ID: 1104531151

View in Genome Browser
Species Human (GRCh38)
Location 12:129572304-129572326
Sequence GTGTGGAGCTGGCGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 388}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104531145_1104531151 -9 Left 1104531145 12:129572290-129572312 CCGCCTGTTGAATTGTGTGGAGC 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1104531151 12:129572304-129572326 GTGTGGAGCTGGCGGGCAGAGGG 0: 1
1: 0
2: 3
3: 36
4: 388
1104531143_1104531151 -1 Left 1104531143 12:129572282-129572304 CCTTGACGCCGCCTGTTGAATTG 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1104531151 12:129572304-129572326 GTGTGGAGCTGGCGGGCAGAGGG 0: 1
1: 0
2: 3
3: 36
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104531151 Original CRISPR GTGTGGAGCTGGCGGGCAGA GGG Intronic
900183839 1:1324096-1324118 CTGGGGAGCTGGGGGGCTGAGGG + Intronic
900183880 1:1324192-1324214 CTGGGGAGCTGGGGGGCTGAGGG + Intronic
900188411 1:1343401-1343423 GTCTGGAGCTGGCTGGGAGGTGG - Intronic
900550619 1:3252609-3252631 GGGTGGGGCTGGTGGGCAGCAGG + Intronic
900794160 1:4697972-4697994 GTGGGGTGGTGGCGGGCAGCCGG + Intronic
901497656 1:9631145-9631167 GTGTGATGCAGACGGGCAGATGG - Intergenic
901913515 1:12479906-12479928 GTGTTAAGCTGGTGGGCTGAGGG - Intronic
902737919 1:18413499-18413521 GGGTGGAGATGACGGACAGATGG + Intergenic
902772581 1:18654197-18654219 GTGTGGAGCTGGCGGGTGGGGGG - Intronic
903385766 1:22925162-22925184 GTGTAGGGCTGGGGGGCTGAGGG - Intergenic
903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG + Intronic
904292593 1:29497593-29497615 GATTGGGGCTGGCGGGAAGATGG - Intergenic
904320980 1:29697678-29697700 GTGTGGAGCTGGGCTGCAGGAGG + Intergenic
904348727 1:29891164-29891186 GTGTGGAGGTGGAGGGCTGTGGG + Intergenic
904503704 1:30933679-30933701 CTGTGCAGCTGGCGGGTAGTGGG - Intronic
904568676 1:31444234-31444256 GTCTGGGGCTGGCGGGTTGAGGG + Intergenic
904615640 1:31748143-31748165 TTGTGGGGCTGGCCAGCAGATGG - Intronic
906149295 1:43578232-43578254 GGGTGGGGCTGGCGGGGAGGGGG + Intronic
906204556 1:43979815-43979837 GTGTGGAGCCTGGGGGCAGGGGG - Intronic
906215555 1:44036172-44036194 GTGGGGAGCAGGCCGGAAGAGGG + Intergenic
906665887 1:47621758-47621780 GTGTGGAGCTGGCCTGCAGACGG + Intergenic
907136409 1:52142648-52142670 GTGTGGAGCTGGGGGCCGGCAGG + Intronic
907311697 1:53542512-53542534 GTGTGGGGCGGGTGGGGAGATGG + Intronic
907401810 1:54229063-54229085 GTGTGGAGTTGGGTGGCAGTGGG - Intronic
907669682 1:56463587-56463609 TTGTGGAACTTGCTGGCAGAGGG - Intergenic
910040885 1:82850463-82850485 GAGGGGAGCTGGAGGGCAAATGG + Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
911114531 1:94233047-94233069 GGGTGGCTTTGGCGGGCAGATGG - Intronic
911115973 1:94247342-94247364 GTGTGACGCCGGCGGGCAGCAGG - Intronic
912446253 1:109739395-109739417 TAGTAGAGGTGGCGGGCAGAAGG - Intronic
912473917 1:109923931-109923953 TTGGGGAGCTGGAGGGCAGGAGG + Exonic
912638357 1:111320102-111320124 GTGTGGAGGTGGGGTGCAGTTGG - Intronic
912775765 1:112505576-112505598 TTGTGGGGCTGCCAGGCAGAGGG - Intronic
913531715 1:119738372-119738394 GTGTGGGGCTGCTGGGCAGCAGG - Intronic
915915412 1:159937663-159937685 GTATGAAGCTGGGGGGCAGGTGG - Intronic
917449789 1:175137945-175137967 GTGTGGAGAAGGTGGGCACATGG + Intronic
919091871 1:192986940-192986962 GTGTGGCGCTTGCGGCCAGCTGG + Intergenic
919733380 1:200928781-200928803 GTGTGGAGCTGGTGTGGTGAGGG + Intergenic
920432444 1:205927635-205927657 GTGTGGGGCTGGGGGGCACGGGG + Intronic
920679240 1:208060110-208060132 CTGTGGAGTTGGTGGGCAGGAGG - Intronic
921254755 1:213329362-213329384 ATGTGGAGCTGGCAGGGAGAAGG + Intergenic
921767547 1:218990199-218990221 GTGTGGCACTGGCAGGCACATGG + Intergenic
922341684 1:224661918-224661940 GTGGGCAGCTGGCGGGAAGCAGG + Intronic
923196313 1:231671532-231671554 GTGTTGAGCTGGGGAGAAGAAGG - Intronic
923621401 1:235582340-235582362 GTGTGGAGCAGCTGGGCAGCGGG - Intronic
924416132 1:243858675-243858697 GTGATCAGTTGGCGGGCAGAGGG + Intergenic
924655178 1:245968222-245968244 GCATGGAGCTGGTGAGCAGAGGG - Intronic
1062994759 10:1855456-1855478 GTGTGGAGCTTTAGGGCAGGTGG + Intergenic
1063892768 10:10647315-10647337 ATGTGGAGCGGGCGGGCAGTGGG - Intergenic
1065780222 10:29160381-29160403 GTTGGGAGATGGTGGGCAGAGGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067145005 10:43688511-43688533 GTGAGAAGCTGGCTGGGAGAGGG + Intergenic
1067161232 10:43826390-43826412 GTGTGGAGCTCTGGGGCAGAAGG - Intergenic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067414254 10:46091677-46091699 GGGCTGAGCTGGTGGGCAGAGGG + Intergenic
1067434310 10:46266217-46266239 GGGCCGAGCTGGTGGGCAGAGGG + Intergenic
1067523827 10:47026737-47026759 GTGGGGAGGGGGAGGGCAGAGGG + Intergenic
1067576135 10:47409776-47409798 GGGCCGAGCTGGTGGGCAGAGGG - Intergenic
1067581638 10:47450206-47450228 GGGCCGAGCTGGTGGGCAGAGGG - Intergenic
1067917680 10:50418308-50418330 GTCTGGAGCTGGCGGGCGGCCGG + Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1072533623 10:96342841-96342863 GTGAGGAACAGGCAGGCAGAAGG + Intergenic
1072690290 10:97568216-97568238 GTGTGGAGCGGTGGGGCAGGTGG + Intronic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1074153988 10:110782643-110782665 CTGGGGAGGTGGCGGGGAGAAGG - Intronic
1074387251 10:113026495-113026517 TTGTGGAGCTGGCTGACAGAAGG - Intronic
1074672027 10:115802071-115802093 GTGTGGTGGTGGGGGGCGGAAGG - Intronic
1074878796 10:117635314-117635336 GTGTTTAGCTGGGGTGCAGATGG - Intergenic
1075711689 10:124534059-124534081 GTGGGGAGCTTGGGGGCAGTGGG + Intronic
1076751359 10:132545116-132545138 GTGTGGAGTTGTGGGGCAGGTGG + Intronic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1077334757 11:1998289-1998311 GTGGGGTGCTGAGGGGCAGAGGG + Intergenic
1077917686 11:6621971-6621993 GTGAGAAGCTGGTGGGAAGATGG + Exonic
1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG + Intronic
1078548930 11:12267240-12267262 GTGTGGAGCAAGCGGGCAGCTGG - Intergenic
1080986811 11:37477517-37477539 GTCTGGGGCTGACAGGCAGAGGG - Intergenic
1081525986 11:43928147-43928169 ATGTTGAGCTGGAGGGGAGACGG + Intronic
1083184824 11:61011395-61011417 GTGAGCTGCTGGAGGGCAGAAGG + Intronic
1083241566 11:61392537-61392559 GAGTGCCGCGGGCGGGCAGAGGG + Exonic
1083827764 11:65212796-65212818 GTGAGGGGCTGGAGGGCAGGAGG + Intergenic
1084480040 11:69414864-69414886 CTGTGGAGCTGTTGGGGAGAAGG + Intergenic
1085442785 11:76578979-76579001 GAGTGGAGATGGGGGTCAGAGGG + Intergenic
1086752541 11:90515567-90515589 GTGGGGGGCTGGCTGGCAGGTGG + Intergenic
1088495843 11:110430397-110430419 GTGTGGGCCCGGCGCGCAGAAGG - Intronic
1089116109 11:116096466-116096488 GTGAGGAGCTGGCAGCCAGCGGG + Intergenic
1089338730 11:117743496-117743518 TTGGGGAACTGGTGGGCAGATGG - Intronic
1089628819 11:119770676-119770698 GTGTGGTGATGGCAGGCAAATGG - Intergenic
1089631183 11:119785389-119785411 GTGAGGAGCTGCCAGACAGATGG - Intergenic
1090007716 11:123017576-123017598 GCGCGGGGCTGGCGGGCAGTTGG + Intergenic
1202817740 11_KI270721v1_random:53471-53493 GTGGGGTGCTGAGGGGCAGAGGG + Intergenic
1091449206 12:562169-562191 GTGGGGAGCTGGCGGGCAGGGGG + Exonic
1091588976 12:1831777-1831799 GTGGGGAGCTGGCTGGGGGAGGG - Intronic
1091809965 12:3389016-3389038 GTGTGGTGCTGGCAAGCAGGTGG - Intronic
1093098443 12:14998822-14998844 ATGTGGAGGTGGCTGTCAGATGG + Intergenic
1093439989 12:19183794-19183816 GTTTGAACCTGGCAGGCAGAGGG - Intronic
1093612739 12:21182528-21182550 GGGAGGGACTGGCGGGCAGAAGG - Intronic
1094492882 12:30972208-30972230 GAGTGGAGCTGGAGGTCAGTGGG + Intronic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1096747384 12:53737814-53737836 GTGAGGAGAGGGCAGGCAGAGGG - Intergenic
1096977039 12:55705392-55705414 GTTGGCAGCTGGGGGGCAGAGGG + Intronic
1097085939 12:56468523-56468545 TAGGGGAGCGGGCGGGCAGATGG + Intronic
1097189888 12:57214616-57214638 GAGGGGAGCTGGCTGGCAGAGGG - Intergenic
1099049845 12:77768615-77768637 GTGGGGAGCTGCCAGGCAGAGGG + Intergenic
1100648471 12:96558040-96558062 TTGTGGAGGTGGCAGGGAGATGG + Intronic
1102018287 12:109663300-109663322 GTGTGAAGGTGGCGTGCAGCTGG - Intergenic
1102386905 12:112517444-112517466 GGGTGGAGATGGGGGGCAAATGG + Intergenic
1103398938 12:120629189-120629211 GAGTGGATCTGGAGGGCAAATGG + Intergenic
1104531151 12:129572304-129572326 GTGTGGAGCTGGCGGGCAGAGGG + Intronic
1108339949 13:49489271-49489293 GTGTGGAGATGGCGGCTAGTGGG + Intronic
1109476575 13:62887067-62887089 GTGAGGTGCTGACGGGCATAGGG + Intergenic
1112368584 13:98775481-98775503 CTTGGGAGCTTGCGGGCAGAGGG - Intergenic
1112819538 13:103315145-103315167 GGGTGGAGCAGAGGGGCAGAAGG + Intergenic
1113455718 13:110447267-110447289 GTGTCGGGCTGGCAAGCAGAGGG - Intronic
1113545152 13:111143013-111143035 GTGTGGAGCTGGGTGGCAGTAGG + Intronic
1113784567 13:112995671-112995693 GTGTGGAGGTGGCGGGCTGCTGG + Intronic
1115776399 14:36720060-36720082 GGGTGGGCCTGGCTGGCAGAGGG - Intronic
1117838266 14:59830120-59830142 GGGTGCTGCTGGTGGGCAGAGGG - Intronic
1118331791 14:64821073-64821095 GTGTGATTCTGGCAGGCAGAAGG - Intronic
1118591199 14:67402560-67402582 GTGAGGGGCTGCCGGGGAGATGG - Intronic
1119867796 14:77988603-77988625 GTGGGGAGGTGGAGGCCAGATGG + Intergenic
1121279895 14:92690685-92690707 GGGTGGAGCTGGGGTTCAGAGGG + Intergenic
1121569377 14:94936019-94936041 GTGTGCAGCAGGCCTGCAGATGG - Intergenic
1121823847 14:96994221-96994243 GTCTGGAGCTGGTGGGGAGATGG + Intergenic
1122348273 14:101073598-101073620 GTGTGGGGGTGGCGGGGAGGAGG + Intergenic
1122383907 14:101331013-101331035 GTCTGGAGCCGTCGGGCAGAAGG - Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122596430 14:102896277-102896299 TTGTGGAGCTGCTGGGCAAAGGG - Intronic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1123215960 14:106809697-106809719 CTGTGGACCTGGCAGGCTGAGGG - Intergenic
1123754389 15:23385652-23385674 GTGGGCAGCTGTAGGGCAGAGGG - Intergenic
1125433961 15:39626298-39626320 GTGTTGAGCTGGCCTGAAGATGG + Intronic
1125999407 15:44195113-44195135 GTGCGGAGCTGCCGGGCTGAGGG - Exonic
1127622827 15:60750983-60751005 GTGAGGACTTGGCTGGCAGAAGG + Intronic
1128566802 15:68706142-68706164 GTGTGGAGCAGGCTGGCTGGTGG - Intronic
1129692223 15:77720343-77720365 GCGTGGACCTGGCGGGCGGCGGG - Intronic
1130828918 15:87579763-87579785 GTCTAGAGCTGGCGGGGGGAGGG + Intergenic
1131509810 15:93043785-93043807 GTGTGGAGCTGTAGGGCTGCTGG + Intronic
1131575298 15:93583812-93583834 ATCTGGAGCTGGCGAGCAGCTGG - Intergenic
1132064854 15:98722526-98722548 ATATGGAGGTGGGGGGCAGAGGG - Intronic
1132074690 15:98810134-98810156 GTGTGGGGGTGGCTGGCGGAGGG + Intronic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132146577 15:99433071-99433093 CTGGGCAGCTGGAGGGCAGAAGG - Intergenic
1132365272 15:101252125-101252147 GACTGGAGCTGGCGGGCGGAGGG + Intergenic
1133049050 16:3106457-3106479 GTGAGGAGCAGGCGGGGCGAGGG - Intergenic
1133273803 16:4624935-4624957 GCGCGGCGCTGCCGGGCAGAGGG - Exonic
1133815195 16:9192022-9192044 GTGAGGAGCTGGGATGCAGAGGG + Intergenic
1134461974 16:14437345-14437367 GTGGGCAGCTGAAGGGCAGAGGG + Intronic
1135899241 16:26441521-26441543 GCCTGGAGCTGGAAGGCAGAAGG - Intergenic
1135928867 16:26719547-26719569 GAGTGAAGCAGGAGGGCAGAGGG - Intergenic
1136103645 16:28013342-28013364 GAGGAGAGCTGGCGAGCAGAGGG + Intronic
1136407629 16:30057726-30057748 GTTTGGGGCTGAGGGGCAGAAGG + Intronic
1137253455 16:46757042-46757064 GTGTGGTGCGGGCGGGGAGGTGG - Intronic
1137556557 16:49473980-49474002 GTGTGGAGCTGGGGTGCCCAGGG - Intergenic
1138340267 16:56284624-56284646 GTGTGCTGCTGGGGGGCAGCTGG - Intronic
1140199975 16:72887181-72887203 GAGAGGAGCAGGTGGGCAGAGGG + Intronic
1140245290 16:73242839-73242861 GTGTGGAGGTGTGGGGTAGAGGG + Intergenic
1141672236 16:85498121-85498143 GAGTGGAGCTGGCGGGAGGAGGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142260060 16:89038678-89038700 ATGAGGGGCTGGCGTGCAGAGGG - Intergenic
1142431819 16:90032676-90032698 GTGTGGTGCAGGTGAGCAGATGG + Intronic
1142560463 17:806257-806279 GGGGGGAGCTGGGGTGCAGACGG - Intronic
1142560481 17:806302-806324 GGGGGGAGCTGGGGTGCAGACGG - Intronic
1142986318 17:3697136-3697158 GTGCGGGGGTGGGGGGCAGACGG + Intergenic
1143115800 17:4581391-4581413 ATGTGGACCTGGGGTGCAGAGGG + Intergenic
1143123770 17:4627476-4627498 GTGTGGAGTTGGTCGGCGGAGGG + Intergenic
1143773555 17:9183244-9183266 GTGTTGGGCTGGCGGGCAGCTGG - Intronic
1143798291 17:9356474-9356496 GTGTGGAGCTGGCAGACACCAGG - Intronic
1143969816 17:10787474-10787496 GAATGGAGCTGGGAGGCAGATGG - Intergenic
1144033437 17:11342332-11342354 GAGGGGAGGTGGCAGGCAGAGGG + Intronic
1144853980 17:18258190-18258212 GGGTGGCGGTGGCGGGGAGAGGG + Intronic
1145825629 17:27875287-27875309 GTGTGGAGCAGGCAGGCACAAGG - Intronic
1145937954 17:28726192-28726214 GTGTGGGGCTGGCGGCCGGCGGG - Exonic
1146499169 17:33349562-33349584 GGGTGGAGCTGGAGGGCATTCGG - Intronic
1146635613 17:34502103-34502125 GAATGGATCTGGAGGGCAGATGG + Intergenic
1147467784 17:40624652-40624674 GTGTGGAGGTGGCTGACCGAGGG + Intergenic
1147783819 17:42963690-42963712 TAGTGGTGCTGGGGGGCAGAGGG - Intronic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1148146414 17:45367708-45367730 GGGTGGGGCAGGCGGGGAGAGGG + Intergenic
1148784464 17:50139309-50139331 ATCTGGAGCTGTTGGGCAGAGGG + Exonic
1149626381 17:58083452-58083474 GTGCGGAGCGGGCGGGCGGGCGG + Exonic
1150259119 17:63774129-63774151 GTGAGGAACGCGCGGGCAGAAGG - Exonic
1150295585 17:64005635-64005657 ATCTGGAGCTGATGGGCAGATGG - Intronic
1150724332 17:67639303-67639325 GTGTGGAGCTGGCACTCAGTAGG - Intronic
1151308383 17:73278717-73278739 GAGTGGTGCTTGCAGGCAGATGG - Intergenic
1151893104 17:76962770-76962792 GAGTGGTGCTTGCGGGCAGCAGG - Intergenic
1151965711 17:77430194-77430216 GGATGGAGCTGGCGGGGGGAGGG - Intronic
1152284316 17:79403519-79403541 CTGTGGAGCTGTGGGGCTGACGG - Intronic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1153001957 18:463950-463972 GGGTGGAGCTGTAGGGCATAGGG - Intronic
1153519448 18:5938069-5938091 GTCTGGAGCTAGGGGGCAGGGGG + Intergenic
1153543750 18:6185321-6185343 GTATGGATCTGGAGGGGAGAAGG - Intronic
1154109488 18:11553558-11553580 GTGAGGAGCAGGTGGGCAAAGGG + Intergenic
1155401564 18:25445557-25445579 GTGTGGAGCAGGAAGGCAGAGGG + Intergenic
1157444608 18:47735275-47735297 GTGGGGAGTGGGCTGGCAGAGGG - Intergenic
1157566428 18:48681744-48681766 GTGTGGGGCAGGCAGGCAGGTGG - Intronic
1157575101 18:48738444-48738466 GTGTGAAGGGGGAGGGCAGATGG - Intronic
1158951498 18:62499432-62499454 GTGAGGAGGGGGCGGGCTGAGGG + Intergenic
1160900210 19:1424204-1424226 GGCTGGAGCGGGCGGGCCGAGGG - Intronic
1161313845 19:3608832-3608854 GTGAGGGGCTGGGGGGCAGATGG + Intergenic
1161398534 19:4057820-4057842 GGGTGGAACTGGCGGGAAGTAGG - Intronic
1161592527 19:5135279-5135301 GTGTGGGGCAGGCGGGCGGGCGG - Intronic
1162418561 19:10552870-10552892 CTGAGGACCTGGCGGGAAGAGGG - Exonic
1162728111 19:12701862-12701884 GTGAGCAGCTGGAGGTCAGAGGG + Intronic
1162794815 19:13081587-13081609 GAGGGGAGCTGCCGGTCAGAGGG - Intronic
1163453956 19:17395096-17395118 GTGGCGAGCAGGCGGGAAGACGG - Intergenic
1163807217 19:19406354-19406376 GGGTGGAGGCGGCGGGAAGACGG + Intronic
1164695046 19:30237116-30237138 GTGTGGATCTGGGGGACAGCAGG + Intronic
1164823760 19:31269024-31269046 GTGTGGACCTGCTGGGCAGCAGG - Intergenic
1164974743 19:32563960-32563982 CTGTGGAGCTGGCGGGTTGTCGG - Intergenic
1165018058 19:32898401-32898423 GTGGGGGGCTGGGGGGCAGGTGG + Intronic
1165349580 19:35268754-35268776 GCGTGCAGCGGGCGGGCAGCTGG + Intergenic
1166199957 19:41231064-41231086 GTGGGGAGCTGGGCGTCAGAGGG + Intronic
1166349800 19:42191143-42191165 GGGTGGACCTGGAGGGCAAATGG - Intronic
1166428175 19:42698148-42698170 ATGTGGAGCCGGAGGGCAGCCGG - Intronic
1166529696 19:43535014-43535036 GTGGGGAGCTGGGGGACAGGAGG - Exonic
1167510018 19:49890943-49890965 GGGCGGGGCTGGCGGGCAGGGGG - Intronic
925306138 2:2849264-2849286 CTGTGGAGGGGGCAGGCAGATGG - Intergenic
926287482 2:11501272-11501294 GTGGGGAGCTGAGAGGCAGAAGG + Intergenic
927095141 2:19742627-19742649 GTGGGGAGCTGGGGGCCAGCAGG - Intergenic
928626210 2:33142467-33142489 GCGTGGTGGTGGTGGGCAGAGGG + Intronic
929311332 2:40429464-40429486 GTATCGAGCTGGCAAGCAGAGGG - Exonic
929668619 2:43852487-43852509 GTGAGGGCCTGGGGGGCAGATGG + Intronic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
932594211 2:73084081-73084103 CTGGGGAGCTGGCCGGGAGAGGG - Intronic
932784659 2:74589615-74589637 GTGTGGTGCTGGCAGGCAGTGGG + Intronic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
934097518 2:88620267-88620289 GTGTGGAGCTGGGAAGGAGAGGG - Intronic
934608577 2:95717366-95717388 GTGTGCAGCTGGTGTGGAGAGGG + Intergenic
934778095 2:96951477-96951499 GCGGGGAGCTGGGAGGCAGAGGG + Exonic
936556942 2:113504011-113504033 GAGTGGAGCTGGCGGCCACTGGG + Intergenic
938069262 2:128299926-128299948 GGGTGGCTCTGGTGGGCAGAGGG + Intronic
938163847 2:129009423-129009445 GAGTGGAGCAGGTGGGAAGAAGG + Intergenic
939577280 2:143911466-143911488 GTCAGGAGCTGGCTGGCAGAAGG - Intergenic
942424676 2:175847120-175847142 GCCTGGAGCTGGTGGGGAGAAGG + Intergenic
946021627 2:216644219-216644241 ATGTGGGGCTGGCAGCCAGAAGG - Intronic
948517247 2:238511535-238511557 GTCTGGAGCTGGCAGGCGGGGGG + Intergenic
948902613 2:240964056-240964078 GTGCAGAGCTGGGGAGCAGAGGG + Intronic
948915598 2:241033720-241033742 GTGTTGACCTGCCGGGGAGAGGG - Exonic
948920550 2:241064154-241064176 GCGGGGAGCAGGCGGGCAGAGGG - Intronic
948920558 2:241064176-241064198 GCGGGCAGCAGGCGGGCAGAGGG - Intronic
948920565 2:241064198-241064220 GCGGGGAGCAGGCGGGCAGAGGG - Intronic
948920573 2:241064220-241064242 GCGGGGAGCAGGCGGGCAGAGGG - Intronic
1169132449 20:3173251-3173273 GGGGGGAGGTGGCGGCCAGAGGG - Intronic
1171029418 20:21663894-21663916 GTATGGAGCTGGAGGGAAGGAGG + Intergenic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1172031494 20:31985170-31985192 GGGTGGGGCTGGGAGGCAGATGG - Intronic
1172115649 20:32572008-32572030 GTGTGAATCTGCCTGGCAGAGGG - Intronic
1174292495 20:49519129-49519151 GTGGGGTGGTGGGGGGCAGACGG - Intronic
1175252361 20:57617129-57617151 GACTGGAGCTGGCGGGCCAACGG - Intronic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1176182375 20:63756719-63756741 GTGTGGTGATTGAGGGCAGAGGG - Intronic
1176371844 21:6067068-6067090 GGGTGGAGCTGGTCGGCAGTGGG + Intergenic
1176427323 21:6556832-6556854 GTGTGCAGGTGGCGGGCAGGGGG - Intergenic
1178375959 21:32067677-32067699 GAGGAGAGCTGGGGGGCAGAGGG + Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179482351 21:41686133-41686155 GTGTGGGGCAGGTGGGCAGTGGG + Intergenic
1179553840 21:42160204-42160226 GGATGGAGCAGGAGGGCAGAGGG - Intergenic
1179702814 21:43165149-43165171 GTGTGCAGGTGGCGGGCAGGGGG - Intergenic
1179721154 21:43316591-43316613 CCGTGGAGCTGGGGGGCTGAGGG + Intergenic
1179751675 21:43471471-43471493 GGGTGGAGCTGGTCGGCAGTGGG - Intergenic
1179904269 21:44414085-44414107 GGGTGGGGCTGGCGTGCAGGTGG + Intronic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1182015105 22:27032674-27032696 ATCTGGCGCCGGCGGGCAGATGG - Intergenic
1182466706 22:30521335-30521357 AGGTGGAGCTGGCAGCCAGATGG + Intergenic
1183526737 22:38327564-38327586 GAGTGGAGCAGGAGGACAGAGGG - Intronic
1183665719 22:39244685-39244707 GCGGCGAGCGGGCGGGCAGACGG - Exonic
1183777032 22:39972948-39972970 GTGTGGAGTTGGTGGGCAGATGG + Exonic
1184115145 22:42417804-42417826 GGGTGGAGCAGGAGGGCAGCAGG + Intronic
949259769 3:2091704-2091726 GTGCTGAGCTGGCAGGGAGAAGG + Intergenic
950158196 3:10739564-10739586 GTCTAGACCTGGCGGACAGAGGG + Intergenic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950786539 3:15441234-15441256 GGGTAAAGCTGGAGGGCAGAGGG - Exonic
952340092 3:32438190-32438212 GGTTGGAGCTGGCGGGAGGAGGG + Intronic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
954446517 3:50549785-50549807 GTGGGCAGCTGGGGGACAGAAGG - Intergenic
954464556 3:50646868-50646890 GAGTGGGGCTGCCGGGCAGGAGG + Intronic
955898562 3:63726963-63726985 GATTGGAGCTGGCTTGCAGAAGG - Intergenic
958263071 3:91404786-91404808 GTGTGGTACTGGCTGGCATAAGG + Intergenic
960928755 3:122822954-122822976 GTGGGGAGGTGGAGGGCGGATGG - Intronic
961116661 3:124335569-124335591 GGGGGGAGCTGGCTGGGAGATGG + Intronic
961357289 3:126347097-126347119 GTGCTGAGCTGTAGGGCAGAGGG + Intronic
961372453 3:126439963-126439985 GGGAGGAGCTGGAGAGCAGAAGG - Intronic
961509433 3:127391958-127391980 AGGAGGAGCTGGAGGGCAGAGGG + Intergenic
962382239 3:134907647-134907669 GTGGGGAGGGGGCGGGCAGGGGG - Intronic
963214114 3:142724900-142724922 GTGTGGAGCTGGCGGGAGAGTGG + Intronic
964524927 3:157607938-157607960 GTGTGTAGATGGTTGGCAGAAGG - Intronic
966241168 3:177756787-177756809 GTGTGGAACTGTCAGGTAGAAGG - Intergenic
966624850 3:182004844-182004866 CTGTGGAGCTGGCAGGAAGAAGG - Intergenic
966888041 3:184387391-184387413 GACCGGAGCTGGCGGGCAGCGGG + Exonic
966912950 3:184569433-184569455 GACTGGAGCTGGCGGGCGGTGGG - Intronic
968292676 3:197550793-197550815 TTCTGGAGCTGGGGGGCAGATGG - Intronic
969529993 4:7725314-7725336 GTGGGGAGCCTGCGGGAAGAAGG - Intronic
969644532 4:8419807-8419829 GTGTGGAACTGGGGTGCAGGAGG - Intronic
969682241 4:8649781-8649803 CTGTGGGGCAGGCGGGCAGCGGG - Intergenic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
970171589 4:13295956-13295978 AGGTGGAGCTGGATGGCAGAGGG - Intergenic
975668033 4:76753438-76753460 GAGTGGATCTGGAGTGCAGATGG - Intronic
980009444 4:127579681-127579703 GGGAGGGGCTGGCGGGCAGGTGG - Intergenic
981509866 4:145544197-145544219 GTGTGGGGGTGGGGGGCATATGG + Intronic
982100722 4:151965242-151965264 GAGCGGACCTGGCGGGCAAAGGG - Intergenic
984329626 4:178298069-178298091 GTGTGGGGCGGGGGGGCAGTCGG + Intergenic
984521024 4:180801111-180801133 GTATGGAGGTGGCGGCCAGGGGG - Intergenic
984615920 4:181897120-181897142 CTTTGGAGCTGGCAGGCTGAAGG - Intergenic
985200152 4:187476274-187476296 GTGTGGTGGTGGCAGGGAGATGG - Intergenic
985543857 5:499611-499633 GTCTGGAGATGGCGGACAGAGGG - Intronic
985720436 5:1486005-1486027 GCTTGGAGCTGGCAGGCAGGTGG + Intronic
990287530 5:54314656-54314678 CTTTGGAGCTGGGGGGTAGAAGG - Intergenic
990414180 5:55570556-55570578 ATGTGGAGCCACCGGGCAGATGG - Intergenic
990449466 5:55921088-55921110 GTGTGGATCTAGAAGGCAGAGGG - Intronic
992470116 5:77043783-77043805 GTGGGCAGCTGCCGGGCGGAGGG + Intronic
993467778 5:88269141-88269163 GTGGGGAGCGGGAGGGGAGAGGG + Intronic
993500403 5:88660470-88660492 GTGTGGTGGTGGCGGGGAGGGGG + Intergenic
996412374 5:123172208-123172230 GGATGGAGGTGGCGGGGAGAGGG + Intronic
996690743 5:126337289-126337311 GTGTGGAGTTGGCGAGGGGAAGG + Intergenic
997777472 5:136624115-136624137 GTGTGGTGGTGGTGGGCAGTGGG - Intergenic
998152478 5:139765175-139765197 GTGTGAAGATAGCGAGCAGAAGG - Intergenic
999318851 5:150601089-150601111 GTGAGGAGCAGGCGGGCAGGCGG + Exonic
1002085909 5:176775213-176775235 GTGTGGTGTTGGTGGGAAGACGG - Intergenic
1002167471 5:177357435-177357457 ATGTGCAGCTGCCGGGGAGAGGG + Intergenic
1002695448 5:181085478-181085500 GTGAGGAGCGGGCGGGCTGGGGG - Intergenic
1004384319 6:15159274-15159296 GTGGGGAGCTGGGGGGTACAAGG + Intergenic
1004817115 6:19323646-19323668 GTATGGAGCTGGAGGGTAAATGG - Intergenic
1005453164 6:25992994-25993016 GTCTGGGGCTGGCGGGGACAGGG + Intergenic
1006105771 6:31715444-31715466 CGGTGGAGCCGGCTGGCAGAAGG - Intronic
1006472127 6:34235375-34235397 GCGGGGAGCCGGCGCGCAGAGGG + Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007167064 6:39836124-39836146 CTGTGAATCTGGCCGGCAGAGGG - Intronic
1007236941 6:40397303-40397325 ATGTGGAGTTGGAAGGCAGAGGG - Intronic
1007242505 6:40437235-40437257 ATGCAGAGCTGGCGGGGAGAGGG - Intronic
1007412656 6:41673917-41673939 CTGTGTTGCTGGGGGGCAGATGG - Intergenic
1007466910 6:42058938-42058960 GTGTGTGGTTGGGGGGCAGAGGG + Intronic
1007634045 6:43287431-43287453 GTTTGGAGCTGGGAGGAAGAAGG + Exonic
1007777197 6:44230390-44230412 CCGTGTAGCTGGCAGGCAGAAGG - Exonic
1008427905 6:51380678-51380700 GTGTGGGACTGGTGGACAGAAGG + Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1008992336 6:57618102-57618124 GTGTGGTACTGGCTGGCATAAGG - Intronic
1009180960 6:60517214-60517236 GTGTGGTACTGGCTGGCATACGG - Intergenic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1012932300 6:105329900-105329922 GTGTGGAGATGGAGGGGAAATGG + Intronic
1013614969 6:111834481-111834503 GATTGGAGCTGGGAGGCAGAAGG - Intronic
1014928957 6:127310095-127310117 GTGTGGAGTTGGCAGGGGGATGG + Intronic
1015325765 6:131921695-131921717 GTGGGGGGCTGGCGGGGAGGTGG + Intergenic
1016269390 6:142271155-142271177 GTGTGGTGCTGGAGGGGGGAAGG - Intergenic
1017739955 6:157398023-157398045 CTGGGGAGCTGGGGGGCTGAGGG - Intronic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018837244 6:167494250-167494272 GTGTGGAGCTGCCTGGGAGGAGG + Intergenic
1019140114 6:169937644-169937666 ATGTGGGGCCGGCGGGCAGGTGG - Intergenic
1019343691 7:519843-519865 GTGTGGAGCCGGCCGGCGGCGGG + Intronic
1019415392 7:924539-924561 GCGTGGACCTGGAGGGCAGGGGG - Intronic
1019575611 7:1736259-1736281 GTGTGGGGGAGGCGGGGAGATGG - Intronic
1019643358 7:2116244-2116266 GGGTGCAGCTGGAGGGCAGGCGG + Intronic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1020285789 7:6679355-6679377 GTGTTGATCTGGCAGGCACATGG + Intergenic
1021174667 7:17437428-17437450 GTGGGGAATTGGAGGGCAGAAGG + Intergenic
1021654408 7:22860977-22860999 GTGTGGAGCTGTCCTGGAGATGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022622839 7:32002356-32002378 CCATGGAGCTGGCGGGCTGATGG + Intronic
1023247802 7:38224603-38224625 GTGTGGATCTGCTGGACAGAGGG - Intronic
1023697104 7:42858866-42858888 GGGAGGAACTGGCAGGCAGAGGG - Intergenic
1024046521 7:45589301-45589323 GTGTGGTGGTGGTGTGCAGATGG + Intronic
1024278510 7:47698485-47698507 TTGAGGAGCTTGTGGGCAGAGGG + Intronic
1026447525 7:70498575-70498597 GTGGGGGGTTGGTGGGCAGAAGG + Intronic
1026889799 7:73975130-73975152 GTCTGGAACTGGTGGGGAGAAGG - Intergenic
1026910601 7:74089681-74089703 GTGTTGAGCTGGAGGGGACATGG + Intronic
1027001559 7:74657945-74657967 GAGGGGAGCTGGCGAGCGGACGG - Intronic
1029277904 7:99418477-99418499 GTGTGGAGCTGGGGAAAAGAAGG - Exonic
1030772372 7:113490082-113490104 TTGTGGGGCAGGGGGGCAGAGGG + Intergenic
1033016635 7:137678269-137678291 GTGTGTTGGTGGGGGGCAGAGGG - Intronic
1034256850 7:149729349-149729371 GTGTGGAGGTGGCTCCCAGAGGG + Exonic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034426432 7:151016605-151016627 GTGGGGAGCTGGGGCGCTGAGGG - Intronic
1035034612 7:155886668-155886690 GGGTGGGGCTGGCGGGGTGAAGG + Intergenic
1035573945 8:692573-692595 GTGTAGAGCCGTCGGGCAGTCGG + Exonic
1035816305 8:2544867-2544889 GTGTGGATCTGCTGGGCATAGGG + Intergenic
1036184809 8:6613781-6613803 GTGTGGAGCTGGCTTGTGGACGG + Intronic
1036469625 8:9040866-9040888 GCTTGGTGCTGGCGGGCTGATGG - Intronic
1036575851 8:10027172-10027194 GTGAGGAAATGGCGGGGAGAAGG - Intergenic
1037386409 8:18347422-18347444 GTGTGCAGGTGGAGGGGAGATGG + Intergenic
1037901585 8:22692234-22692256 GTGTGGGGACGGCGGGGAGAAGG - Intronic
1039961903 8:42254832-42254854 CTGTGGGGCGGCCGGGCAGAGGG - Intergenic
1040834823 8:51720802-51720824 GTGGGGAGCTGGCAGCAAGAGGG - Intronic
1043028928 8:75106656-75106678 CTGTGGAGATGGCTGGCAGTTGG + Intergenic
1044727078 8:95202665-95202687 GTGTGGAGATGCTGGGCAAAGGG + Intergenic
1045510089 8:102806933-102806955 GCGGGGAGCTGCCGGGCAGGCGG + Intergenic
1046454538 8:114440901-114440923 GGGAGGGGCTGGTGGGCAGAAGG - Intergenic
1049038071 8:140092034-140092056 AAGTGGAGCTGGCCGGCAGGAGG - Intronic
1049435123 8:142583035-142583057 GTGTGAGGCTGGGGGACAGAAGG + Intergenic
1049687770 8:143945821-143945843 GTGTGGGGCTGGAGAGCAGGAGG - Intronic
1049896059 9:113290-113312 GAGTGGAGCTGGCGGCCACTGGG - Intergenic
1050523364 9:6524692-6524714 GTGTGAACCTGGGAGGCAGAGGG - Intergenic
1051172924 9:14337730-14337752 GTGTGGAGCCCGAGGCCAGATGG - Intronic
1051475664 9:17505902-17505924 GTGTGGTGCTGGCAGGTAGAGGG + Intergenic
1051932714 9:22406240-22406262 GGGAGGAGCTGGCAGGCAGGAGG - Intergenic
1053522190 9:38791491-38791513 GTGTGGAGGGGGTGGGAAGAAGG - Intergenic
1053804495 9:41787412-41787434 GTGTGGAGATGAGGGGCACATGG - Intergenic
1054140788 9:61528050-61528072 GTGTGGAGATGAGGGGCACATGG + Intergenic
1054625995 9:67398669-67398691 GTGTGGAGATGAGGGGCACATGG + Intergenic
1056624889 9:88245226-88245248 GGGTGTGGCTGCCGGGCAGAGGG + Intergenic
1056964058 9:91151702-91151724 GTGTGCAGATGGTGGGCAGTGGG - Intergenic
1057161974 9:92895333-92895355 ATGTGGGGCTGCCGGGCAGCTGG + Intergenic
1057163660 9:92909169-92909191 GTGGGGAGGGGGCTGGCAGATGG - Intergenic
1057194485 9:93109274-93109296 GTGTGAAAATGGCAGGCAGATGG - Intronic
1057385935 9:94606037-94606059 GTGCGGAGCTTGGGGGCAGGAGG + Intronic
1058993898 9:110280828-110280850 GTGTGTAGGTGGGGGTCAGAGGG + Intergenic
1059104661 9:111501252-111501274 CTGTGGAGCTGGCTGGGAGCAGG + Intergenic
1059402937 9:114081844-114081866 GTCTGGAGCTTGGGGACAGAAGG + Intergenic
1059471162 9:114505535-114505557 GTGGGGAGGGGGCGGGCAGGAGG - Intergenic
1061188281 9:129067849-129067871 GGCTGGAGCTGGAGGGCCGAGGG + Exonic
1061257282 9:129460218-129460240 GGGAGGAGCTGGCAGTCAGAAGG - Intergenic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061540040 9:131273304-131273326 GCTTGGAGCAGTCGGGCAGAAGG - Intronic
1061828234 9:133274991-133275013 CTGGGGAGCCGGCGGGCAGGTGG - Intronic
1061953651 9:133950289-133950311 GAGTGGAGCAGGTGGGCAGCTGG + Intronic
1062027435 9:134347009-134347031 CTGTGGAGGTGGCAGGCAGGTGG + Intronic
1062212714 9:135373233-135373255 GGGTGGGGCTGGCGGGCAATGGG + Intergenic
1062303109 9:135886945-135886967 GTGTGGAGGAGGAGGGCAGTCGG + Intronic
1185603853 X:1355778-1355800 GTGTGCTGCAGGTGGGCAGAGGG + Intronic
1186800751 X:13090253-13090275 GTGTGGATCTGGGGGATAGAAGG - Intergenic
1190360638 X:49645283-49645305 GTGTGGAGAAGCCAGGCAGAAGG + Intergenic
1190463807 X:50705771-50705793 GTGTGGAGTAGGGGGGCAGAAGG - Intronic
1192410812 X:70930806-70930828 GTTTGGAGCTGGGGTGGAGACGG + Intronic
1195229722 X:102834026-102834048 GAGTGGAGATGGGGGGAAGAGGG - Intergenic
1195308434 X:103608099-103608121 GGGTGGAGGTGGCTGGCAGTAGG + Intronic
1195668300 X:107449766-107449788 GCGGGGAGCTGGCGCGCAGGCGG - Intergenic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1199758741 X:150889247-150889269 GAGTGGATCTGAAGGGCAGATGG - Intronic