ID: 1104532916

View in Genome Browser
Species Human (GRCh38)
Location 12:129589346-129589368
Sequence GACCCACAGTTCCACGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14459
Summary {0: 1, 1: 51, 2: 946, 3: 5255, 4: 8206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104532916_1104532919 16 Left 1104532916 12:129589346-129589368 CCAGTCACGTGGAACTGTGGGTC 0: 1
1: 51
2: 946
3: 5255
4: 8206
Right 1104532919 12:129589385-129589407 CTTTACAAATTACCCAGTCTCGG 0: 121
1: 3692
2: 4516
3: 3262
4: 3435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104532916 Original CRISPR GACCCACAGTTCCACGTGAC TGG (reversed) Intronic
Too many off-targets to display for this crispr