ID: 1104531791

View in Genome Browser
Species Human (GRCh38)
Location 12:129578848-129578870
Sequence TACTCACCCACTTTGCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104531790_1104531791 -4 Left 1104531790 12:129578829-129578851 CCTTCAACGGGTTGGAGCATACT 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1104531791 12:129578848-129578870 TACTCACCCACTTTGCTGACAGG 0: 1
1: 0
2: 1
3: 12
4: 111
1104531786_1104531791 20 Left 1104531786 12:129578805-129578827 CCTCAATCTCTAGTTCTATTCAG 0: 1
1: 0
2: 0
3: 18
4: 219
Right 1104531791 12:129578848-129578870 TACTCACCCACTTTGCTGACAGG 0: 1
1: 0
2: 1
3: 12
4: 111
1104531785_1104531791 24 Left 1104531785 12:129578801-129578823 CCTTCCTCAATCTCTAGTTCTAT 0: 1
1: 0
2: 0
3: 22
4: 325
Right 1104531791 12:129578848-129578870 TACTCACCCACTTTGCTGACAGG 0: 1
1: 0
2: 1
3: 12
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104531791 Original CRISPR TACTCACCCACTTTGCTGAC AGG Intronic
907470105 1:54668122-54668144 AACTCAGCCACTGTGCTGCCAGG - Intronic
911301546 1:96180532-96180554 TACCCTCACATTTTGCTGACAGG - Intergenic
911700063 1:100942203-100942225 TACTCTCATACTTTGCTGATAGG + Intronic
912643713 1:111371214-111371236 TACTCTCCCAGTTTGCTGACTGG + Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
915014238 1:152718620-152718642 GACTTACCCTCTTTGCTGATAGG - Intergenic
915039657 1:152958047-152958069 TACACACACACTTTGCTCTCAGG - Intergenic
915971553 1:160358644-160358666 TACCCAGCCACCTTCCTGACTGG + Exonic
916725634 1:167520189-167520211 CACTCAACCTCGTTGCTGACTGG - Intergenic
923682410 1:236128812-236128834 AACTCACCCAGCTCGCTGACAGG + Intergenic
1063570191 10:7208304-7208326 TACTCAAACATTTTGCTAACAGG + Intronic
1064193678 10:13228575-13228597 TACTCAGCATCTTTACTGACTGG - Intronic
1067520860 10:47003325-47003347 TACTCAGCTACTGTGCTAACAGG - Intergenic
1069857424 10:71449018-71449040 CAGTCACCCATTTTGGTGACTGG - Intronic
1070150790 10:73803592-73803614 TGCTCACCAACCCTGCTGACAGG - Exonic
1070398921 10:76035868-76035890 TTGTCATTCACTTTGCTGACAGG + Intronic
1071107653 10:82117040-82117062 TGCACACCCACTTTTCTGTCTGG + Intronic
1071758006 10:88567644-88567666 TAGTCTCCCACTTTGCCTACAGG + Intronic
1073413006 10:103358030-103358052 CACTCTCACACATTGCTGACAGG + Intergenic
1073514353 10:104063767-104063789 TGCTCACCCACTTTGCACCCTGG - Exonic
1075687298 10:124373236-124373258 CACTCTCTCACTTTGCTGATGGG - Intergenic
1079885909 11:25988387-25988409 TACTAATCCACTATGCTGGCAGG - Intergenic
1085120837 11:73966377-73966399 ATCTCACCCACTCTGCAGACTGG - Intronic
1090149975 11:124374049-124374071 TTCTCAGCCACTTTGCCAACTGG + Intergenic
1097496114 12:60337346-60337368 AACTCTCACACATTGCTGACAGG - Intergenic
1104531791 12:129578848-129578870 TACTCACCCACTTTGCTGACAGG + Intronic
1107281637 13:38743101-38743123 AGCTCATCCACCTTGCTGACAGG + Intronic
1110995538 13:82103224-82103246 TATTCACCCACTTTGTTTACTGG + Intergenic
1117116385 14:52517551-52517573 TACCCACCCACTTGGCTGAATGG + Intronic
1117653803 14:57933560-57933582 GACTCAGCCACTCAGCTGACTGG - Intronic
1126711522 15:51462147-51462169 CACTCACCCACTTACCTGAATGG - Intronic
1129881614 15:79010380-79010402 CACTCTCCCATTTTGCAGACAGG - Intronic
1132997654 16:2831558-2831580 GTCACACCCACTTTGCAGACGGG + Intronic
1135235261 16:20749465-20749487 TTTTCACCCCCTTTGCTGTCAGG + Intronic
1135281550 16:21157708-21157730 TTCTCAGCCACTTTCCAGACAGG - Intronic
1135978621 16:27128840-27128862 TAGTCACCAGCTTTGGTGACAGG - Intergenic
1137368970 16:47887152-47887174 CTCCCACCCACTTTCCTGACAGG + Intergenic
1138409234 16:56825008-56825030 TTCTGACTCATTTTGCTGACTGG - Intronic
1139961377 16:70719752-70719774 AACTCTCCCACAATGCTGACGGG + Intronic
1141428356 16:83957723-83957745 CACTCACCCACAATGATGACCGG - Exonic
1142281308 16:89149400-89149422 TTCTCAGCCACTTTGCCAACCGG + Intronic
1142917839 17:3156905-3156927 TACTCACCTACTTTGCTACTTGG - Intergenic
1145004324 17:19328898-19328920 CACTCACCCACTTTCCTGCCTGG + Intronic
1146081693 17:29786139-29786161 TGATGACCCACTTTGCTGACCGG - Intronic
1148627134 17:49078178-49078200 TTCTCAGCCACTTTGCCAACAGG - Intergenic
1149411721 17:56415097-56415119 GACTCACAGCCTTTGCTGACTGG + Intronic
1150122604 17:62616581-62616603 AACTCACCCACTTGGAAGACAGG + Intergenic
1151215876 17:72576001-72576023 TACTCACCCACTCCGCGGACTGG - Intergenic
1156627476 18:38926476-38926498 TCCTCCCCCACTTTCCTGACAGG + Intergenic
1158021011 18:52841682-52841704 TCCAGACCCACTTTGCTGGCTGG + Intronic
1160115886 18:76078979-76079001 TACTCCCCCACCTTGCTTGCGGG - Intergenic
1162370009 19:10272924-10272946 TACTCACCCACCTTACAGATGGG + Intronic
1167661350 19:50797803-50797825 TACCCACCCACCCTGCTGCCTGG + Exonic
925213432 2:2071419-2071441 TACTCACCAAGTTTACTGTCTGG + Intronic
925737451 2:6976216-6976238 TACTCACACACCTTACTGGCTGG - Intronic
926505988 2:13716669-13716691 TATTCACCCACTTAGTTTACCGG + Intergenic
926660084 2:15455238-15455260 TACTCAAGAACTTTGCTCACTGG - Intronic
926969830 2:18455455-18455477 CAGTCACCCACCTTGCTGACAGG + Intergenic
928385319 2:30862703-30862725 GATTCACCCACTTTTCTGCCAGG + Intergenic
931775362 2:65535856-65535878 TGATCATCCACTTTGCTGATAGG + Intergenic
933304596 2:80581561-80581583 TACTCACCCACATAGCTGTGTGG + Intronic
937225327 2:120365519-120365541 TATTAGCCCACTTTGCTGATGGG - Intergenic
944029740 2:195220725-195220747 TTCTCACACACATTGCTGATAGG + Intergenic
944661415 2:201924680-201924702 TACCCAGCCACTTGGCTGACGGG - Intergenic
945520262 2:210818778-210818800 TCCTCACCCACTTTGCAGTTAGG - Intergenic
1168763537 20:366155-366177 TACTCACATGCTTTGCTGGCAGG + Intronic
1169096903 20:2909026-2909048 TAATCAGCCACTGTACTGACTGG - Intronic
1172870012 20:38130014-38130036 CACTCACCCCCTTTGCTGTGAGG - Exonic
1173540471 20:43847397-43847419 TACTCATCCACTTCCCTGCCTGG - Intergenic
1174419853 20:50392263-50392285 TGCTCACCCCCTTTTCAGACGGG - Intergenic
1181594529 22:23905779-23905801 TACTGGGCCACTTTGCTCACTGG + Intergenic
950450014 3:13060223-13060245 TACTCTCCCATGGTGCTGACTGG - Intronic
956209711 3:66790171-66790193 TTCTCCCCCACATTGCTGACTGG + Intergenic
959000852 3:100962697-100962719 TATTCTCCCACTTCTCTGACTGG + Intronic
959024039 3:101219907-101219929 TTCTCAGCCACTTTGCCAACTGG - Intergenic
961582055 3:127891299-127891321 TCCTCACACACTGTGGTGACGGG + Intergenic
962875141 3:139530334-139530356 TACTCTCCCATTTTACAGACAGG - Intronic
963107219 3:141657623-141657645 TTCTCAGCCACTTTGCCAACTGG - Intergenic
964886370 3:161488261-161488283 TACTCACACCCTTTGCTAAATGG + Intergenic
964886659 3:161491263-161491285 TACTCACACCCTTTGCTAAATGG - Intergenic
965878029 3:173352085-173352107 ATCTCTCCCACTTAGCTGACTGG - Intergenic
972651139 4:41018873-41018895 TCCTCTCCCACTTTCTTGACTGG - Intronic
973773287 4:54225570-54225592 TCCGCACCCACCTTGCTGGCTGG - Intronic
983335040 4:166380012-166380034 TAAGCACACACTTTGATGACTGG + Intergenic
984933651 4:184870498-184870520 TGCTCACCCACATTGGTGAGGGG - Intergenic
986063458 5:4213193-4213215 TAATCACCTAATTAGCTGACTGG - Intergenic
989737568 5:44727268-44727290 CACTCAATCACTTTGCTCACAGG - Intergenic
992215684 5:74522817-74522839 TACACACCCACTTTGCAGTGTGG - Intergenic
992435791 5:76755057-76755079 CAGTCACCCACTGTGCTAACGGG + Intergenic
993987555 5:94615543-94615565 TACTTACCCACTGTGCTGTAAGG + Intronic
998156345 5:139788942-139788964 GACTCACACTCTTTGCTCACTGG - Intergenic
998638095 5:143979489-143979511 TAGTCACCTGTTTTGCTGACAGG - Intergenic
999103183 5:149044614-149044636 TACTGACCAACCTTGCTGAGAGG + Exonic
1000106227 5:158061572-158061594 AACTCCCCCACTTTTCTCACAGG - Intergenic
1003564013 6:7207292-7207314 TGCTCAGCCACTTTGCAGAAAGG + Intronic
1005725407 6:28642930-28642952 TACTCACCCAATCTACTGAGTGG + Intergenic
1009640807 6:66333498-66333520 AACTCTCCTACTTTGCTGACGGG + Intergenic
1012851426 6:104450609-104450631 TTCTCAACCACTTTGCTTCCTGG - Intergenic
1013282952 6:108655944-108655966 TGCTCACCCACTTTGTGTACAGG - Intronic
1018086525 6:160305735-160305757 AACTAACCCATTTTGCAGACAGG + Intergenic
1020039416 7:4990352-4990374 TTTTCACCCACATTGCTGTCAGG + Intronic
1020155885 7:5724097-5724119 TTTTCACCCACATTGCTGTCAGG - Intronic
1027339323 7:77189191-77189213 TCCTCACACACTTTGCAGACAGG + Intronic
1030963589 7:115959240-115959262 TTCTCTCTCACTTTGTTGACTGG - Intronic
1031091583 7:117362473-117362495 TACCCAAGCACTGTGCTGACTGG + Intergenic
1033408425 7:141093187-141093209 TAGTCACCATCTTTGCTGGCTGG - Intronic
1035994186 8:4527456-4527478 AACTCACCAACTTTGCAAACAGG - Intronic
1037797216 8:22005995-22006017 GACTCACCCACATTGCTCCCAGG - Exonic
1038902914 8:31864354-31864376 TACTCACCAACTGTGCTAACTGG + Intronic
1039244408 8:35593133-35593155 TACTTACCTATTTTGCTGAGAGG + Intronic
1044898231 8:96915864-96915886 TCCTCTCCCACTTTGCATACAGG + Intronic
1045821672 8:106345605-106345627 TACTCACCAACTTTCTTCACAGG - Intronic
1047314746 8:123722594-123722616 TACATACACACTTTGCTCACTGG - Intronic
1047855508 8:128905594-128905616 TACTCAACCAATTAGCTGAAGGG + Intergenic
1051408964 9:16769394-16769416 TTCTCTCCCATTTTACTGACAGG + Intronic
1056194755 9:84218557-84218579 TACTCCTCCACATTGCTGGCAGG - Intergenic
1057256597 9:93554199-93554221 TAATCTCCAAATTTGCTGACAGG - Intronic
1059907204 9:119000972-119000994 TACTTCCCCAGTTTGCTGAGGGG - Intergenic
1061001442 9:127905084-127905106 TCCTCAGCCACTCTGCTGAGGGG + Intronic
1061582862 9:131548116-131548138 TGCTCACCCACATTGCAGCCAGG + Intergenic
1189147473 X:38669904-38669926 GACTCTCCCATTTTGCTGATGGG - Intronic
1189170428 X:38904020-38904042 TACTCAGCCACTTTGGAGAGGGG + Intergenic
1197297528 X:124737234-124737256 TACTCTCCCACTTGGCAGTCAGG + Intronic
1199822418 X:151462508-151462530 TTCCCACCCACCTGGCTGACTGG + Intergenic
1200852106 Y:7893890-7893912 GTCCCACTCACTTTGCTGACAGG + Intergenic