ID: 1104530236

View in Genome Browser
Species Human (GRCh38)
Location 12:129563392-129563414
Sequence TGCATAGCTGAGGATATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104530233_1104530236 13 Left 1104530233 12:129563356-129563378 CCTCAGTGCTCTTAGTTTTGGGT 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1104530236 12:129563392-129563414 TGCATAGCTGAGGATATAGATGG 0: 1
1: 0
2: 0
3: 17
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104530236 Original CRISPR TGCATAGCTGAGGATATAGA TGG Intronic
900282403 1:1879247-1879269 TTAATAGTTGAGGATGTAGAGGG - Intronic
900312645 1:2041643-2041665 TGCAGGGCTGAGGATGTAGGGGG - Intergenic
900535717 1:3176199-3176221 TGGATAGATGAGGGGATAGATGG - Intronic
900535798 1:3176637-3176659 TGGATAGATGAGGGGATAGATGG - Intronic
901114085 1:6827160-6827182 TGCAAATTTGAGGATCTAGATGG + Intronic
904922638 1:34020812-34020834 TGCATTGCTGAGCATGTCGAAGG + Intronic
904929101 1:34072407-34072429 GTAAGAGCTGAGGATATAGAAGG + Intronic
905040205 1:34949789-34949811 TGCAGAACTGTGGATACAGAGGG - Intergenic
906428044 1:45730605-45730627 TGCTTAGCTGAGGAGGTAAACGG + Intronic
906946509 1:50298977-50298999 TGAATTGCTGAGGAAACAGAGGG - Intergenic
908730747 1:67223863-67223885 TGCATAGCTTTGTATATAAATGG + Intronic
910465329 1:87493063-87493085 TGCTTAGCAGAAGATAAAGAGGG + Intergenic
911585623 1:99687332-99687354 CGCATAGGTGAGGATAATGAGGG + Intronic
912640766 1:111343744-111343766 TGCATCACTCAGGATGTAGATGG + Intergenic
915042303 1:152979140-152979162 GGCATAGCTGAGCAAACAGAAGG + Intergenic
916511038 1:165472630-165472652 TTTATAGCTGAGGAAATGGACGG + Intergenic
918345572 1:183604496-183604518 TGAAGAGCTGAGGAGATAGTGGG + Intergenic
918438065 1:184537021-184537043 TGCATAGCCCAGGTTATATACGG + Intronic
919549983 1:198973537-198973559 TGAATAGATGGGGGTATAGAAGG + Intergenic
919851104 1:201673562-201673584 AGCTTAGCTGAGGATGCAGAGGG - Intronic
923167881 1:231384564-231384586 GGCATATCTGAGGAAAAAGAGGG + Intronic
923927218 1:238645615-238645637 TGCATATCTGAGGAGGTGGACGG + Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1065987743 10:30973026-30973048 TCCATAGCTGAGCATCTGGAAGG - Intronic
1066625016 10:37397293-37397315 GGCATAGCTGAGGATATAATTGG - Intergenic
1067086192 10:43239975-43239997 TGCATTCCTGAGAATCTAGAAGG + Intronic
1071131626 10:82400333-82400355 TGCATAGGTGAGAATATGAATGG + Intronic
1071586951 10:86832584-86832606 TGCCTAGATGAGGAGGTAGAAGG - Intronic
1074310290 10:112316600-112316622 TGCATAGCTGAGGCCAGATACGG + Intergenic
1075630021 10:123995170-123995192 TGCATATCTGGGGATAGGGATGG + Intergenic
1077726511 11:4680477-4680499 TGTACAGCTGAGGAAATAAATGG + Exonic
1077755236 11:5021688-5021710 TGCATAGCCAATGACATAGAGGG - Intergenic
1077853729 11:6100630-6100652 TGCACAGGTGAGGATCTTGAGGG - Intergenic
1078984567 11:16580374-16580396 TGCATAACTGAGCATGTACAAGG + Intronic
1079478453 11:20856588-20856610 TGCTTTGCTGAGGATATACCAGG - Intronic
1080470108 11:32537506-32537528 TGCAGAGCTGAGGTGAAAGACGG - Intergenic
1080643237 11:34170200-34170222 TGTATAGATGAGGAAATTGAGGG - Intronic
1080745587 11:35105829-35105851 AGCATAGCTGAGGCTTTAGCAGG - Intergenic
1082720715 11:56672174-56672196 TGTATAGATGTAGATATAGATGG - Intergenic
1083073772 11:60015721-60015743 TGCAGAACTGTGGATAAAGATGG + Intergenic
1085606488 11:77904156-77904178 TGGATAGGTGAGGAGAGAGATGG - Intronic
1085915923 11:80887597-80887619 TGGATTGCTGAGGGTATATATGG + Intergenic
1087297527 11:96394851-96394873 TGCATAGCTTAGAATGTAAAGGG - Intronic
1087328324 11:96750380-96750402 TGCACACCATAGGATATAGATGG - Intergenic
1088164694 11:106919743-106919765 TACATATCTGAGGAAATAAAAGG + Intronic
1088429130 11:109738729-109738751 TGCATAAATGAAGTTATAGAAGG - Intergenic
1089548495 11:119250366-119250388 TGCTTAGCTGAAGACTTAGAAGG + Intronic
1091414013 12:264459-264481 TGCATATGTGAGGACACAGAAGG - Intergenic
1095627971 12:44340607-44340629 TGCATAGCTAAGTAGTTAGATGG - Intronic
1096256966 12:50068916-50068938 TGCAGAGTGAAGGATATAGAAGG - Intronic
1099705116 12:86142596-86142618 TGAATAGCTGAATATATAGTAGG + Intronic
1100098070 12:91068148-91068170 TGCATAGCTTAGGTAAAAGATGG - Intergenic
1101285278 12:103305553-103305575 TTCATAGCACAGGATATAGGAGG - Intronic
1103084992 12:118056000-118056022 TGCATAGATGAGAGTAGAGATGG - Intronic
1104447094 12:128843444-128843466 TCCATAGCAGAGGAGGTAGAAGG + Intergenic
1104447107 12:128843513-128843535 TCCATAGCAGAGGAGGTAGAAGG + Intergenic
1104530236 12:129563392-129563414 TGCATAGCTGAGGATATAGATGG + Intronic
1104801217 12:131556270-131556292 AGCATCCCTGAGGATATAGGAGG + Intergenic
1109484431 13:63000161-63000183 AGCATAGCTCAGGATAAAAAAGG + Intergenic
1109815662 13:67580419-67580441 TGCATAGATGATGAGATGGAAGG - Intergenic
1109915264 13:68976666-68976688 TGCATAGATGATGAAATTGAAGG - Intergenic
1110432990 13:75447424-75447446 TTCATAGATGAGGATACTGAAGG + Intronic
1111958405 13:94782882-94782904 TTTATAGCTGAGGAAATTGAGGG - Intergenic
1113356140 13:109582115-109582137 TGCATAACTGCGGATATGGAAGG + Intergenic
1117925659 14:60776602-60776624 GCCATAACTGAGGATAAAGATGG + Intronic
1120866616 14:89300681-89300703 TGGAAAGCTGATGACATAGAAGG + Intronic
1121583907 14:95049872-95049894 TGGATGGATGAGGATGTAGAAGG + Intergenic
1128667551 15:69549522-69549544 TGCAGGGCTGAGCACATAGAAGG - Intergenic
1132169918 15:99640398-99640420 TGCCTTACTGAGGATAAAGATGG - Intronic
1133081493 16:3324436-3324458 TGCATAGCAGAGTTAATAGATGG + Intergenic
1133852519 16:9518779-9518801 TGCATAGCTTAGCAAATACAAGG + Intergenic
1135086490 16:19478766-19478788 TGGATAGATGGGTATATAGATGG - Intronic
1135346524 16:21693421-21693443 TCAATAGCTGAAGATAGAGAAGG + Intronic
1138203450 16:55107013-55107035 TGCACACCTGAGTACATAGATGG - Intergenic
1139603340 16:68000213-68000235 TGCATAGAAGAGGAAGTAGAGGG - Intronic
1140167547 16:72569170-72569192 TCCATAGCTCTGAATATAGAGGG - Intergenic
1140853250 16:78954294-78954316 TGCATGGCTGAGTGGATAGAAGG + Intronic
1141506469 16:84481591-84481613 TGCAGAGCTGAGGGCAGAGAAGG - Intronic
1142619939 17:1158813-1158835 TTCACAGCTGAGGACACAGAGGG + Intronic
1143824430 17:9592736-9592758 TGCATAGATGAAGATAAAGTAGG - Intronic
1143940758 17:10538722-10538744 GGCATTGCAGAGGATATAGAAGG - Intronic
1144632295 17:16880457-16880479 TGCAGTGATGAGGATGTAGAGGG - Intergenic
1146161901 17:30564572-30564594 TGCAGAACTGAGGATATGCATGG + Intergenic
1146995716 17:37319402-37319424 TGCATAGAAAAGGATACAGATGG + Intronic
1147303065 17:39545201-39545223 TGCAAGGCTGTGTATATAGATGG - Intronic
1150439011 17:65176767-65176789 TGGATAGGTGAAGAGATAGACGG - Intronic
1151120274 17:71785743-71785765 TAGATAGCTGAGGAAACAGATGG + Intergenic
1155318660 18:24596888-24596910 TGAAGAGCTGAGAATCTAGAAGG - Intergenic
1155561169 18:27078762-27078784 TTCCTAGCTGAGGCTAAAGAAGG - Intronic
1156196886 18:34784466-34784488 TGCATAGATGGGGATAAGGAGGG - Intronic
1157399224 18:47373009-47373031 TGCAGAGCTGGAGATAGAGATGG + Intergenic
1157592939 18:48846676-48846698 TGAATAGGTGAGTAGATAGATGG + Intronic
1157945208 18:51971716-51971738 TGATTAGCTGAGCATAAAGAAGG - Intergenic
1160057740 18:75500971-75500993 TGCATATATGAGGAGAGAGAAGG - Intergenic
1163361882 19:16851878-16851900 TGCACAGCTGAGGGCAGAGAGGG + Intronic
1164776600 19:30858039-30858061 GGGAAAGCTGAGGATGTAGAGGG + Intergenic
1167497524 19:49828341-49828363 TGCATAGCCCAGGATAGAGTGGG + Intronic
925412267 2:3646755-3646777 TGCATGGGTGAGCAGATAGAGGG - Intergenic
925779038 2:7363152-7363174 TACATGGCTGAGAATATAAAAGG - Intergenic
926702839 2:15815315-15815337 TGTAGAGCTGAGGAAACAGAAGG - Intergenic
927061403 2:19425940-19425962 TGCATAGATGTGGATAATGAGGG - Intergenic
927704943 2:25291168-25291190 TGCAGAGCTGAGGAACTGGAAGG - Intronic
928323200 2:30300220-30300242 TTCACAGCTGAGGACATTGAGGG - Intronic
929119877 2:38475917-38475939 TGCATGGATGAGTATAAAGATGG - Intergenic
932337933 2:70941657-70941679 TGCCTAGCTTAGTACATAGAAGG + Exonic
932508167 2:72256992-72257014 TGCAGAGCAAAGGATATTGAGGG - Intronic
932861729 2:75299780-75299802 AGCTTAGATGAGGACATAGAGGG + Intergenic
933174535 2:79160165-79160187 TGGACAGTTGAGGACATAGATGG + Intergenic
933944020 2:87268727-87268749 GGCATATTTGAGGATATGGAAGG + Intergenic
934154266 2:89180752-89180774 TGCATTGCTGAGGATCTATGAGG + Intergenic
934212964 2:90001186-90001208 TGCATTGCTGAGGATCTATGAGG - Intergenic
935266561 2:101400016-101400038 GGCATAACTGAGGATCTTGAAGG - Intronic
935638873 2:105271845-105271867 TGCAGAGCTGAGGCCAAAGAAGG + Intronic
936336199 2:111592852-111592874 GGCATATTTGAGGATATGGAAGG - Intergenic
938706917 2:133939586-133939608 TGGATAACTGGGGATATAGATGG - Intergenic
939302227 2:140359140-140359162 TGCACAGCTGAGGATCTTAAAGG + Intronic
940392431 2:153147843-153147865 TTCCTAGTTGAGGATATAAAAGG + Intergenic
940542586 2:155040611-155040633 TGCATAAATGAGGATAAAAACGG - Intergenic
940762979 2:157758364-157758386 TGCAAAACTGAGTATATAGAGGG - Intronic
943894768 2:193342225-193342247 TGCATAGCTGAGGGAATAATGGG - Intergenic
943945516 2:194057028-194057050 CTCATTACTGAGGATATAGATGG - Intergenic
944009776 2:194960446-194960468 TGCATAACTGAGTTTATAGAAGG - Intergenic
944130216 2:196339583-196339605 AGGATAGATGAGGAGATAGATGG + Intronic
945640982 2:212429452-212429474 TGGATAGCTGAGTATATCAAAGG + Intronic
945886807 2:215384621-215384643 GGCAGAGCTGAGGAAATAAAAGG - Intronic
1170375068 20:15691326-15691348 TGGATAGTTGAGTAAATAGATGG - Intronic
1170921591 20:20684488-20684510 TGGATGGCTGAGGATAAAGGTGG - Intronic
1178128701 21:29545139-29545161 TGAATAGCTGATGGTATAAAAGG + Intronic
1178503718 21:33146499-33146521 TGCAGAGCAGGGGATATTGATGG - Intergenic
1179043698 21:37827240-37827262 TGGACAGATGGGGATATAGAGGG - Intronic
1180756639 22:18166720-18166742 TACATTCCTGAGGATCTAGAAGG - Intronic
1181075126 22:20370712-20370734 TACATTCCTGAGGATCTAGAAGG + Intronic
1181392492 22:22593873-22593895 TGAATAGCTGAGATTACAGAAGG - Intergenic
1181837942 22:25626334-25626356 TGAATATCTGTGGAAATAGAGGG + Intronic
1182367489 22:29788888-29788910 TGCAAAGCTGAGGCTGTTGAGGG + Exonic
1182598030 22:31437264-31437286 AGAGAAGCTGAGGATATAGAAGG - Intronic
949272345 3:2233455-2233477 TGCATTGATTAGCATATAGATGG + Intronic
952855532 3:37767517-37767539 TGCAGAGCTGGGGATAGAGCAGG - Intronic
953804737 3:46058688-46058710 TGAATAGCTGGGACTATAGACGG + Intergenic
954904531 3:54048916-54048938 TGCAGAACTGCGGATATGGAGGG + Intergenic
955870722 3:63435729-63435751 TGTATATGTGAGAATATAGATGG - Intronic
955904933 3:63796824-63796846 TGCATAAAGAAGGATATAGAAGG - Intergenic
956421278 3:69088469-69088491 GGCTTAGATGAGGATAGAGAGGG + Intronic
958870154 3:99548875-99548897 TGCATAGGTAAGTATTTAGAAGG - Intergenic
961568289 3:127779557-127779579 TGCATTGCTGAGGTTATGTAAGG - Intronic
963178029 3:142322338-142322360 TGAATAGCTGAGAATATAGGTGG + Intronic
964337296 3:155668979-155669001 TGCATAACTGGGGACATAAATGG + Intronic
965087622 3:164119531-164119553 TGCAGAGCTAAGGATAAATATGG + Intergenic
966267106 3:178059575-178059597 TAAGTAGCTGAGGCTATAGAAGG + Intergenic
966797282 3:183727608-183727630 GGCATAGATGAGCATATAGAAGG + Intronic
970517802 4:16850684-16850706 AGCATAGCTAAGGAGAGAGAGGG + Intronic
971994542 4:33948361-33948383 TGGAGAGCTAATGATATAGATGG + Intergenic
980021192 4:127712184-127712206 TTCATAGCTAAGGAAATAGGAGG - Intronic
987818423 5:22932507-22932529 TCCATAGATGAGGAGGTAGAGGG - Intergenic
988483368 5:31648001-31648023 AGCATGGCTGGGGAAATAGATGG + Intronic
988937990 5:36108371-36108393 TGCATTCCTCAGTATATAGAAGG - Intronic
989520516 5:42395750-42395772 TGCAGAACTGTGGATATGGAGGG - Intergenic
993231403 5:85241848-85241870 CGCATATCTTAGGATATAAATGG - Intergenic
993560150 5:89396646-89396668 TGAAGAGCTGAGCATGTAGAAGG + Intergenic
994834689 5:104834480-104834502 TACATATATGAGGATATAAAAGG + Intergenic
996898184 5:128511298-128511320 TGCCTACTTGAGGGTATAGAGGG + Intronic
996950836 5:129123755-129123777 AGCATATCTGAGATTATAGATGG - Intergenic
998301567 5:141026663-141026685 TGCATAGATGAGGAAATTGTAGG + Intergenic
999038948 5:148385339-148385361 TGCATAGCAGAGGAGAAAAAGGG + Intronic
1001666903 5:173440801-173440823 CACATAGTTGAGGATATAGAGGG - Intergenic
1001752043 5:174138766-174138788 TGCCTAGCTGGGGAGAGAGATGG + Intronic
1002082400 5:176745190-176745212 TACACAGATGAGGATATTGAGGG - Intergenic
1002512304 5:179729546-179729568 TGCATAGCAGAGGAGAAAGCTGG - Exonic
1003469075 6:6411739-6411761 AGCACAGCTGTGGACATAGATGG + Intergenic
1005152452 6:22767830-22767852 TGCATTGCTAAGGTTATATATGG - Intergenic
1005172374 6:23002798-23002820 TGAATAGATGTAGATATAGATGG + Intergenic
1005414161 6:25583539-25583561 TGGATAGCTGGAGACATAGATGG + Intronic
1006299866 6:33188005-33188027 TGCATAGATGAGTAAATAGATGG + Intronic
1007012056 6:38427226-38427248 TGAATAGCTGAGATTATAGGTGG - Intronic
1007958475 6:45938102-45938124 TGCAGAGCTGAAGATCCAGAGGG + Intronic
1010024524 6:71200452-71200474 TTCATAGATGAGGACATTGAGGG + Intergenic
1011014412 6:82738962-82738984 TGCAGAGCTGGGGATAAAGATGG + Intergenic
1011237800 6:85236913-85236935 TGCATAGCTGATCTTAAAGAAGG + Intergenic
1012666855 6:101981958-101981980 TGCATAGCTGGTTAGATAGATGG + Intronic
1013253830 6:108362639-108362661 TGCATTGATGAGGAAATTGAGGG + Intronic
1013488728 6:110623218-110623240 GGAATAGCTGAGTAAATAGAAGG + Intronic
1015344777 6:132143452-132143474 TGCAAAGCTGGGGCTCTAGAGGG - Intergenic
1015844389 6:137504296-137504318 TGAATAGCTGAGATTACAGAAGG - Intergenic
1020285976 7:6680980-6681002 TGCAAACCTGAGGATACAGAGGG + Intergenic
1021087531 7:16440434-16440456 TATACAGCTGAGGATACAGAGGG + Intergenic
1021364398 7:19758733-19758755 TCAATAGCTGAGGGTAAAGAAGG - Intronic
1023071748 7:36441662-36441684 TCTATAGCTGAGGAAACAGAGGG - Intronic
1023123840 7:36935708-36935730 TGCACAGCTGAGGGTTTTGAAGG + Intronic
1023186352 7:37537200-37537222 TGTATAGATGAGGATAGAAATGG - Intergenic
1024010388 7:45261340-45261362 TGCATAGCTGAGGAGAGAAGAGG + Intergenic
1025846151 7:65200057-65200079 TGGATAGGTGAGGAGAGAGATGG + Intergenic
1025896371 7:65705789-65705811 TGGATAGGTGAGGAGAGAGATGG + Intergenic
1027777111 7:82480235-82480257 TCCATATCTGTGGATATGGAGGG + Intergenic
1029350286 7:100008646-100008668 TCCATAGCTGAGAACAAAGAAGG + Intergenic
1029814958 7:103083920-103083942 TGCACAGATGAGGAAATTGAGGG - Intronic
1031968526 7:128046222-128046244 TGCCTAGCTGGGACTATAGATGG + Intronic
1034083632 7:148303311-148303333 TGCAGAGCTAAGCACATAGAAGG + Intronic
1035318693 7:158014268-158014290 TGCATAGATGAGTGAATAGATGG - Intronic
1042295775 8:67215939-67215961 TGCAAAGCTGAAGATATTGTTGG - Intronic
1043314286 8:78900945-78900967 TGCAAAGCTGTTGATAGAGATGG + Intergenic
1046808304 8:118504496-118504518 TGCTTAGCAGAGGATGTAGTGGG + Intronic
1048283803 8:133125469-133125491 GGCATATTTGAGGATAAAGAAGG + Intronic
1048372165 8:133788432-133788454 TGTGTAGCTGAGAAGATAGAGGG + Intergenic
1050749410 9:8919765-8919787 TGCATAGATGTGCATATACATGG - Intronic
1051079955 9:13282210-13282232 TGCCTCACTGAGGATATAGGTGG - Intergenic
1052248419 9:26367224-26367246 TGGATGGCTAAGGATATATATGG - Intergenic
1053819449 9:41951948-41951970 TGAATAGCTGAGAATACAGGCGG - Intronic
1056192825 9:84201155-84201177 TGGAAACCTGAGGATATAGAGGG + Intergenic
1056538221 9:87549701-87549723 TGCATTGCTGAGGCTCTAGAAGG - Intronic
1059060348 9:111029599-111029621 TGCATATCTGAGGATGGAGAGGG - Intronic
1185959659 X:4535199-4535221 TGCATAGCTGTAGGTATACAGGG - Intergenic
1191740490 X:64432383-64432405 TTCATAGCTGAGGTAAGAGAGGG - Intergenic
1193764939 X:85516114-85516136 AGCATAACTGATGATAAAGATGG + Intergenic
1194950557 X:100121006-100121028 AGCATGGCTGAGGAAATAGAAGG - Intergenic
1195735624 X:108009751-108009773 GACAAGGCTGAGGATATAGAAGG + Intergenic
1196053650 X:111332203-111332225 TCCAGAGCTGAAGATACAGAAGG + Intronic
1198798088 X:140420948-140420970 TGCATTGCAGAGAATATATAGGG - Intergenic
1199162059 X:144624588-144624610 TGCATACCAGAGGAAATAGAAGG - Intergenic
1199284535 X:146041628-146041650 TGCAGTGTTGAGGGTATAGATGG + Intergenic
1201522369 Y:14889601-14889623 TGAATAGCTGTGGTTAGAGAGGG + Intergenic