAAGAATGAGTGG + Intergenic
1104526480 12:129528215-129528237 GTGTTTTTCTTAAGGATAATTGG - Intronic
1107342006 13:39417552-39417574 GAATTTTGCTTAAGGAAAATTGG - Intronic
1110159792 13:72361767-72361789 GTTTTTTTCTTAAGAAGAAAAGG - Intergenic
1110193687 13:72760990-72761012 GTGGTTCTCCTAAGGAGAATAGG + Intronic
1110412524 13:75220090-75220112 ATTTTCTTCTCAAGGATAATTGG - Intergenic
1111558120 13:89908168-89908190 GTGTTTTTGTTAAGGAACACAGG + Intergenic
1112669444 13:101617321-101617343 AAGTTTCTTTTAAGGATAATTGG + Intronic
1112916618 13:104558867-104558889 GTGAGTTTGTTGAGGATAATAGG + Intergenic
1113550839 13:111192041-111192063 GGGTTTTTCTTCAGGATCAGTGG + Intronic
1114808061 14:25860863-25860885 GTGTTATTCTTAATAATCATAGG - Intergenic
1114932050 14:27484680-27484702 GTGTGTTTCTCAATCATAATAGG + Intergenic
1115228699 14:31134031-31134053 TTTTTTTTTTTAAGGAGAATGGG - Intronic
1116621423 14:47208916-47208938 GTGTTTTTCATAAAGATAGAAGG - Intronic
1116697993 14:48201201-48201223 GGGTTTTTCTTCAGGATCAGTGG - Intergenic
1117083193 14:52172643-52172665 GTGTTTTAATTAAGGAGATTTGG - Intergenic
1117429201 14:55635864-55635886 GTGTTTTTCTTAAGTCTTGTTGG + Intronic
1117572548 14:57062241-57062263 GTTTTTTTCTTCTGGAAAATGGG + Intergenic
1117630159 14:57682892-57682914 GTGTTTTAGTTACAGATAATAGG + Intronic
1117857807 14:60053680-60053702 GTGTGTTTTGTTAGGATAATTGG + Intronic
1119109000 14:71953717-71953739 GTATTTTTCTTATTCATAATTGG - Intronic
1119888316 14:78163157-78163179 ATGTTTTTCTTAATGCTATTAGG + Intergenic
1120046660 14:79815463-79815485 TGGTTTTTCTTAAGGGTAAGGGG + Intronic
1121031086 14:90659293-90659315 GTGTTTTTTTTTAGGAGAAAGGG + Intronic
1121773687 14:96576073-96576095 TTTTTTTTTTTAAGGATTATGGG - Intergenic
1123133985 14:106010837-106010859 GTGGTTTTCTTTGGGATACTTGG + Intergenic
1123159279 14:106262161-106262183 GTGTTTTTCTAAAGGACATTAGG - Intergenic
1123584014 15:21741272-21741294 GTGGTTTTCTTTGGGATACTTGG + Intergenic
1123620664 15:22183875-22183897 GTGGTTTTCTTTGGGATACTTGG + Intergenic
1123676797 15:22717477-22717499 GTGTTTATATTCAGGTTAATTGG - Intergenic
1123763331 15:23449522-23449544 GTGGTTTTCTTAAGTTTAATTGG - Intergenic
1124329014 15:28791752-28791774 GTGTTTATATTCAGGTTAATTGG - Intergenic
1126036485 15:44550862-44550884 GTCCTTTTCTTTAGGATAACTGG + Exonic
1126241903 15:46454542-46454564 GTGCTTCTCTCAAGGAAAATGGG + Intergenic
1126355548 15:47791717-47791739 TTGATTTTCTCAAGTATAATAGG + Intergenic
1127012419 15:54644609-54644631 GTCTTTTTCTTTAAGGTAATGGG - Intergenic
1127013464 15:54656058-54656080 GTCTTTATCTTAAAGACAATAGG - Intergenic
1127315259 15:57788749-57788771 ATGTTTTCCATATGGATAATAGG - Intergenic
1129815593 15:78550462-78550484 GTGTTGTTCCTAAGCATAAGAGG - Exonic
1130736546 15:86556416-86556438 GTGTTTTTCATATAGAGAATGGG - Intronic
1132890980 16:2204727-2204749 GTGTTTTTTTAAAGGCTAACCGG + Intronic
1133091725 16:3409849-3409871 TTGTTATTCTTAAAGCTAATGGG - Intronic
1134241690 16:12511482-12511504 GTGTTTCTCGTAACAATAATAGG - Intronic
1135498035 16:22969678-22969700 GTGTTTTTCTGAATGCTGATCGG - Intergenic
1138290321 16:55841165-55841187 CTGTTTTTTTTTAGGATAATTGG - Intergenic
1138374328 16:56552296-56552318 GGGTGCTTCTTAAGAATAATTGG - Intergenic
1139240549 16:65387653-65387675 TAGTGTTTCTTAAGGACAATAGG - Intergenic
1140292247 16:73670754-73670776 CTTTTTTCCTTAAGGATTATGGG + Intergenic
1140690842 16:77481989-77482011 TTGTTTTTCATAAGCATAATGGG + Intergenic
1140713484 16:77700400-77700422 GTTTTTTTCTTATGAAAAATTGG - Intergenic
1146536476 17:33657149-33657171 GTGTCGTTCGTAAGGAGAATGGG - Intronic
1146626223 17:34437508-34437530 GTGTTTTTAATATGGAGAATGGG - Intergenic
1148516338 17:48221720-48221742 GTGGATTTCTTAAAGATACTCGG - Intronic
1149184599 17:53982465-53982487 TAGTTTTGCTGAAGGATAATAGG - Intergenic
1149210326 17:54293210-54293232 GGGTTTTTCTTCAGGATCATTGG - Intergenic
1150091611 17:62331337-62331359 TTTTTTATCTTAAAGATAATGGG + Intergenic
1150233236 17:63570705-63570727 TTGTTTTTCATAGGGAAAATGGG + Intronic
1151107644 17:71636164-71636186 GTTTTTTGCTTAAAGATACTTGG - Intergenic
1152483440 17:80572460-80572482 GTGTTTTTCTTACTGATTTTAGG + Intronic
1153205708 18:2698099-2698121 TTGTTTTTCTAAATGATTATCGG + Intronic
1153395138 18:4611137-4611159 GTCTTTATCCTAAAGATAATGGG - Intergenic
1153507738 18:5819690-5819712 GTTTTTTTCTCAAGGAGAACAGG - Intergenic
1153509055 18:5832704-5832726 GTGTTTTTCGAAAGGATGCTAGG - Intergenic
1153533686 18:6077709-6077731 TTTTTTTTTTTAAGGAAAATGGG - Intronic
1153808406 18:8730942-8730964 CTGCTTTTCTTAAAAATAATTGG + Intronic
1155398541 18:25413675-25413697 GTGGTTTTCTTAAAGGAAATGGG + Intergenic
1155643823 18:28053358-28053380 GTTATCTTCTTAAGCATAATAGG - Intronic
1155758931 18:29540106-29540128 GTGATTTTCTTAATGATATTTGG - Intergenic
1156130716 18:33970509-33970531 GTGTATTTCTTCAGAATCATTGG - Intronic
1157181594 18:45503200-45503222 GTGTTTGTTTTTAGGATATTAGG + Intronic
1157952097 18:52050674-52050696 GTATTTTTCTCAAGGAAATTTGG - Intergenic
1158325930 18:56314004-56314026 GTGTTTTTATTGTGGTTAATGGG - Intergenic
1158982008 18:62772344-62772366 TTATTTTTTTTAAGCATAATTGG + Intronic
1159666349 18:71166056-71166078 ATGTTTTCATAAAGGATAATAGG + Intergenic
1161548472 19:4896869-4896891 GTGTTTTGCTTTCAGATAATTGG - Exonic
1165562770 19:36694919-36694941 TTTTTTTTTTTAAGGATATTTGG + Intronic
927319438 2:21725240-21725262 TTTTTTTTCCTAAGGATATTTGG - Intergenic
928228196 2:29473528-29473550 GTATTTTTCTTAATGATTTTAGG - Intronic
928555774 2:32423413-32423435 GAGTTTTTGTTTAGGATGATGGG - Intronic
929435868 2:41927861-41927883 GAGCTTTTCTTAAGGCTAATTGG + Intergenic
930062718 2:47303815-47303837 ATGTTTTTCCTGAGAATAATGGG + Intergenic
930421215 2:51154811-51154833 GTGTTTTTCTCAACGATAGCAGG + Intergenic
931620720 2:64206828-64206850 GTTTTTTTCTCAAGCACAATGGG - Intergenic
931930391 2:67127081-67127103 GTGGTTGTCTTCAAGATAATAGG - Intergenic
932902269 2:75713245-75713267 GTGTGTTTCTTTTGGAAAATTGG + Intergenic
932920130 2:75903632-75903654 GTGTTTTTATTACTGATAACAGG - Intergenic
935419302 2:102850822-102850844 TTGTTTTTCCTAAGGCTATTTGG + Intergenic
935532348 2:104250023-104250045 GTGTTTTTCTTCAAGATCTTGGG + Intergenic
938168646 2:129055926-129055948 GTGTGTCACTTACGGATAATGGG - Intergenic
938681499 2:133696387-133696409 CTGTTTTTCTCAAGGAAAAAGGG + Intergenic
940532290 2:154893832-154893854 CTGTTTTTCCTATGGCTAATGGG + Intergenic
941099800 2:161282965-161282987 GTTTTTCTTTTAAGAATAATCGG - Intergenic
941364652 2:164595432-164595454 TTGTTTTTCTTGAGGACATTAGG + Intronic
942162919 2:173211120-173211142 GTCTTTGTCTTAAGAGTAATGGG - Intronic
944398517 2:199298120-199298142 GTATTAATCTTAAGGATAAAGGG - Intronic
944980409 2:205112267-205112289 TTGCATTTCTTAATGATAATAGG + Intronic
945425880 2:209700772-209700794 GTGTTTATCTTTATGATAAGAGG - Intronic
946206171 2:218110465-218110487 GGGTTTTTCTTCAGGATCAGTGG + Intergenic
1169389309 20:5176540-5176562 ATATTTTTCTTAAGTATAATGGG + Intronic
1169972255 20:11280568-11280590 CTGTTTTTCTTTAGGAACATTGG + Intergenic
1169993544 20:11530457-11530479 TTGTTTTTTTAAAGGATAAATGG + Intergenic
1170188841 20:13623674-13623696 GTGTTTATATTCAGGTTAATTGG + Intronic
1171335563 20:24382299-24382321 GAGTTTTTCTTAAAAATAATTGG + Intergenic
1173755271 20:45510283-45510305 TTCTTTTTCTTAAGGTAAATCGG + Intergenic
1174730183 20:52908500-52908522 GTGTTTTTTTTTAGGATACTTGG + Intergenic
1174947555 20:55005018-55005040 GTGTTATTCTTAAGTGAAATGGG + Intergenic
1175338619 20:58213285-58213307 GTGTTTGTCTAAATGTTAATGGG + Intergenic
1175481803 20:59316888-59316910 TTGTTTTTTCTAAGGATATTTGG + Intronic
1175857555 20:62130571-62130593 GTGTTTTCCTTAACGTTAGTTGG - Exonic
1177806273 21:25878045-25878067 GTATTTATCTTATGAATAATTGG - Intergenic
1179118783 21:38523156-38523178 GTGTGTTTTTTAAGAATGATAGG - Intronic
1181505333 22:23352345-23352367 TTTTTTTTTTTAAGGATAATTGG + Intergenic
1181619990 22:24084422-24084444 TTTTTTTTTTTAAGTATAATGGG + Intronic
1181835261 22:25600924-25600946 GTGTATTTCATAATGATCATGGG + Intronic
949842339 3:8333549-8333571 GTTTTTATCTTAAGAACAATAGG + Intergenic
950729157 3:14941697-14941719 GTGTCAATCTTAAGGATAAGAGG - Intergenic
952209858 3:31219334-31219356 TTGTTTGTCTGAAGGATAAATGG + Intergenic
953334733 3:42084707-42084729 GGGTTCTTCTTGAGGATTATAGG + Intronic
955017784 3:55088786-55088808 TTTTTTTTCTTAAGTACAATGGG - Intergenic
955057441 3:55469213-55469235 GTTATTTTCTTAGGGATACTTGG - Exonic
955529547 3:59858760-59858782 GTATATATATTAAGGATAATGGG + Intronic
956173562 3:66452473-66452495 TTGGTTTTCTTAAGGATTGTTGG - Intronic
956817833 3:72924506-72924528 GTCTTTTTCTTAAGGGCAGTGGG + Intronic
957221912 3:77393320-77393342 GTGTTTTTCCAAAAGAAAATAGG - Intronic
957606692 3:82408426-82408448 GTTTTTTGCTTAAAGATAATAGG - Intergenic
958517508 3:95137066-95137088 GTGTTTTTCTCAAGAATACAAGG - Intergenic
959081214 3:101803154-101803176 GTATTTTTGTTAAGGATATCTGG + Intronic
959711344 3:109388931-109388953 ATTTTTTTCTTGAGGATTATAGG + Intergenic
959806921 3:110565908-110565930 CTTTTTTTCTTAAAGATCATAGG + Intergenic
960158017 3:114317764-114317786 CCGTTTTTCTTAAGGATTGTGGG - Intergenic
963488118 3:145963009-145963031 GTGGTTATCTCAAGGATAAGTGG - Intergenic
963944200 3:151127618-151127640 ATTTTTTTCTTAATGAAAATTGG + Intronic
964335990 3:155654852-155654874 GAGTTTTTCCTAAGGGTAATTGG - Intronic
964459238 3:156904334-156904356 GTATTTTTCTTGAGGATAAGGGG - Intronic
964704630 3:159604762-159604784 GTGTTTCTCATAAGAATATTTGG + Intronic
965050965 3:163646762-163646784 TTTTTTTTCCTCAGGATAATGGG + Intergenic
967281771 3:187830106-187830128 GTTTTTTTCTCAAGAGTAATGGG - Intergenic
967459022 3:189723747-189723769 ATGTATTTCTTAAGGATACCTGG - Intronic
969097574 4:4745260-4745282 CTGATTTTCTTATGAATAATAGG - Intergenic
969946851 4:10792015-10792037 GTGATTGTTTTAAGGACAATGGG - Intergenic
969989062 4:11241683-11241705 GTAAATTTATTAAGGATAATGGG + Intergenic
971388630 4:26164763-26164785 GTGTTTTTCTACTGGAAAATGGG + Intronic
971465502 4:26954678-26954700 GCTTTTTTCTTTAGGATACTGGG + Intronic
972937739 4:44159382-44159404 ATTTTTTTCTTAAGGACAATGGG - Intergenic
974053407 4:56962166-56962188 GGGTTTTTATTAAGGAAAAATGG - Intergenic
974434417 4:61839012-61839034 TTGTTTTTGTTAAGGAAACTTGG + Intronic
974527161 4:63059566-63059588 GGGTTTTTCTTCAGGATCAGTGG - Intergenic
975788221 4:77917675-77917697 GTATTTTTCTTGAGGAAAAAAGG - Intronic
975887925 4:78987642-78987664 AAGCTTTTCTTAAAGATAATTGG + Intergenic
977107465 4:92906574-92906596 GTGTCTTTTTTAAGGATGAAAGG - Intronic
977550467 4:98436881-98436903 GTGTTTATCCTGAGGATACTGGG + Intronic
977552056 4:98452506-98452528 ATGCTTTTCATAAGGATGATGGG - Intergenic
978377222 4:108087572-108087594 GTTTTTCTCTCAAGAATAATAGG - Intronic
978668278 4:111212690-111212712 GTGTTCATCTGAAGGAGAATGGG - Intergenic
978988972 4:115054024-115054046 GTATTTCTCTAAATGATAATAGG + Intronic
979132558 4:117066017-117066039 TTGTTTTTTATTAGGATAATGGG + Intergenic
980809028 4:137851921-137851943 CTGTTTTACTTCAGGATATTGGG + Intergenic
980831466 4:138133813-138133835 GTGTTTCTCTAAATGAAAATGGG + Intergenic
982126823 4:152190899-152190921 GGCTTTTTCTTAAGGCCAATGGG + Intergenic
982259525 4:153482181-153482203 GTTTTTTTCTTAAAGAGGATGGG + Intronic
983145861 4:164214454-164214476 GGGTTTTTTTTTAGAATAATGGG - Intronic
984395830 4:179198885-179198907 ATGTGTTTATAAAGGATAATTGG - Intergenic
984591114 4:181618802-181618824 GTGTTTTGCTTCTGGAAAATAGG + Intergenic
984694276 4:182763991-182764013 TTGTTTGTGTTAAGGAGAATGGG - Intronic
987241999 5:16009667-16009689 GTGATTCTTTTTAGGATAATGGG + Intergenic
987425137 5:17764517-17764539 GTGTGTTTCTTACGGGGAATAGG - Intergenic
988125100 5:27022273-27022295 GAGTTTTTTTAAAGGATCATTGG + Intronic
988708020 5:33744455-33744477 GTCTTTATCCTAAGGGTAATGGG + Intronic
988961795 5:36378350-36378372 GTTCTTTTCATAAGGATAACAGG + Intergenic
989265129 5:39464629-39464651 GTTTTTATCTTAAGGACAAAGGG - Intergenic
989459187 5:41677610-41677632 GTGGTTTTCTTAAACACAATTGG - Intergenic
990751161 5:59018012-59018034 GCATTTTACTTAAGGATACTGGG + Intronic
990901959 5:60761123-60761145 GTTTTCTTCTTTATGATAATGGG + Intronic
990982343 5:61613524-61613546 ATGTTTTTCTGAGGGAGAATTGG + Intergenic
992766947 5:80010178-80010200 GACTTTGTCTTAAGGGTAATGGG - Intronic
993247526 5:85469341-85469363 GGGTTTTTATTACGGATAGTGGG + Intergenic
993426198 5:87767218-87767240 GTGTGTTTTTTAAGTAAAATAGG - Intergenic
993472711 5:88325384-88325406 GTGTTTTTTTTAAGGAGACCAGG + Intergenic
993759352 5:91773443-91773465 GTGTATTTTTTAAGTATATTGGG + Intergenic
994008537 5:94871779-94871801 GTGTTTTATGTAGGGATAATGGG - Intronic
994068268 5:95568248-95568270 TTGTTTTTCTTAAGCATTAAAGG + Intronic
994100691 5:95888958-95888980 GTATTTTTCTTCATGGTAATTGG + Exonic
994231121 5:97311559-97311581 GGGTTTTTCTTCAGGATCAGTGG + Intergenic
994733262 5:103520035-103520057 GTGTTTTTTTTAAAGATACATGG - Intergenic
995689338 5:114806112-114806134 GTATTTTTCTTGGGGTTAATGGG + Intergenic
995929886 5:117427761-117427783 GTTTTTTTCTTAAAGAAAAGAGG - Intergenic
996322396 5:122233281-122233303 GTGTATTTCTGAAGGAAAATTGG + Intergenic
997072918 5:130639699-130639721 GGGTTTTTCTTCAGGATCAGTGG - Intergenic
998112085 5:139510050-139510072 GGGTTTTTCTTCAGGATCAGTGG - Intergenic
998520572 5:142796757-142796779 GATTTTTTCTAATGGATAATGGG + Intronic
998742708 5:145223073-145223095 GACTTTTTCTTAAAGACAATGGG + Intergenic
998972932 5:147611927-147611949 GTCTTTTTATGAATGATAATGGG + Intronic
999050156 5:148514461-148514483 GTATTTTTCTTAAGGATTGAAGG + Intronic
1001225324 5:169939949-169939971 GTGTCTTGCTTAAGGATAGTTGG + Intronic
1001498633 5:172209916-172209938 GTTTTTTTCTTAAGCAGATTTGG - Exonic
1003264486 6:4553315-4553337 GTGATTTTCATACGTATAATGGG + Intergenic
1003744481 6:8984563-8984585 TTATTTTTATGAAGGATAATTGG + Intergenic
1004248867 6:14005931-14005953 GTGTTTCTATTAATGATGATGGG + Intergenic
1004828533 6:19450942-19450964 GTTTTTTTTTTAAGGATTGTGGG - Intergenic
1005764660 6:28999108-28999130 TTGTTTTACTTTAGGAGAATGGG + Intronic
1007330444 6:41102813-41102835 ATGTGTTCCTTAAGGATAAGAGG - Intergenic
1007352721 6:41285686-41285708 ATGTTTTTCTGAAGGAGAACTGG - Intronic
1009474124 6:64066484-64066506 CTTTTTTTCTTAAAGGTAATGGG - Exonic
1011374446 6:86674656-86674678 GAGTTTTTCTTCAGGATCAGTGG + Intergenic
1011889642 6:92141424-92141446 GTCTTTCTCTCCAGGATAATAGG + Intergenic
1013157570 6:107508113-107508135 GTGTTTTTATTAGGGAAGATAGG + Intronic
1013360953 6:109393589-109393611 GTCTTCATCCTAAGGATAATGGG - Intronic
1013612821 6:111811016-111811038 GTGTTTTACTAAAGAATAATTGG + Intronic
1013875083 6:114815691-114815713 TTGTTTTTTTTAAAGAGAATTGG - Intergenic
1015455450 6:133422223-133422245 GTGTTTTTCTCAAGGAGCAATGG - Intronic
1015527846 6:134190659-134190681 TTGATTTTCTTGAGGATTATAGG + Intronic
1017272814 6:152529163-152529185 GAGTGTTTCATAAGGATAAAAGG - Intronic
1017617981 6:156265429-156265451 CTTTTTTTCTATAGGATAATGGG - Intergenic
1017771362 6:157647116-157647138 GTATTTTTCTTAAAGAAAACGGG - Intronic
1018226923 6:161637701-161637723 TTTTTTTTTTTAAGGATAAAAGG - Intronic
1021001689 7:15339717-15339739 GTATTTTCTTTAAGGATAAAGGG - Intronic
1022049902 7:26656349-26656371 GTATTTTTCTTTTGGATATTAGG + Intergenic
1022073438 7:26940963-26940985 GTGTTTTTCTGAAGCAAATTAGG - Intronic
1022213051 7:28230670-28230692 GTGTTTTTCTTAATCACAATAGG - Intergenic
1022874320 7:34513067-34513089 GTGTTTTACTAAGGGATACTAGG - Intergenic
1023428275 7:40062715-40062737 GTGTTTTTAGTTAGGATTATAGG + Intronic
1023674937 7:42619083-42619105 TTGTTTTTCATGAGGTTAATAGG + Intergenic
1025534360 7:61929701-61929723 GTTTTTTTTCTAGGGATAATCGG - Intergenic
1026319611 7:69257352-69257374 GGGTGTTTCTTAATGATACTAGG + Intergenic
1027391781 7:77711066-77711088 TTGTTTTTCTAAATGATAATCGG - Intronic
1027736295 7:81936818-81936840 GTATTTCTCTTTAGGAAAATAGG + Intergenic
1027791643 7:82643190-82643212 GGGTTTTTCTTCAGGATCAGTGG - Intergenic
1028037175 7:85999427-85999449 GTCTCTTTCTTCAGGATAGTAGG + Intergenic
1028070808 7:86447806-86447828 ATGTTTTTGTCAAGGATAGTTGG - Intergenic
1028696444 7:93718524-93718546 GTGTTATTTTTAGGGAAAATAGG + Intronic
1029107137 7:98187207-98187229 CTGCTTTTCTAAAGGAAAATGGG - Intronic
1029177172 7:98673048-98673070 GTGTTTCTTATAAGGATACTCGG + Intergenic
1029231346 7:99071637-99071659 GGTTTTTTCTTAAGTATTATAGG + Intronic
1031034769 7:116776550-116776572 ATGTTTTTCTGCAGGAGAATAGG + Intronic
1031785559 7:126027130-126027152 TTTTGTTTCTTAAGCATAATTGG + Intergenic
1032587068 7:133156712-133156734 GTGTTTTTATAAAGTAGAATTGG + Intergenic
1033010888 7:137621605-137621627 GTGATTTTTGTAAGGATAATAGG - Intronic
1033053529 7:138028487-138028509 CTGTTTTTCTTAAGGGTTCTCGG + Intronic
1033886737 7:145957952-145957974 TTGTATTTTTTAAGGATAATAGG + Intergenic
1036669766 8:10775043-10775065 GGGTTTTTCTTGAGTAGAATTGG - Intronic
1037691889 8:21188182-21188204 TTTTTTTTCTTAAGGCTACTGGG + Intergenic
1038762252 8:30395132-30395154 CTGATTTTCTTAAGCATATTAGG - Intronic
1038778305 8:30550360-30550382 GTGTTTATGTGAAGGATTATTGG - Intronic
1039118271 8:34116708-34116730 GTTAGTTTCCTAAGGATAATGGG - Intergenic
1039692577 8:39878748-39878770 GAGTTTTTCTTCAGGATCAGTGG + Intergenic
1039999079 8:42561423-42561445 GGGTTTTTCTTCAGGATCAGTGG + Intergenic
1041002520 8:53466302-53466324 GGGTTTTTCTTCAGGATCAGTGG - Intergenic
1041629823 8:60074580-60074602 CTGATTTTCTTAAGGATGAGTGG + Intergenic
1042740443 8:72038017-72038039 GTGTTTTTATCAAGTATATTTGG - Exonic
1043060550 8:75496225-75496247 ATGTACTTCTTAAAGATAATTGG + Intronic
1044517118 8:93152432-93152454 GTGCTTCTGTTAAGGAAAATTGG + Intronic
1044731815 8:95234747-95234769 ATATTTTTCTTAACGAAAATGGG - Intergenic
1045404759 8:101854720-101854742 TTGTTATACTTTAGGATAATCGG - Intronic
1045786803 8:105931272-105931294 AACTTTTTCCTAAGGATAATTGG + Intergenic
1045846809 8:106646407-106646429 TTGTTTTTATTAAAGATAATAGG - Intronic
1045984431 8:108233214-108233236 TTGTTTTTCTTAAGCAAAGTTGG + Intronic
1047889523 8:129292500-129292522 GTCCTTTTCTTAAAGAGAATGGG - Intergenic
1049581656 8:143414344-143414366 CTTTTTTTTTTAAGGATAAAGGG + Intergenic
1050271315 9:3948487-3948509 GTATTTTTCATAAGAATTATAGG - Intronic
1050498326 9:6267423-6267445 CTGAGTTTATTAAGGATAATTGG - Intergenic
1051316351 9:15837309-15837331 ATGTTTTTCTTCAGGTGAATGGG + Intronic
1051449926 9:17184878-17184900 GTATTTTTCTAAAGGATTGTAGG + Intronic
1052032578 9:23645290-23645312 TTTTTTTCCTTAAGGAAAATGGG + Intergenic
1052280218 9:26724259-26724281 GTTTTTTTCTTATGCAAAATGGG + Intergenic
1054705371 9:68455997-68456019 GTGCCTTTCTGATGGATAATAGG + Intronic
1055883001 9:81024230-81024252 GAGATTTTATTAAGGAGAATTGG - Intergenic
1055912291 9:81366607-81366629 GTGTGTTTATTAAGTTTAATTGG - Intergenic
1056392179 9:86150568-86150590 GGGTTTTTCTTCAGGATCAATGG + Intergenic
1058336472 9:103835684-103835706 GTGTTTTTGTTAAGTATAGTTGG + Intergenic
1059566760 9:115390246-115390268 GTGTTTTTTTTAAGGAAAACAGG + Intronic
1059579335 9:115527095-115527117 GTTTTTATCCTAAGAATAATAGG + Intergenic
1059621360 9:116009110-116009132 ATTTTTTTCTTCAGGAAAATAGG + Intergenic
1059889159 9:118782013-118782035 GTGTTATTCTAAAGCATAAATGG - Intergenic
1061734417 9:132643627-132643649 GTTTTTTTCTTCTGGAAAATGGG - Intronic
1186058280 X:5674763-5674785 CTGTTTTTCTTAATGATAAATGG + Intergenic
1186134331 X:6503547-6503569 CTTTTAGTCTTAAGGATAATTGG - Intergenic
1186268310 X:7856878-7856900 GTGTTTTTCTTATGCAATATGGG + Intergenic
1186280159 X:7984242-7984264 TTGTTTTTCTGTAGGATACTTGG + Intergenic
1186608880 X:11119302-11119324 CTCTTTTTCTCAAGGAGAATAGG + Intronic
1189014834 X:37086379-37086401 CTGATTTTCTTAAGCATATTAGG - Intergenic
1190082663 X:47368891-47368913 GTTTGTTTTTTAAGGATACTGGG + Intergenic
1192197037 X:69035285-69035307 GTCTTTTTCTTAAGAACAAAGGG - Intergenic
1193749917 X:85328547-85328569 GTGATTTTCCTAAGGAAAATTGG + Intronic
1195206806 X:102608975-102608997 GTGTTTTTTTAAAGGATATCAGG + Intergenic
1195842246 X:109186970-109186992 CTGTTTTTGGTAAGGATAAAAGG + Intergenic
1196912021 X:120493307-120493329 GGGTTTTTTTCAGGGATAATAGG + Intergenic
1197567432 X:128104714-128104736 TTGGTTTTCTGCAGGATAATAGG + Intergenic
1198754393 X:139967800-139967822 GTATTTTTCATAATGAGAATGGG - Intergenic
1198950781 X:142069036-142069058 ATGTTTTTCTTACTGACAATAGG + Intergenic
1199266255 X:145830773-145830795 GTGTTTTGCTAAAGGAGAATTGG + Intergenic
1199355012 X:146852018-146852040 GTATTTTTCTTTAAGAAAATAGG - Intergenic
1201370037 Y:13253354-13253376 GTCTTTTTCTTCAAGATAATAGG - Intronic
1201631799 Y:16077957-16077979 GGGTTTTTCTTCAGGATCAGTGG - Intergenic