ID: 1104527703

View in Genome Browser
Species Human (GRCh38)
Location 12:129539792-129539814
Sequence GCTTTGATCACAGATCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104527700_1104527703 28 Left 1104527700 12:129539741-129539763 CCAGAAAGCAAAACCTTGGATTA 0: 1
1: 1
2: 2
3: 11
4: 191
Right 1104527703 12:129539792-129539814 GCTTTGATCACAGATCACCCTGG 0: 1
1: 0
2: 0
3: 5
4: 112
1104527699_1104527703 29 Left 1104527699 12:129539740-129539762 CCCAGAAAGCAAAACCTTGGATT 0: 1
1: 1
2: 5
3: 23
4: 258
Right 1104527703 12:129539792-129539814 GCTTTGATCACAGATCACCCTGG 0: 1
1: 0
2: 0
3: 5
4: 112
1104527702_1104527703 15 Left 1104527702 12:129539754-129539776 CCTTGGATTAAAGGATACTACTG 0: 1
1: 0
2: 1
3: 26
4: 276
Right 1104527703 12:129539792-129539814 GCTTTGATCACAGATCACCCTGG 0: 1
1: 0
2: 0
3: 5
4: 112
1104527698_1104527703 30 Left 1104527698 12:129539739-129539761 CCCCAGAAAGCAAAACCTTGGAT 0: 4
1: 16
2: 72
3: 160
4: 489
Right 1104527703 12:129539792-129539814 GCTTTGATCACAGATCACCCTGG 0: 1
1: 0
2: 0
3: 5
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104527703 Original CRISPR GCTTTGATCACAGATCACCC TGG Intronic
901826120 1:11862672-11862694 GCTGTGCTCACAGAGCATCCAGG - Intergenic
907311588 1:53541962-53541984 GCTTTGGTGAGTGATCACCCAGG - Intronic
907519741 1:55015403-55015425 GCTCAGTTCACAGATGACCCAGG + Intergenic
915844199 1:159246797-159246819 GCAATGATCTCAGATCAGCCTGG + Intergenic
915980402 1:160416531-160416553 GCTTTGCTCACACATACCCCAGG - Intronic
919817973 1:201453752-201453774 GCTTTGACCAGAGGCCACCCTGG + Intergenic
921583025 1:216916796-216916818 AATTTGAACCCAGATCACCCTGG - Intronic
924953252 1:248905323-248905345 GCTTTGAACACAGAAATCCCTGG - Intergenic
1064498371 10:15940037-15940059 GCTCTACTCACAGAGCACCCCGG - Intergenic
1065403330 10:25332095-25332117 GCATTGATCAGAAATCACCTGGG + Intronic
1071091198 10:81920450-81920472 GCATTGATCACAGCCCACTCAGG + Intronic
1072690962 10:97572218-97572240 TCTCTGATCACAGCTCACGCTGG - Intergenic
1075219752 10:120574915-120574937 GTTTTGATCACATATAACCCTGG + Intronic
1075585204 10:123652329-123652351 GCTTTTATCACAGATTTCTCAGG + Intergenic
1076404807 10:130204674-130204696 GCTTGGGTCCCAGAACACCCAGG - Intergenic
1076831458 10:132996460-132996482 GCTTTGGTCAAAGGCCACCCAGG - Intergenic
1078464920 11:11543240-11543262 GCAATGATCACAGATCAGCCTGG - Intronic
1081813495 11:45926234-45926256 GCTGTGATCAAGGAGCACCCGGG + Exonic
1087788271 11:102380056-102380078 GATTTGAACACAGATCTGCCTGG + Intergenic
1090050898 11:123378232-123378254 GCTTTGAAGTCAGATCAACCTGG - Intergenic
1090985446 11:131762122-131762144 GCTTTGATAACAAATGAACCTGG - Intronic
1096334012 12:50739373-50739395 GCTTTGATCACAACTCACTGGGG - Intronic
1097919458 12:65056031-65056053 GCTTTGAACAGAGGTCTCCCTGG + Exonic
1104174697 12:126319123-126319145 GCACTGATCACATATCACCTTGG + Intergenic
1104527703 12:129539792-129539814 GCTTTGATCACAGATCACCCTGG + Intronic
1104531298 12:129573286-129573308 GCTTTCATCTCAGCTCTCCCTGG - Intronic
1104652675 12:130547737-130547759 GCTTTGCTCTGAGATCTCCCTGG - Intronic
1106097791 13:26663821-26663843 GCTTTTATCACATAGCTCCCTGG - Intronic
1106397245 13:29393100-29393122 GCTTTGCTCACAGCTGGCCCTGG - Intronic
1106505770 13:30369347-30369369 GCTTTGTAAACAGATCCCCCTGG - Intergenic
1107381304 13:39859126-39859148 CCTTTTATGGCAGATCACCCTGG + Intergenic
1108084819 13:46775539-46775561 GCTTTGACCCAAGATTACCCTGG - Intronic
1109934680 13:69265331-69265353 CCTTTGACCCCAGATCACACTGG - Intergenic
1114604901 14:23988714-23988736 GCTTTGATCACTCACCAGCCCGG + Intronic
1115994222 14:39178619-39178641 GCTTTGAGCTCAGACCAGCCTGG - Intronic
1116569980 14:46503779-46503801 GCTGTGATCACACTTCATCCTGG + Intergenic
1118523233 14:66610946-66610968 ACATTGATAACTGATCACCCTGG - Intronic
1118595340 14:67430828-67430850 GCTTTGATCACAGAATCCTCAGG - Intergenic
1122856419 14:104562368-104562390 GCTCTGATCCCAGCCCACCCTGG - Intronic
1122856428 14:104562414-104562436 GCTCTGATCCCAGCCCACCCTGG - Intronic
1122856439 14:104562460-104562482 GCTCTGATCCCAGTCCACCCTGG - Intronic
1132693666 16:1192731-1192753 TGTTTGCTCTCAGATCACCCCGG - Intronic
1133767669 16:8849117-8849139 GCTTTCATCACAGCTAAACCTGG + Exonic
1140030137 16:71329187-71329209 GCTTTGATATCAGATGACGCTGG - Intergenic
1141292828 16:82736202-82736224 GCTTTGATGGAAGAACACCCAGG + Intronic
1141426913 16:83950045-83950067 GCCCTGAGCACAGGTCACCCAGG + Intronic
1148284660 17:46377173-46377195 GATTTGAACTCAGATCAGCCTGG + Intergenic
1148306881 17:46595094-46595116 GATTTGAACTCAGATCAGCCTGG + Intronic
1148745025 17:49913225-49913247 ATTTTGATGACAGATGACCCAGG - Intergenic
1149368951 17:55973827-55973849 GTTTTAATCCAAGATCACCCCGG + Intergenic
1154234768 18:12594268-12594290 GGTTTGATCACAGATATCTCTGG - Intronic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1159134202 18:64318033-64318055 TCTTTGATCACAGAGCACAATGG - Intergenic
1159432660 18:68375017-68375039 GCTTTAAGTACAGATCACCTAGG + Intergenic
1159514505 18:69440256-69440278 TCATTGATCACAGATCACCATGG + Intronic
1160086151 18:75779417-75779439 GTGTTGATCACAGCTCACACAGG + Intergenic
1161936629 19:7376337-7376359 GCTGTGATCACAAAGGACCCTGG + Intronic
1162067085 19:8132446-8132468 GCTGGGATCACAGATGAACCTGG + Intronic
1164251579 19:23482017-23482039 CCTTTGTTGACAGATCAGCCTGG - Intergenic
1166688046 19:44807951-44807973 GCTTGGATTACAGGTCAGCCTGG - Intergenic
1166916490 19:46199062-46199084 GCCTTGGTCACAGATATCCCTGG - Intergenic
1168229128 19:55017762-55017784 GCTTCCATCACAGAACTCCCTGG + Intronic
925125942 2:1455894-1455916 GCTTTGAAGACAGATGCCCCTGG - Intronic
930831328 2:55746668-55746690 TCACTGATCACAGATCACCAAGG - Intergenic
931293824 2:60902652-60902674 GATGTGATCACAGATCACTGCGG + Intronic
932450176 2:71804751-71804773 TCTTTGATGAGAGATGACCCTGG + Intergenic
934993099 2:98935457-98935479 GCTTTGATTACACGCCACCCGGG - Intronic
935121371 2:100186227-100186249 GCGTTCATCACAGAACACCAGGG - Intergenic
936906578 2:117542338-117542360 GCTGTAATCACTGAGCACCCTGG - Intergenic
947313380 2:228828551-228828573 CCCTTGATCTCTGATCACCCTGG - Intergenic
947877364 2:233476669-233476691 CTTCTGATCACAGAGCACCCAGG + Exonic
1175263731 20:57690266-57690288 GCTTGGGGCACAGACCACCCGGG + Intronic
1175516049 20:59570902-59570924 GGGTTGATTACAGAACACCCAGG - Intergenic
1182742801 22:32580971-32580993 ACTGTGCACACAGATCACCCAGG - Intronic
959144591 3:102529639-102529661 GCTTTGAACATAGCTCTCCCTGG + Intergenic
959351514 3:105270914-105270936 GCTTTTAACATAGATCAACCTGG + Intergenic
959369047 3:105500055-105500077 GCTTTGTTCACAGACTACACAGG + Intronic
965382244 3:168004347-168004369 GCTTTTATCACAGATCCTCTGGG + Intergenic
971212177 4:24629471-24629493 GCCTAGATCACTGATCTCCCTGG + Intergenic
973953905 4:56043979-56044001 GCTATGATCACACTTCAGCCTGG - Intergenic
975972279 4:80054468-80054490 ACCTTGAACACAGATCACGCTGG - Intronic
979483253 4:121242141-121242163 GCCTTGATCACAGGCTACCCGGG + Intergenic
980710404 4:136558883-136558905 GATTTGATCCCAGGTCACCCTGG + Intergenic
983238470 4:165206476-165206498 GGAGTAATCACAGATCACCCAGG - Intronic
990368583 5:55094411-55094433 GGTGTGATCACAGCTCATCCAGG - Intergenic
992001370 5:72439507-72439529 GCTTTGAACACAGGCCACCTGGG + Intergenic
995022294 5:107380421-107380443 TCTTTGAATACAGATCACCATGG - Exonic
999297168 5:150466992-150467014 GCCTTCATCACATCTCACCCAGG + Intergenic
1000470988 5:161641654-161641676 GATTTGGTCATAGAACACCCTGG + Intronic
1002844440 6:934516-934538 GCTTTGATGACAAGTCACACAGG - Intergenic
1004334730 6:14754416-14754438 GCTATGATCACAGCTCACTGTGG + Intergenic
1004687880 6:17964764-17964786 GATTTTATCCCAGATAACCCAGG + Intronic
1005788301 6:29270111-29270133 GCAGTGAGCAGAGATCACCCAGG - Intergenic
1007111469 6:39315492-39315514 GCTTTGTTCACAGACAGCCCTGG + Intronic
1012952120 6:105529430-105529452 GATTTGCCCACAGATCTCCCTGG - Intergenic
1016761315 6:147740572-147740594 TTTTGGATCACAGATCACACAGG + Intergenic
1017678596 6:156840650-156840672 GCTTTGTTCTCAGAGCACCTGGG - Intronic
1018629270 6:165808178-165808200 GTATTCATCTCAGATCACCCTGG + Intronic
1020110758 7:5446673-5446695 ACTTTGATCTCAGAGCCCCCAGG - Intronic
1023395793 7:39750831-39750853 TCTTTGATCAAATGTCACCCTGG + Intergenic
1026456479 7:70576875-70576897 GCTTTGACCACAGAACACCTAGG + Intronic
1036048726 8:5172288-5172310 GCGTTGAACCCAGATCTCCCTGG - Intergenic
1037025834 8:14036137-14036159 ACTTTGATCACAGACAACACAGG + Intergenic
1042529764 8:69803068-69803090 GCTGTAATCCCAGATCAGCCTGG + Intronic
1046856485 8:119038171-119038193 GCTTTGATATGAGATCAACCTGG + Intronic
1046947638 8:119988898-119988920 GCTCTGATCTCAGATAGCCCAGG - Intronic
1047758239 8:127934934-127934956 GGTTGGATAACAGAGCACCCAGG - Intergenic
1050291834 9:4163166-4163188 GGTTTGAACACAGATCTGCCTGG + Intronic
1055983898 9:82036192-82036214 GCTTTTATCCCAGAATACCCAGG + Intergenic
1056572438 9:87827818-87827840 GCTTTGTTCAGAGATTTCCCAGG - Intergenic
1056846291 9:90040740-90040762 GCATGGATCACAGAGGACCCTGG + Intergenic
1187219475 X:17309716-17309738 CCTTTGATGTCTGATCACCCTGG + Intergenic
1187562288 X:20414024-20414046 GCTGTGCTTACAGATCATCCGGG - Intergenic
1189327126 X:40119576-40119598 GCTGTGATCACAGCTCACTGCGG - Intronic
1190199648 X:48349891-48349913 GCATGGATCCCAGATAACCCTGG - Intronic
1190666420 X:52700347-52700369 GCATGGATCCCAGATAACCCTGG - Intronic
1190672998 X:52758063-52758085 GCATGGATCCCAGATAACCCTGG + Intronic
1192763177 X:74118117-74118139 CCTTGGATCACTGAGCACCCAGG + Intergenic