ID: 1104535471

View in Genome Browser
Species Human (GRCh38)
Location 12:129614126-129614148
Sequence GGGTTCTCCAGACAGTACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104535471_1104535478 8 Left 1104535471 12:129614126-129614148 CCAGGGTACTGTCTGGAGAACCC 0: 1
1: 0
2: 2
3: 16
4: 137
Right 1104535478 12:129614157-129614179 ATCTCCAGAACCCAGGGGACTGG 0: 1
1: 1
2: 2
3: 35
4: 398
1104535471_1104535475 1 Left 1104535471 12:129614126-129614148 CCAGGGTACTGTCTGGAGAACCC 0: 1
1: 0
2: 2
3: 16
4: 137
Right 1104535475 12:129614150-129614172 GGTGACTATCTCCAGAACCCAGG 0: 1
1: 1
2: 2
3: 17
4: 148
1104535471_1104535476 2 Left 1104535471 12:129614126-129614148 CCAGGGTACTGTCTGGAGAACCC 0: 1
1: 0
2: 2
3: 16
4: 137
Right 1104535476 12:129614151-129614173 GTGACTATCTCCAGAACCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 141
1104535471_1104535477 3 Left 1104535471 12:129614126-129614148 CCAGGGTACTGTCTGGAGAACCC 0: 1
1: 0
2: 2
3: 16
4: 137
Right 1104535477 12:129614152-129614174 TGACTATCTCCAGAACCCAGGGG 0: 1
1: 1
2: 2
3: 27
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104535471 Original CRISPR GGGTTCTCCAGACAGTACCC TGG (reversed) Intronic