ID: 1104532916 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:129589346-129589368 |
| Sequence | GACCCACAGTTCCACGTGAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 14459 | |||
| Summary | {0: 1, 1: 51, 2: 946, 3: 5255, 4: 8206} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1104532916_1104532919 | 16 | Left | 1104532916 | 12:129589346-129589368 | CCAGTCACGTGGAACTGTGGGTC | 0: 1 1: 51 2: 946 3: 5255 4: 8206 |
||
| Right | 1104532919 | 12:129589385-129589407 | CTTTACAAATTACCCAGTCTCGG | 0: 121 1: 3692 2: 4516 3: 3262 4: 3435 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1104532916 | Original CRISPR | GACCCACAGTTCCACGTGAC TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||