ID: 1104536250

View in Genome Browser
Species Human (GRCh38)
Location 12:129620809-129620831
Sequence TGGGGCCCTCTTGGGGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 739
Summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 682}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104536250 Original CRISPR TGGGGCCCTCTTGGGGGATG AGG Intronic
900374432 1:2347000-2347022 TGGGTCCTTCTTGGGAGATAGGG + Intronic
900374453 1:2347073-2347095 TGGGGAGCTCTTGGGAGATGGGG + Intronic
900621347 1:3588913-3588935 TGGGGCCCTCATGAGGGCAGGGG - Intronic
900780491 1:4614650-4614672 TGGGGACCTCCTGGGGCCTGAGG - Intergenic
901672245 1:10862782-10862804 GGGGGCAGACTTGGGGGATGAGG - Intergenic
902149628 1:14432729-14432751 CCGGGACCTCTTGGGGGTTGGGG - Intergenic
902159674 1:14519910-14519932 TGGGGCCCTCTGGGTGCCTGAGG - Intergenic
902543409 1:17170493-17170515 TGGGGGCCTGTTGGGGGTTGGGG - Intergenic
902735048 1:18394960-18394982 TGGGCCCCTCTTGGAGGCTCAGG - Intergenic
903372331 1:22844736-22844758 TGGGGGCTTCCTGGGGGATCCGG - Intronic
903833372 1:26188172-26188194 TGGGGCCCTCTTGTATGCTGGGG - Intronic
904012153 1:27395897-27395919 GGGGGGCCTGTTGGGGGATCTGG + Intergenic
904380988 1:30110980-30111002 TGGGGCTCTTTTCGGGAATGCGG - Intergenic
905793108 1:40800693-40800715 TGGGGCCAGCCTGGGGGTTGTGG + Intronic
905873365 1:41417258-41417280 TGGTGCCCTCTGGTGGCATGCGG + Intergenic
906089572 1:43167068-43167090 TGGAGCCTTCTTGGTTGATGTGG - Intronic
906214710 1:44031809-44031831 TGGGGCACTATGGGGGGCTGAGG + Intergenic
906842686 1:49157237-49157259 TGGGGCCTTCTGGGGGGTGGGGG - Intronic
908204546 1:61832162-61832184 TGGGGCCTACTTGGGGGTAGAGG + Intronic
908658347 1:66412089-66412111 TGGGGGCCTGTTGGGGGTGGGGG + Intergenic
909260739 1:73486448-73486470 TGGGGGCCTCTCAGGGGGTGGGG - Intergenic
909813767 1:79964344-79964366 CCGGGGCCTGTTGGGGGATGAGG - Intergenic
909874888 1:80789490-80789512 CTGGGACCTGTTGGGGGATGGGG + Intergenic
910041974 1:82863482-82863504 TGGGGCCTTCTTCAGGGAGGAGG - Intergenic
910421313 1:87066727-87066749 CTGGGGCCTGTTGGGGGATGGGG - Intronic
910889079 1:91998343-91998365 CTGGGGCCTGTTGGGGGATGGGG + Intronic
911366730 1:96947550-96947572 CCGGGTCCTGTTGGGGGATGAGG - Intergenic
911690407 1:100826522-100826544 CCGGGGCCTGTTGGGGGATGTGG + Intergenic
911825930 1:102485316-102485338 TGGTGTCCTCATGGGGGTTGCGG - Intergenic
912490806 1:110061641-110061663 TTGTGTCCTCTTGTGGGATGGGG + Intronic
912967285 1:114247777-114247799 CGGGGGCCTGTTAGGGGATGGGG + Intergenic
914693747 1:150055871-150055893 TGGGGCCCACTTGAGGGTGGAGG + Intergenic
915305641 1:154975913-154975935 TGGGGCCTGCTTGAGGGAGGAGG + Intronic
915357807 1:155266759-155266781 TGTGGCGCACTTGGTGGATGGGG + Exonic
916166958 1:161973130-161973152 TGGGGCCTTCCTGTGGGAGGTGG + Intergenic
917729538 1:177861073-177861095 TGGGGGCCTGTTGGGGGGTTGGG + Intergenic
917768038 1:178244730-178244752 CCGGGGCCTGTTGGGGGATGAGG - Intronic
917781822 1:178405356-178405378 TGTGGACATCTTGGGAGATGGGG - Intronic
918581992 1:186142158-186142180 TGGGGCCTACTTGAGGGAGGAGG - Intronic
918588221 1:186211944-186211966 TGGGGGCCTGTTGTGGGGTGGGG + Intergenic
919389530 1:196964820-196964842 TGGGGCCTTCTTGAGGGTGGAGG + Intergenic
919506987 1:198411576-198411598 TGGGGCACTGGTGGGGGAGGAGG - Intergenic
919806627 1:201384526-201384548 TGGGGCCCCAAAGGGGGATGAGG - Intronic
919939514 1:202276551-202276573 TGGGGTCCTGCTGGGGGCTGGGG + Intronic
921793286 1:219313981-219314003 TGGGGCCCACTTGAGGGTGGAGG - Intergenic
921840969 1:219827842-219827864 TGGGGCCCACTTGAGGGTGGAGG - Intronic
922816642 1:228453857-228453879 GAGGGCCCTCTTGGTGGCTGTGG - Intergenic
922975948 1:229783474-229783496 CTGGGCCCTCTAGAGGGATGAGG + Intergenic
924504214 1:244666026-244666048 TAGGGCCCTCTTGGGGTTTGTGG - Intronic
924537531 1:244949514-244949536 TGTTGCCCTCTTTGGAGATGAGG - Intergenic
924891750 1:248290107-248290129 TTGGGACCTTTTGGGGGGTGGGG - Intergenic
1064575240 10:16738863-16738885 TGGGGTCCGCTGGGGGGGTGGGG - Intronic
1066299378 10:34083306-34083328 TGGGGGCCTGTTGGGCGTTGGGG + Intergenic
1067479157 10:46584236-46584258 TGGGGCCTTCCTGGGGGTGGTGG - Intronic
1067615582 10:47757565-47757587 TGGGGCCTTCCTGGGGGTGGTGG + Intergenic
1068125609 10:52838857-52838879 CCGGGGCCTGTTGGGGGATGGGG - Intergenic
1068289698 10:54987019-54987041 TTGGGGCCTGTTGGGGGCTGGGG - Intronic
1069578928 10:69551938-69551960 TTGGGCCCTTTAGGGGCATGGGG + Intergenic
1069855617 10:71439437-71439459 TCTGTCACTCTTGGGGGATGTGG + Intronic
1070288361 10:75099560-75099582 TGGGGCGCCCATGGGGGGTGGGG + Intronic
1070346766 10:75551487-75551509 CTGGGGCCTGTTGGGGGATGGGG - Intronic
1070471980 10:76789713-76789735 TTGGGGCCTTTTGGGGGTTGGGG - Intergenic
1070498355 10:77046379-77046401 TGGGGTTTTCTTGGGGGGTGTGG - Intronic
1071190627 10:83095159-83095181 TTGGGGCCTCTTGGTGGGTGGGG + Intergenic
1072739211 10:97899744-97899766 TTGGGCCCTCCCGGGAGATGGGG + Intronic
1074816120 10:117141807-117141829 TGGGGCAGTCTTGTGGGGTGTGG - Intergenic
1074964844 10:118481196-118481218 TGGGGCCTTTTTGGGGGTGGGGG + Intergenic
1075179074 10:120194107-120194129 CTGGGGCCTGTTGGGGGATGGGG - Intergenic
1075789399 10:125072704-125072726 TGGGGCCCTCATGGTAGCTGGGG + Intronic
1076329445 10:129653933-129653955 TGGAGCCACCTTTGGGGATGCGG + Intronic
1076345237 10:129774859-129774881 TGTGGCCGCCTTGGGGGAGGGGG - Intergenic
1076859217 10:133132702-133132724 TGGGGCCTTCGTGGGCGACGCGG - Intergenic
1076859853 10:133135563-133135585 TGGGTCCCTGTTGGGGGGTCTGG + Intergenic
1076859904 10:133135699-133135721 TGGGTCCCTGTTGGGGGGTCTGG + Intergenic
1076859936 10:133135779-133135801 TGGGTCCCTGTTGGGGGGTCTGG + Intergenic
1076860154 10:133136371-133136393 TGGGTCCCTGTTGGGGGGTCTGG + Intergenic
1076860212 10:133136532-133136554 TGGGTCCCTGTTGGGGGGTCTGG + Intergenic
1076860291 10:133136748-133136770 TGGGTCCCTGTTGGGGGGTCTGG + Intergenic
1076860375 10:133136990-133137012 TGGGTCCCTGTTGGGGGGTCTGG + Intergenic
1076860422 10:133137126-133137148 TGGGTCCCTGTGGGGGGATCTGG + Intergenic
1076860517 10:133137395-133137417 TGGGTCCCTGTTGGGGGGTCTGG + Intergenic
1076860546 10:133137474-133137496 TGGGTCCCTGTTGGGGGGTCTGG + Intergenic
1076860658 10:133137797-133137819 TGGGTCCCTGTTGGGGGTTCTGG + Intergenic
1076860966 10:133138613-133138635 TGGGTCCCTGTTGGGGGGTCTGG + Intergenic
1076860998 10:133138693-133138715 TGGGTCCCTGTTGGGGGGTCTGG + Intergenic
1076861145 10:133139098-133139120 TGGGTCCCTGTTGGGGGCTCTGG + Intergenic
1076861166 10:133139151-133139173 TGGGTCCCTGTTGGGGGGTCTGG + Intergenic
1076861205 10:133139258-133139280 TGGGTCCCTGTTGGGGGGTCTGG + Intergenic
1076861257 10:133139398-133139420 TGGGTCCCTGTTGGGGGGTCTGG + Intergenic
1077021440 11:418855-418877 GAGGGCATTCTTGGGGGATGGGG + Intronic
1077023985 11:431390-431412 TGGGGGCGTCTGCGGGGATGTGG + Intronic
1077206725 11:1348373-1348395 TGGGGCCCTGTGGGTAGATGGGG - Intergenic
1077533464 11:3107994-3108016 TGGTGGCCCCTTGGGGGATGCGG - Intronic
1077550563 11:3198226-3198248 AGGGGTCCTCTGGGGAGATGGGG + Intergenic
1078587970 11:12610478-12610500 TGCGGCCACTTTGGGGGATGGGG - Intergenic
1078796274 11:14594912-14594934 TTGGGGCCTGTTGGGGGTTGGGG - Intronic
1079623357 11:22583265-22583287 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
1079707156 11:23635209-23635231 TGGGGTCCTGCTGGGGGATGGGG + Intergenic
1079816635 11:25068153-25068175 TGGGGGCCTGTTGGGGGCTGGGG + Intronic
1079820988 11:25127871-25127893 TGGGGGCCTGTCGGGGGGTGGGG + Intergenic
1080303036 11:30805929-30805951 CTGGGGCCTGTTGGGGGATGGGG - Intergenic
1082117248 11:48340940-48340962 CCGGGGCCTGTTGGGGGATGGGG + Intergenic
1082740703 11:56907889-56907911 TTGGGGCCTGTTGGGGGGTGCGG - Intergenic
1083486853 11:62988509-62988531 TGGTGCCCTCATGGGGGAGTGGG + Intergenic
1083617703 11:64034795-64034817 TGGGGCCCTGGTGGGGGCTCTGG + Intronic
1083711275 11:64550493-64550515 TGGGGCCCACTTGAGGGTGGAGG - Intergenic
1083822947 11:65182857-65182879 TGGGACCCTCTTCCGTGATGAGG + Exonic
1084653598 11:70502743-70502765 TGGGGCCCTACTGGGGGGGGGGG - Intronic
1084782822 11:71422220-71422242 TGGGGCCCCCTTGAGGGTGGAGG + Intergenic
1085207442 11:74744622-74744644 TGGGGCCCTGGTGGGGTTTGAGG - Intergenic
1085505008 11:77053399-77053421 TGCGCCCCACCTGGGGGATGTGG - Intergenic
1085597366 11:77821538-77821560 TGGGGCCCTGCTGGGAGAAGAGG + Intronic
1085672845 11:78485222-78485244 CTGGGGCCTATTGGGGGATGGGG + Intronic
1086946794 11:92851747-92851769 TGGTGACAGCTTGGGGGATGTGG - Intronic
1087162205 11:94959694-94959716 TTGGGCGCTCTTGGAGGGTGGGG - Intergenic
1087413832 11:97826597-97826619 TGGGGCCATCTTGAGGGTGGAGG + Intergenic
1087462606 11:98463763-98463785 CCGGGGCCTGTTGGGGGATGGGG + Intergenic
1087842819 11:102937507-102937529 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
1088176403 11:107057401-107057423 TTGGGAACTCTGGGGGGATGGGG + Intergenic
1088313545 11:108484949-108484971 GGGGGCGCTATTGGGGGATGTGG + Intronic
1088604038 11:111512231-111512253 GGGGGCCTTCTTGGGGAATGAGG + Exonic
1088621637 11:111690615-111690637 TGGGGGCCTCTTTGGGGGTGAGG - Intronic
1089028977 11:115303068-115303090 TGCCCCCCTTTTGGGGGATGAGG - Intronic
1089184510 11:116605745-116605767 TGGTGCCCTCTAGGGGACTGTGG - Intergenic
1089189904 11:116646216-116646238 TGATGCCCTATTGGGGGTTGTGG - Intergenic
1089586659 11:119513794-119513816 AGGGGCCCTCCTGGGGGAGGAGG + Intergenic
1089998679 11:122933929-122933951 TGTTGCCAACTTGGGGGATGAGG - Intronic
1090120169 11:124018355-124018377 AGGGGGCCTTTTGGGGGGTGGGG - Intergenic
1090554821 11:127862929-127862951 TGGGGCCTGCTGGGGGGTTGGGG - Intergenic
1090812630 11:130259790-130259812 GTGGGGCCTGTTGGGGGATGGGG + Intronic
1090996770 11:131873348-131873370 CCGGGGCCTGTTGGGGGATGGGG + Intronic
1090996804 11:131873811-131873833 CTGGGGCCTGTTGGGGGATGGGG - Intronic
1091164649 11:133464451-133464473 TGGGGCGCTCTGGGGCCATGTGG + Intronic
1091449113 12:561785-561807 TGAGGAGCGCTTGGGGGATGTGG - Exonic
1092129054 12:6095842-6095864 TGGGGGCCTCCTGGGGAGTGGGG - Intronic
1092274545 12:7049148-7049170 TGGGGCCCACTTGAGGGTGGAGG - Intronic
1092731773 12:11541562-11541584 TGGGGCCCTCATGATGGATCTGG - Intergenic
1093427995 12:19051141-19051163 TGGGGGCCTGTTGGGGGGTGGGG - Intergenic
1094031564 12:26017735-26017757 TGGGGTCCTCCTGTGGCATGGGG - Intronic
1094500551 12:31017173-31017195 TGGGGCCCTCATGATGGATCTGG + Intergenic
1094503628 12:31041756-31041778 TGGGGCCTGCTTGGAGGCTGAGG + Intergenic
1094694506 12:32804455-32804477 CTGGGGCCTGTTGGGGGATGAGG - Intronic
1095562519 12:43583027-43583049 GAGGGGCCTGTTGGGGGATGGGG + Intergenic
1095728730 12:45481073-45481095 TGGGGCCCACTTGAGGGTGGAGG - Intergenic
1096214057 12:49789661-49789683 TGATGCCATTTTGGGGGATGGGG + Intergenic
1096709280 12:53443495-53443517 TGGGGAGCTCCTGGGGGAGGAGG - Exonic
1097118756 12:56717531-56717553 GGGGGCCCCTTTGGGGGGTGGGG + Intronic
1097118781 12:56717600-56717622 GGGGGCCCCTTTGGGGGGTGAGG + Intronic
1097118830 12:56717738-56717760 GGGGGCCCCTTTGGGGGGTGGGG + Intronic
1097118857 12:56717807-56717829 GGGGGCCCCTTTGGGGGATGGGG + Intronic
1097118883 12:56717876-56717898 GGGGGCCCCTTTGGGGGATGGGG + Intronic
1097118908 12:56717945-56717967 GGGGGCCCCTTTGGGGGATGGGG + Intronic
1097119004 12:56718221-56718243 GGGGGCCCCTTTGGGGGATGGGG + Intronic
1097119030 12:56718290-56718312 GGGGGCCCCCTTGAGGGATGGGG + Intronic
1097119155 12:56718641-56718663 GGGGGCCCATTTCGGGGATGGGG + Intronic
1097119182 12:56718710-56718732 GGGGGCCCCTTTGGGGGATGGGG + Intronic
1097161990 12:57053166-57053188 TTGGGGCCTGTTGTGGGATGTGG - Intergenic
1097224112 12:57467028-57467050 TGGGGTCATCTTGGGGGAACGGG - Intronic
1097313278 12:58144835-58144857 TGGGGCCTACTTGAGGGCTGAGG - Intergenic
1098448775 12:70595285-70595307 CGGGGACCTGTTGGGGGGTGAGG + Intronic
1099016462 12:77349172-77349194 TATGGGCCTCTTTGGGGATGGGG + Intergenic
1099093282 12:78340147-78340169 TGGGGGCCGGTTGGGGGGTGAGG + Intergenic
1099372035 12:81846099-81846121 TGGGGCCTTCTTGAGGGTGGAGG - Intergenic
1099492605 12:83305704-83305726 TGGGGGCCTGTTGGGGGGTGGGG + Intergenic
1099920435 12:88950918-88950940 TGGGGCTTTCTTGGGAGATTGGG - Intergenic
1100130564 12:91488059-91488081 TGGGGGCCTGTCGGGGGGTGAGG + Intergenic
1100468810 12:94873092-94873114 TGGGGCGCCCTCGGGGGCTGCGG - Intergenic
1100614956 12:96223793-96223815 TGGGGCCGTCTTGGGGAGGGTGG + Intronic
1101265093 12:103076066-103076088 CCGGGTCCTGTTGGGGGATGGGG + Intergenic
1102247711 12:111365749-111365771 TCGGGGCCTGTTGGGGGATCGGG + Intronic
1102525986 12:113512645-113512667 TGGGGGCCTCTGGGGAGAGGTGG - Intergenic
1102615572 12:114151291-114151313 CCGGGGCCTATTGGGGGATGGGG + Intergenic
1102753666 12:115319216-115319238 TTGGGGCCTGTTGGGGGGTGGGG + Intergenic
1103727270 12:123004345-123004367 TGGGGCCTTCCTGGGCGAGGTGG - Intronic
1103763672 12:123267886-123267908 TGGTCCCCTCTTTGGGGAGGGGG - Intronic
1103904806 12:124321745-124321767 GTGGGCCCTCTTTGGGGATTTGG + Intergenic
1103906499 12:124330267-124330289 TGGGGCCCTCCTAGAGGATGGGG + Intronic
1104384838 12:128341717-128341739 TGCAGCCATTTTGGGGGATGAGG + Intronic
1104536250 12:129620809-129620831 TGGGGCCCTCTTGGGGGATGAGG + Intronic
1104627126 12:130366561-130366583 TGGGGCCGTCCTGGGGTCTGCGG + Intronic
1104679528 12:130739858-130739880 GGGGCCCCTCTGCGGGGATGGGG - Intergenic
1106349115 13:28910542-28910564 TGGGGCCTGCTGGGGGGCTGGGG - Intronic
1106473351 13:30077202-30077224 TGGGGACATCTTTGGGGGTGGGG + Intergenic
1106686907 13:32069867-32069889 CCGGGGCCTCTTGGGGGGTGGGG - Intronic
1107095462 13:36530583-36530605 TGTGGCCATCTTGGGAGGTGAGG + Intergenic
1107437526 13:40393398-40393420 CGGGGGCCTATTGGGGGGTGAGG + Intergenic
1108384396 13:49885667-49885689 CTGGGGCCTGTTGGGGGATGGGG + Intergenic
1109016744 13:57025411-57025433 CTGGGGCCTGTTGGGGGATGTGG - Intergenic
1110052948 13:70926856-70926878 TTGGGACCTGTTGGGGGATGGGG + Intergenic
1110406728 13:75159303-75159325 TGGGGCCTGCTTGAGGGAGGAGG + Intergenic
1110470694 13:75856432-75856454 TGGGGCACTCCTGGGGGTGGGGG - Intronic
1112437998 13:99405287-99405309 GGGGGCAGTCTTGTGGGATGGGG - Intergenic
1112945312 13:104920303-104920325 TGTGGCTCTTGTGGGGGATGGGG - Intergenic
1113049464 13:106193354-106193376 CCGGGGCCTGTTGGGGGATGAGG + Intergenic
1113613632 13:111665552-111665574 TGGGCCCCTCTGCGGGGCTGGGG + Intronic
1113969110 13:114175211-114175233 TGGGGTCTTTGTGGGGGATGGGG - Intergenic
1115671890 14:35622351-35622373 TTGGGGCCTGTTGGGGGATTGGG + Intronic
1115824297 14:37249271-37249293 AGGAGCCCTGTTGGGGGAAGGGG - Intronic
1115833693 14:37373540-37373562 TGGGGGCCTGTTGGGGGTTGGGG - Intronic
1116233891 14:42253476-42253498 TTGGGGCCTGTTGGGGGGTGGGG + Intergenic
1116337417 14:43675102-43675124 CTGGGGCCTGTTGGGGGATGGGG - Intergenic
1116496811 14:45570518-45570540 CGGGGGCCTGTTGGGGGGTGGGG + Intergenic
1116673764 14:47878397-47878419 TGGGGCCTACTTGGGGGTGGAGG + Intergenic
1117272044 14:54154639-54154661 TGGGGCCCACTTGAGGGTGGCGG - Intergenic
1118009084 14:61591497-61591519 CTGGGGCCTGTTGGGGGATGGGG + Intronic
1118511204 14:66475405-66475427 TGGGGGCCTGTTGTGGGGTGGGG + Intergenic
1118877885 14:69799776-69799798 TGGGGCCTACTTGAGGGAGGAGG - Intergenic
1120184539 14:81380809-81380831 TGGGGCCCACTTGAGGGTGGAGG + Intronic
1120483132 14:85077505-85077527 TGGGGCCTGTTGGGGGGATGGGG - Intergenic
1120535482 14:85689850-85689872 CTGGGGCCTGTTGGGGGATGGGG + Intergenic
1120854906 14:89203811-89203833 TGGGGTGCTCTGGGTGGATGAGG - Intronic
1121464172 14:94103549-94103571 TGGGGCCCCTTTGGGAGCTGTGG - Intronic
1121884904 14:97534017-97534039 TGGGACCCTCCTGAGGGCTGAGG + Intergenic
1122395762 14:101428922-101428944 CCGGGGCCTGTTGGGGGATGGGG - Intergenic
1122396595 14:101437248-101437270 CGGGGCCCTTTTGAGGGATTCGG - Intergenic
1122972931 14:105159625-105159647 TGGAACCCCGTTGGGGGATGTGG - Intronic
1122973041 14:105159958-105159980 CGGAGCCCTGTTGGGGGGTGTGG - Intronic
1123110867 14:105866342-105866364 TGGGGCCCTCAGGGAGGCTGAGG + Intergenic
1124764969 15:32481540-32481562 TGGGGCCCTCATGGGGGAAGGGG + Intergenic
1124939378 15:34203867-34203889 CCGGGCCCTGTTGGGGGGTGGGG + Intronic
1125244459 15:37618983-37619005 CTGGGGCCTCTTGGGGGGTGGGG - Intergenic
1125891708 15:43271462-43271484 TGGGGTCTACTTGAGGGATGAGG - Intergenic
1126727692 15:51649012-51649034 CTGGGGCCTGTTGGGGGATGGGG + Intergenic
1127295636 15:57606565-57606587 TGGGGGACTATTGTGGGATGGGG + Intronic
1128250372 15:66159731-66159753 TGGGGACCTTTTGGGGAAGGGGG + Intronic
1129278032 15:74460347-74460369 TAGGGCTCTGTTGGGGAATGAGG - Intronic
1129784794 15:78302857-78302879 TCTGGCCCTCTGGGGGAATGTGG - Intergenic
1131048324 15:89330185-89330207 TAGGGACCTCCAGGGGGATGAGG + Exonic
1131120835 15:89822658-89822680 TGGGGCACTGTTGAGGAATGAGG + Intergenic
1132654218 16:1035145-1035167 TGGGGCTCTGCTGGGGCATGAGG + Intergenic
1132699189 16:1215092-1215114 TGGGGCCGTCTTGGGTTCTGGGG + Intronic
1132850680 16:2023675-2023697 TGGGGCCCTGTCTGGGGGTGGGG - Intergenic
1133286277 16:4692271-4692293 TGGGGCCCTCTTTGGGTGAGAGG + Intergenic
1133741067 16:8651851-8651873 CCGGGGCCTTTTGGGGGATGGGG + Intergenic
1134008643 16:10835059-10835081 TGAGCCCCTCCTTGGGGATGGGG - Intergenic
1135818313 16:25656267-25656289 TGATGCCCTCTTGGAGGAGGAGG + Intergenic
1135940781 16:26819977-26819999 TGGGACCCTCCTTGGGGATCTGG - Intergenic
1136009900 16:27356669-27356691 TGGGGGCATCTGGGGGCATGTGG + Intronic
1136396762 16:29996675-29996697 TGTGGCCCTACTCGGGGATGGGG - Intronic
1136652263 16:31683055-31683077 TGGGGCCCTCTGGGGGTCAGTGG + Intergenic
1136672130 16:31867864-31867886 CTGGGGCCTGTTGGGGGATGGGG + Intergenic
1137296920 16:47103281-47103303 CCGGGGCCTGTTGGGGGATGAGG + Intronic
1137553044 16:49453493-49453515 TGGGGCCTGCTTGGAGGAGGAGG - Intergenic
1137666053 16:50249746-50249768 TGGGGCCCTGCTGGGGGAGGTGG + Intronic
1137716091 16:50599101-50599123 TGAGGCCTTCTGGGGTGATGAGG + Intronic
1137801562 16:51266537-51266559 TGGGGCCATCTTGGATCATGAGG + Intergenic
1139161661 16:64517451-64517473 TAGGGCCCACTTGAGGGAAGTGG + Intergenic
1139394551 16:66630114-66630136 TGGGGCCATCTTGTGGGACTGGG + Intronic
1139514188 16:67443695-67443717 GCAGGCCCTCTTGGGGGATGGGG - Intronic
1139595901 16:67958125-67958147 TGGGGCCCCACTGGGGGAGGGGG - Intronic
1139922964 16:70471166-70471188 TGGGGCCCTGGTGGGGGACAGGG - Exonic
1140129553 16:72148357-72148379 TGGGGGCCTGTCGGGGGGTGGGG + Intronic
1140337031 16:74117451-74117473 CTGGGCCCTGTTGGGGGGTGGGG + Intergenic
1140693349 16:77506842-77506864 CAGGGGCCTGTTGGGGGATGTGG + Intergenic
1142130455 16:88429534-88429556 CGGGGCCCTCGTGGGGGAATGGG - Exonic
1142641453 17:1288296-1288318 TGGGGAACCCGTGGGGGATGGGG - Intronic
1142641471 17:1288332-1288354 TGGGGAACCCGTGGGGGATGAGG - Intronic
1142641478 17:1288350-1288372 TGGGGAGCCCATGGGGGATGGGG - Intronic
1142641526 17:1288459-1288481 TGGGGAACCCGTGGGGGATGAGG - Intronic
1142641593 17:1288621-1288643 TGGGGAACCCATGGGGGATGGGG - Intronic
1142641634 17:1288712-1288734 TGGGGAACCCGTGGGGGATGGGG - Intronic
1142641643 17:1288730-1288752 TGGGGAGCCCGTGGGGGATGGGG - Intronic
1142641652 17:1288748-1288770 TGGGGAACCCGTGGGGGATGGGG - Intronic
1142641661 17:1288766-1288788 TGGGGAGCCCGTGGGGGATGGGG - Intronic
1142641684 17:1288820-1288842 TGGGGAACCCGTGGGGGATGGGG - Intronic
1142641702 17:1288856-1288878 TGGGGAACCCGTGGGGGATGAGG - Intronic
1142641709 17:1288874-1288896 TGGGGAACCCGTGGGGGATGGGG - Intronic
1142641726 17:1288911-1288933 TGGGGAACCCGTGGGGGATGGGG - Intronic
1142641753 17:1288967-1288989 TGGGGAGCCCGTGGGGGATGGGG - Intronic
1142641772 17:1289004-1289026 TGGGGAGCCCGTGGGGGATGGGG - Intronic
1142641790 17:1289040-1289062 TGGGGAACCCGTGGGGGATGAGG - Intronic
1142641805 17:1289077-1289099 TGGGGAACCCGTGGGGGATGGGG - Intronic
1142641832 17:1289133-1289155 TGGGGAGCCCGTGGGGGATGGGG - Intronic
1142641857 17:1289187-1289209 TGGGGAACCCGTGGGGGATGAGG - Intronic
1142641897 17:1289279-1289301 TGGGGAGCCCCTGGGGGATGAGG - Intronic
1142641917 17:1289333-1289355 TGGGGAACTCGTGGGGGATGAGG - Intronic
1143130242 17:4673002-4673024 TGGGGCCCTGAAGGGCGATGGGG + Exonic
1143304345 17:5933969-5933991 TGTGGCTCTTTTGGGGGTTGGGG + Intronic
1144113187 17:12059035-12059057 TGGGGGGATCTTGGAGGATGAGG + Intronic
1144625396 17:16841913-16841935 TGGGGGCCTCTTGGCGGGGGGGG - Intergenic
1146355574 17:32131207-32131229 TAAGGCCCTGTGGGGGGATGGGG + Intergenic
1147317584 17:39628097-39628119 GAGGGCCTTCTTGGGGGTTGAGG + Intronic
1147331231 17:39700466-39700488 TGGGGCCCTCGGGCGGGAGGGGG + Intronic
1147614904 17:41822041-41822063 TGGGGTCCTGGTGGGGGCTGGGG - Intronic
1147877577 17:43632437-43632459 TGTGGCCCTTCTGGGGGCTGTGG - Intergenic
1148480583 17:47957302-47957324 TGGGGCCCTGCAGAGGGATGGGG - Intronic
1148748136 17:49929804-49929826 ATGGGCCTTCTTGGGGGCTGGGG - Intergenic
1149224039 17:54447980-54448002 TGGAGGCCTGTTGGGGGGTGGGG - Intergenic
1149366006 17:55944923-55944945 CTGGGGTCTCTTGGGGGATGGGG + Intergenic
1149554221 17:57561589-57561611 TGGGCCCCTTTTGGGGTAGGAGG + Intronic
1150193693 17:63271613-63271635 CTGGGGCCTGTTGGGGGATGGGG - Intronic
1150876337 17:68975006-68975028 TGGGGCCTGTTGGGGGGATGGGG - Exonic
1150888393 17:69114401-69114423 TGGGGGCCTGTTGTGGGGTGGGG + Intronic
1151172184 17:72256232-72256254 CTGGGGCCTCTTGGGGGGTGGGG - Intergenic
1151276175 17:73036052-73036074 TGGGTTCCTCTTGGAGGATTTGG - Intronic
1151279572 17:73063027-73063049 TGGGGGCCTGCTGGGGGTTGGGG + Intronic
1151850104 17:76685022-76685044 TGGCGGGCTCTTGGGGGAGGGGG - Intronic
1152306097 17:79520858-79520880 TGGGGACCTCTTGCAGCATGGGG - Intergenic
1152683968 17:81684543-81684565 TCGAGCTCTCTTGGGGGCTGCGG + Intronic
1152838052 17:82547783-82547805 TGGGACTCTCCAGGGGGATGAGG - Intronic
1153511975 18:5864643-5864665 TTGGGGCCTGTTGGGGGGTGGGG + Intergenic
1153885083 18:9457368-9457390 TGGGGCCCTCCTGGGGAACATGG + Intergenic
1154288035 18:13078788-13078810 TGGGGGCCTGTTGTGGGATGGGG - Intronic
1155553038 18:26987071-26987093 TGGGGCAGTGTTGGGAGATGGGG + Intronic
1155566719 18:27143779-27143801 CCAGGGCCTCTTGGGGGATGGGG + Intronic
1156429828 18:37059995-37060017 CTGGGGCCTGTTGGGGGATGGGG + Intronic
1156498653 18:37543097-37543119 TGGGGAGCTCTTGGAGGCTGGGG - Intronic
1156626373 18:38914870-38914892 TTGGGGCCTGTTGGGGGGTGGGG - Intergenic
1157542769 18:48523859-48523881 TCGGGTCCTGTTGGGGGTTGGGG + Intergenic
1158560473 18:58509038-58509060 TGGGGGCCTGTTGTGGGGTGGGG - Intronic
1158728527 18:59997577-59997599 CTGGGGCCTGTTGGGGGATGGGG - Intergenic
1159082290 18:63748917-63748939 TGGGGCCTGTTTGGGGGGTGGGG + Intergenic
1159210583 18:65316340-65316362 TGGGGGCCTGTCGGGGGGTGGGG + Intergenic
1159436395 18:68423415-68423437 CTGGGACCTATTGGGGGATGTGG + Intergenic
1159856759 18:73598286-73598308 TGTGGCCGTATTGTGGGATGTGG + Intergenic
1160132902 18:76245530-76245552 TGGGGGCCTGTTGTGGGGTGGGG - Intergenic
1160218849 18:76957665-76957687 TGGGGCCTCCTTGAGGGAGGAGG - Intronic
1160356285 18:78230360-78230382 TGGGGACCACATAGGGGATGGGG + Intergenic
1160775232 19:852448-852470 TGGGGCCCTCTATGGAGAGGTGG - Intronic
1160809686 19:1008010-1008032 TGGGGACCTCCTGGGGGCAGTGG + Intronic
1160897872 19:1411193-1411215 TGGGGCTCTCTTGGTGCATTTGG + Intronic
1161517165 19:4702925-4702947 TGGGGCCCTCTTGGTCTCTGGGG + Intronic
1161574850 19:5049563-5049585 TGGGGAGCTCTGGGGGGTTGAGG - Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1161738212 19:6004631-6004653 TGGGGCCCTCCTGGGCACTGTGG - Intronic
1162164850 19:8745222-8745244 AGGGGCCCTCATGGAGGATTGGG + Intergenic
1162165921 19:8752690-8752712 AGGGGCCCTCATGGAGGATTGGG + Intergenic
1162166987 19:8760146-8760168 AGGGGCCCTCATGGAGGATTGGG + Intergenic
1162168053 19:8767606-8767628 AGGGGCCCTCATGGAGGATTGGG + Intergenic
1162168993 19:8773900-8773922 AGGGGCCCTCATGGAGGATTGGG + Intergenic
1162169676 19:8779214-8779236 AGGGGCCCTCATGGAGGATTGGG + Intergenic
1162170738 19:8786668-8786690 AGGGGCCCTCATGGAGGATTGGG + Intergenic
1162180123 19:8862972-8862994 TGGAGGCCTCTTGGGGGTGGAGG + Intronic
1162287163 19:9747435-9747457 TGGGGCCTGCTGGGGGGAGGGGG - Intergenic
1162780915 19:13006725-13006747 TGGGGCCCTGGTGGGAGTTGGGG - Intronic
1162904818 19:13817363-13817385 TGGGGTACTCTTGGAGGAGGTGG + Intronic
1162961206 19:14127957-14127979 GGGGGCCCTCCTGCTGGATGGGG - Intronic
1163068784 19:14820385-14820407 TGGGGGCCTGTTGGGGGGTCGGG + Intronic
1163499835 19:17669667-17669689 CAGGGCCCTCCTGGGGGTTGGGG + Exonic
1164876440 19:31693981-31694003 TGGGGCCCTCATGGGAGCTCAGG - Intergenic
1165326395 19:35116732-35116754 TGGGGACATCTGGGTGGATGAGG + Intronic
1165772571 19:38387733-38387755 TGGGTTCCTCTGGGGGGAGGCGG - Intronic
1165972973 19:39649023-39649045 TGGGGCCTACTTGAGGGTTGAGG + Intergenic
1166011130 19:39943536-39943558 TGGGGAGCTCCTGGGGGAGGAGG + Intergenic
1166100634 19:40569644-40569666 GGTGGCCTTCCTGGGGGATGGGG - Exonic
1166365590 19:42276773-42276795 AGGGGCCATGTTGGGGGTTGTGG - Intronic
1166373069 19:42313231-42313253 TTGGGCCCTCTTGGAGGAGGGGG + Intergenic
1167048732 19:47066542-47066564 TGGGGCACCCTCGGGGGGTGGGG + Exonic
1167262163 19:48464839-48464861 TGGGGCTCTCTCCTGGGATGGGG + Exonic
1167272469 19:48513692-48513714 TGGGCCCCTGCTGGGGGTTGGGG - Intergenic
1168058165 19:53875128-53875150 TGGGGCCCCTTGGGGGGCTGTGG - Exonic
925810609 2:7696696-7696718 TGGGGCCGTCTTATAGGATGTGG + Intergenic
926141237 2:10369679-10369701 TGAGGCCTTCTTGGAGGAGGTGG + Intronic
926927604 2:18003356-18003378 CTGGGGCCTGTTGGGGGATGGGG + Intronic
927265945 2:21151246-21151268 TGGGGTCCTGTTGGGGGGTGGGG - Intergenic
928278948 2:29927235-29927257 CAGGGGCCTGTTGGGGGATGGGG + Intergenic
928480500 2:31678247-31678269 CTGGGGCCTGTTGGGGGATGGGG - Intergenic
928751217 2:34472483-34472505 TTGGGGCCTGTTGGGGGGTGGGG + Intergenic
928804143 2:35130160-35130182 GGAGGACCTGTTGGGGGATGGGG + Intergenic
929556488 2:42928752-42928774 GGGGGCGCTCTTGGGGTGTGTGG + Intergenic
930222475 2:48759121-48759143 CTGGGGCCTGTTGGGGGATGGGG - Intronic
930289798 2:49479431-49479453 TGGGGGCCTGTTGGGGGATGGGG + Intergenic
930290776 2:49490749-49490771 TGCCGCCCTCTGGGTGGATGTGG - Intergenic
930298707 2:49587699-49587721 CTGGGGCCTCTTGGGGGGTGGGG - Intergenic
930338614 2:50083577-50083599 TGGGGTCCTCTTGCGTGTTGTGG - Intronic
930365613 2:50435790-50435812 TGGGGCCTTCTTGAGGGTGGAGG + Intronic
931090669 2:58882706-58882728 CCGGGGCCTGTTGGGGGATGGGG + Intergenic
931211501 2:60201076-60201098 TAGGGGCCTGTTGGGGGGTGGGG - Intergenic
933412613 2:81945032-81945054 TTGGGGCCTATTGGGGGATGGGG - Intergenic
933451275 2:82455268-82455290 TGGGGTCCACTTGAGGGAAGAGG + Intergenic
937076652 2:119112293-119112315 TGGGGGCTTCCTGGGTGATGTGG - Intergenic
937267293 2:120624600-120624622 TGGGGCCCATCTGGGGCATGTGG - Intergenic
937695718 2:124806316-124806338 TGGGGCCATATTGGGGAAAGGGG + Intronic
937741222 2:125356940-125356962 CTGGGGCCTATTGGGGGATGGGG + Intergenic
937955872 2:127421537-127421559 TGAGGCCCTCTTAGGAGTTGTGG + Intronic
938063273 2:128268122-128268144 GGGAGGCCTCTTGGGGGGTGTGG - Exonic
938779810 2:134575034-134575056 TGGGGCTCTGTGGGGGGGTGGGG + Intronic
938857413 2:135328219-135328241 TGGGGGCCTGTTGGGGGGTGGGG - Intronic
938976743 2:136486094-136486116 GGGGGGCCTGTCGGGGGATGGGG - Intergenic
939305133 2:140401485-140401507 TGCAGCCCTTTTGGGGGTTGGGG - Intronic
939398858 2:141665948-141665970 TGGGGGCCTGTTGGGGGCAGGGG + Intronic
940260936 2:151779075-151779097 TGGGGGCCTGTTGGGGGGTGGGG + Intergenic
940708487 2:157133320-157133342 TGGGGCCTACTTGAGGGTTGAGG + Intergenic
940868546 2:158840304-158840326 TTGGGGCCTGTTGGGGGGTGGGG - Intronic
941076942 2:161016275-161016297 CCAGGCCCTGTTGGGGGATGAGG + Intergenic
941818041 2:169817752-169817774 CGGGGGCCTGTTGGGGGGTGGGG + Intronic
942538842 2:176994509-176994531 TGGGGGCCTGTTGAGGGGTGGGG + Intergenic
942908555 2:181213071-181213093 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
943665027 2:190600453-190600475 TGTGGCCCTGTTGGGAGGTGTGG + Intergenic
944336058 2:198536631-198536653 TGGGGCCCACTTGAGGGTGGAGG + Intronic
944419620 2:199515693-199515715 CTGGGGCCTGTTGGGGGATGGGG + Intergenic
945080684 2:206084950-206084972 TGGGGGGCTCTAGGGGGAAGGGG + Intronic
945256092 2:207804414-207804436 TGGGGCCCTGTGGTTGGATGTGG + Intergenic
945386429 2:209207325-209207347 CCGGGACCTCTTGGGGGGTGGGG + Intergenic
946263399 2:218516527-218516549 TGGGGGCCTGTCAGGGGATGGGG + Intronic
947082098 2:226410251-226410273 TCGGGGCCTGTTGGGGGGTGGGG - Intergenic
947327025 2:228990846-228990868 TGGGGCCTACTTGAGGGAGGAGG + Intronic
947427145 2:229994288-229994310 AAGGGCCTTCTTGGGGGGTGAGG - Intronic
947534359 2:230931657-230931679 TGGGGCCCTCGTGGGTGCAGCGG - Intronic
947683107 2:232053988-232054010 TGAGGGACTCTTGGAGGATGGGG - Intronic
948744633 2:240079643-240079665 TGTGGGCCTCTTGGGGGGTGGGG - Intergenic
948806335 2:240454883-240454905 TGGGTCCATCATTGGGGATGGGG + Intronic
948874187 2:240818629-240818651 TGGGGTCCACGTGGGGGTTGGGG - Intronic
948883012 2:240869949-240869971 TGGGACCCTCTTGGCTGTTGCGG - Intronic
1169130147 20:3162557-3162579 TGAGGCCCGGGTGGGGGATGGGG - Intergenic
1169843045 20:9960704-9960726 TGGGGACCTGTCGGGGGTTGGGG + Intergenic
1170174812 20:13457108-13457130 CTGGGGCCTGTTGGGGGATGGGG + Intronic
1171143043 20:22759472-22759494 CGGGGGCCTGTTGGGGGGTGGGG - Intergenic
1172803562 20:37595451-37595473 TGGTTACCTCTGGGGGGATGTGG - Intergenic
1173248898 20:41354229-41354251 TGGGGCAGTCTTGGAGGTTGAGG + Intronic
1173326504 20:42038416-42038438 TGAGTCCAACTTGGGGGATGTGG + Intergenic
1174687237 20:52467720-52467742 CTGGGGCCTCTCGGGGGATGGGG - Intergenic
1174959069 20:55134681-55134703 CTGGGGCCTGTTGGGGGATGGGG + Intergenic
1175034676 20:55988780-55988802 TGGGGCCGTTGTGGGGGGTGTGG - Intergenic
1175141725 20:56865579-56865601 TGGAGCTGTGTTGGGGGATGGGG + Intergenic
1175536949 20:59721453-59721475 TGGGGCGATGGTGGGGGATGTGG + Intronic
1175633025 20:60557926-60557948 TGGGGCCCTGTTGTGGGGTTAGG - Intergenic
1176072308 20:63233762-63233784 TGGGGCCCACTGGGGAGTTGGGG - Intergenic
1176188073 20:63792406-63792428 TGCAGCCCTCATGGGGGACGGGG + Intronic
1176988427 21:15464776-15464798 TGGGGGCCTGTTGTGGGGTGGGG + Intergenic
1177093842 21:16806488-16806510 TGGTGCCATATTGGGGGCTGAGG - Intergenic
1177240085 21:18444470-18444492 CTGGGGCCTGTTGGGGGATGGGG + Intronic
1177311550 21:19401132-19401154 TAGGGCCCTTTTAGGAGATGAGG - Intergenic
1177357021 21:20021660-20021682 TGGGGGCCTGTTGGGGGTCGGGG - Intergenic
1177966394 21:27732892-27732914 CCGGGGCCTGTTGGGGGATGGGG + Intergenic
1178362979 21:31965285-31965307 TGGGGCCCACTTGAGGGTGGAGG + Intronic
1179597215 21:42451017-42451039 TGGGGCCTTCTTGGGATTTGTGG - Intergenic
1179908294 21:44435337-44435359 TGGTGCCTACTGGGGGGATGCGG + Intronic
1180163859 21:46010274-46010296 TGCAGCCCTCTTGCGGGCTGTGG + Intergenic
1180217963 21:46338263-46338285 ACGGGCCCTCTTGGGGGCTGGGG - Intronic
1181081315 22:20417703-20417725 TGGGGCCTGCTACGGGGATGTGG - Intergenic
1181994356 22:26863579-26863601 CTGGGGCCTGTTGGGGGATGAGG - Intergenic
1182062144 22:27406045-27406067 TGGGGCAAACTTGGGGGCTGGGG - Intergenic
1182649486 22:31839602-31839624 TGTGGCCCTGTTGGAGCATGCGG + Intronic
1182847516 22:33443675-33443697 TGGGGATATCTTGGGGGTTGGGG - Intronic
1183020928 22:35025131-35025153 TGGGGACCTGTTGGGGAGTGGGG - Intergenic
1184091780 22:42296666-42296688 TGGAGCCCTGTTTGGGGGTGGGG - Intronic
1184233390 22:43170262-43170284 TGGGGCCCTGCTGGGGGGTCTGG + Intronic
1184419048 22:44368979-44369001 GGGGGCCCTCTTGGGAGAGGCGG + Intergenic
1184593301 22:45500010-45500032 CGGGGCCCTTTCTGGGGATGGGG - Intergenic
1184620173 22:45671428-45671450 AGGGGCCCTCCTGTGGGAGGGGG - Intergenic
1185119057 22:48954924-48954946 AGGGCCCAGCTTGGGGGATGAGG - Intergenic
949161196 3:884405-884427 TGGGGCCCGCTGGAGGGTTGGGG - Intergenic
949790324 3:7785523-7785545 TGGGGGCCTGTTGTGGGGTGGGG + Intergenic
949795973 3:7851426-7851448 TGGGGGCCTGTTGTGGGGTGGGG - Intergenic
950137911 3:10595253-10595275 TGGGGGCCTTTTGGGGAAGGAGG + Intronic
951015356 3:17725869-17725891 TGGGGCCTACTTGAGGGTTGAGG - Intronic
951966515 3:28391793-28391815 TGGCTCCTTCTTAGGGGATGAGG - Intronic
952078487 3:29728194-29728216 TGGGGGCCTGTTGGGGCAGGGGG + Intronic
953225860 3:41019874-41019896 TGGGGCCCACTTGAGGGTGGAGG + Intergenic
953279514 3:41540212-41540234 CTGGGGCCTATTGGGGGATGGGG - Intronic
953306157 3:41831703-41831725 TGGGGGCCTGTCAGGGGATGGGG - Intronic
953729996 3:45439094-45439116 TGAAGCCCTGTTGGGGGTTGTGG + Intronic
953827342 3:46265296-46265318 TGTGGGCCTCTTGGGCAATGTGG + Exonic
953974445 3:47371560-47371582 TGGGACCCTCTGGAGGGAAGAGG + Intergenic
954374140 3:50185356-50185378 TTGGGCCCTGGTGGGGGAAGGGG + Intronic
954376507 3:50196647-50196669 TGGGGCACTCTTGGGGGTATGGG + Intergenic
954386704 3:50247862-50247884 TGGGGCCCTCTGCGGGCAGGAGG + Intronic
954392308 3:50274122-50274144 TGGGGTCTTCTTGGTGAATGTGG + Intronic
955413824 3:58673724-58673746 CCGGGCCCTGTCGGGGGATGAGG - Intergenic
955619739 3:60850069-60850091 TGGGGGCCTGTGAGGGGATGGGG - Intronic
957395294 3:79628470-79628492 TCAGGGCCTGTTGGGGGATGAGG + Intronic
957480028 3:80780870-80780892 TGGGGGCCTGTTGTGGGGTGGGG - Intergenic
958530982 3:95330025-95330047 TGAGGCCCTTTTGGGAGATGGGG + Intergenic
958665982 3:97138722-97138744 TGGGTCCCTGTTGTGGCATGGGG + Intronic
958688346 3:97427905-97427927 TGGGGCCTACTTGAGGGTTGAGG + Intronic
959872071 3:111340277-111340299 TGGGGTCCTCTTGCGACATGTGG - Intronic
960475178 3:118116013-118116035 TGGGGCCCACTTGAGGCAGGAGG + Intergenic
960476855 3:118140920-118140942 TGGGGGCCTGTTGTGGGGTGGGG - Intergenic
960631991 3:119741863-119741885 TGGGGAACTTTTGGGGGGTGAGG + Intronic
960697041 3:120406451-120406473 TGGTGCCCACTTGGGCCATGTGG - Intronic
960744147 3:120867776-120867798 TGGGGGCCTGTTGTGGGGTGGGG + Intergenic
960751641 3:120961426-120961448 TGGGGCCTCGTTGGGGGACGAGG - Intronic
961125259 3:124411874-124411896 TGGGGCATCCTTGGGGGATCTGG - Intronic
962324923 3:134425015-134425037 TGAGGCCCTCAGAGGGGATGTGG - Intergenic
962468492 3:135683633-135683655 TGGGGCCTACTTGAGGGTTGAGG + Intergenic
962604070 3:137017343-137017365 TGGGGGCCTGTTGTGGGGTGGGG - Intergenic
962610262 3:137069989-137070011 TGGGGGCCTGTTGTGGGGTGGGG - Intergenic
962813522 3:138978818-138978840 TGGGGCCCACTTGAGGGTGGAGG + Intergenic
962983998 3:140517996-140518018 TGTGGCTGCCTTGGGGGATGGGG + Intronic
963216823 3:142757631-142757653 CCGGGGCCTCTTGGGGGATGGGG + Intronic
963630929 3:147729125-147729147 CTGGGGCCTCTTGTGGGATGGGG + Intergenic
963844898 3:150145175-150145197 TGGGGCCGTCTTGGGGGGCAGGG + Intergenic
967298184 3:187986110-187986132 CAGAGCCCTCTTGGGGGATATGG - Intergenic
967493316 3:190117732-190117754 TGGGGCTTTCTTGGGGGCTGGGG + Intronic
967605527 3:191440907-191440929 TGGGGCCCACTTGGGTGTGGAGG + Intergenic
967975231 3:195030783-195030805 TGGGGTCTTCTTTGGGGCTGTGG - Intergenic
969047669 4:4348789-4348811 TGGGGTCCCCTTGCAGGATGTGG - Intronic
969290336 4:6235046-6235068 CGGGGCCCTGATTGGGGATGGGG + Intergenic
969297557 4:6278806-6278828 TGGAGGCCTCTGGGCGGATGAGG + Intronic
969349005 4:6587328-6587350 GGGGGCCCTCCTGGTGGAGGAGG - Intronic
969369733 4:6724058-6724080 CAGGCCCCTCTTGGGGTATGTGG - Intergenic
969807755 4:9623914-9623936 CGGGGGCCTCTTGTGGGGTGGGG + Intergenic
970163321 4:13210680-13210702 TGGGACAGTCTTGGGGGAGGTGG - Intergenic
970298259 4:14654632-14654654 TGGGGCCCACTTGAGGGTGGAGG + Intergenic
970364210 4:15341979-15342001 TGGGGCCCTCTGGGGCCCTGGGG - Intronic
970631605 4:17952893-17952915 TGGGGCCTACTTGAGGGAGGAGG - Intronic
970945297 4:21683963-21683985 TGGGGCCTGCTTGAGGGAGGAGG + Intronic
971343887 4:25795042-25795064 CTGGGGCCTCTTGGGGGGTGGGG + Intronic
971558277 4:28040827-28040849 TGGGGGCCTATTTGGGGATGTGG + Intergenic
971644980 4:29188200-29188222 TGGGGCCCACTTGAGGGCGGAGG + Intergenic
971989320 4:33870183-33870205 CTGGGGCCTCTTGGGGGGTGGGG + Intergenic
973126800 4:46595927-46595949 TGGGGGCCTGTTGTGGGGTGGGG + Intergenic
974897038 4:67952571-67952593 TGGGAACCTCTGTGGGGATGGGG - Intronic
975877035 4:78853440-78853462 TGGGGCCGACATGGGGGATGAGG + Intronic
976226094 4:82797039-82797061 TGGGTACCTCTTAGGGGGTGTGG - Intronic
976470729 4:85425596-85425618 TGGGGCCCACTTGAGGGTAGAGG - Intergenic
977344232 4:95797335-95797357 TGGGGGACTCTTGTGGGGTGGGG + Intergenic
977711288 4:100128928-100128950 CTGGGTCCTGTTGGGGGATGGGG - Intergenic
978882241 4:113719665-113719687 TAAGGCCCCCTTGGGGGATGGGG + Intronic
979461074 4:120984871-120984893 CTGGGGCCTTTTGGGGGATGGGG - Intergenic
979652525 4:123152114-123152136 CTGGGGCCTGTTGGGGGATGGGG + Intronic
980261497 4:130455328-130455350 TCGGGGCCTGTTGGGGGGTGGGG - Intergenic
980824683 4:138059327-138059349 TGGGGCCTACTTGAGGGTTGAGG - Intergenic
980955279 4:139421964-139421986 CCGGGGCCTGTTGGGGGATGGGG - Intergenic
981154529 4:141418149-141418171 TGGGGGCCTGGTGGGGGATGTGG - Intergenic
981446351 4:144842816-144842838 TGGGGGCCTCTCGTGGGGTGGGG + Intergenic
985212535 4:187610309-187610331 TTGGGGCCTATTGGGGGTTGGGG + Intergenic
985912727 5:2896249-2896271 TGGGACCCTCCTGGGGGGTAAGG - Intergenic
986126564 5:4887733-4887755 TCAGGGCCTCTTGGGGGTTGGGG - Intergenic
986804545 5:11296820-11296842 TGGGGGCCTGTTGTGGCATGGGG + Intronic
987059698 5:14230667-14230689 TGGGGCCGTATTAGGGGAGGGGG - Intronic
987180444 5:15362086-15362108 TTGGGGCCTGTTGGGGGTTGGGG + Intergenic
987714559 5:21550655-21550677 TCAGGGCCTGTTGGGGGATGGGG + Intergenic
988231529 5:28485442-28485464 CTGGGGCCTGTTGGGGGATGGGG + Intergenic
988505804 5:31821848-31821870 CTGGGGCCTATTGGGGGATGGGG - Intronic
990102933 5:52215572-52215594 CCGGGGCCTGTTGGGGGATGGGG - Intergenic
990295048 5:54392992-54393014 TGTGGCCTTCTTGAGGGAGGAGG - Intergenic
990320694 5:54627564-54627586 TGGGGCCCTCCTGGGGTCTGAGG + Intergenic
992037868 5:72798670-72798692 TGGGCATCTCTTGAGGGATGTGG - Intergenic
992340088 5:75814533-75814555 TGCAGCTCTTTTGGGGGATGGGG + Intergenic
992740006 5:79764154-79764176 TGGGGCCTTTTTGGGGGCAGGGG - Intronic
992862111 5:80921524-80921546 TATGGCCCTCTTGAGGGAGGAGG + Intergenic
993890423 5:93465911-93465933 TGGGGGCCTGTTGTGGGGTGGGG + Intergenic
994415498 5:99464681-99464703 TGGGGCCTTTCTGGGGGCTGGGG + Intergenic
994680948 5:102887153-102887175 TGTGGCACTGTTGGGAGATGGGG + Intronic
994761372 5:103858378-103858400 CTGGGGCCTGTTGGGGGATGGGG - Intergenic
994801979 5:104390112-104390134 TCGGGGCCTGTTGGGGGCTGGGG + Intergenic
994843813 5:104959239-104959261 AGGGGGCCTCTCGGGGGTTGGGG + Intergenic
995643752 5:114287585-114287607 TTGGGGCCTGTCGGGGGATGGGG + Intergenic
996161694 5:120174238-120174260 AGGGACCCACTTGGGGGCTGGGG + Intergenic
996314574 5:122147528-122147550 TGGGGGCCTGTTGTGGGGTGGGG - Intronic
997232935 5:132257314-132257336 GAGGGCCCACTTGGGGGATGGGG - Intronic
997843046 5:137259476-137259498 CTGGGGCCTGTTGGGGGATGGGG + Intronic
999056469 5:148583279-148583301 TGAAGCCCACTTGGGGGAGGGGG + Intronic
999949731 5:156635872-156635894 TGGGGGCCTGTTGTGGGGTGGGG + Intronic
1001325426 5:170720308-170720330 TGGGGCACTCCTGTGGGAAGGGG - Exonic
1001372085 5:171215058-171215080 CCGGGGCCTGTTGGGGGATGGGG - Intronic
1001524587 5:172419530-172419552 GGGGTTGCTCTTGGGGGATGTGG + Intronic
1001656742 5:173356497-173356519 TGGGGCCCTGTGGGCGCATGAGG + Intergenic
1002368497 5:178730827-178730849 AGGGGCCCTCTTGTGGCATGTGG - Intergenic
1002681757 5:180970389-180970411 TGGGGCCGCCTTCAGGGATGCGG - Intergenic
1002813843 6:660154-660176 TGGGTGGGTCTTGGGGGATGGGG - Intronic
1004076694 6:12350451-12350473 TGGGGCCTGCTTGTGGGAGGAGG - Intergenic
1004324524 6:14662693-14662715 GGGGACCCTTTTGGGGGAAGAGG + Intergenic
1004465434 6:15880825-15880847 TGAGGCCCCCTTGAGGGAGGAGG - Intergenic
1005171227 6:22987655-22987677 TGGGGGCCTGTCGGGGGTTGGGG - Intergenic
1005242339 6:23845837-23845859 TGGGGTCCTGTCAGGGGATGGGG - Intergenic
1006211469 6:32399081-32399103 TGGACACCTGTTGGGGGATGGGG - Intronic
1006556419 6:34871035-34871057 GGGGCCCTTCTTGGAGGATGAGG + Exonic
1006813667 6:36837018-36837040 AGAGGCCTTCCTGGGGGATGTGG - Intronic
1007055756 6:38882548-38882570 TGGGGCCTACTTGAGGGTTGGGG + Intronic
1007679669 6:43625524-43625546 TGTGGCCGTCCTGGGGAATGTGG - Exonic
1007686001 6:43667730-43667752 TGTGGCCCTTGTAGGGGATGGGG + Intronic
1008795294 6:55295312-55295334 TCGGGGCCTATTGGGGAATGGGG + Intergenic
1009002170 6:57731405-57731427 TCAGGGCCTGTTGGGGGATGAGG - Intergenic
1009433027 6:63587569-63587591 CTGGGGCCTGTTGGGGGATGGGG + Intergenic
1009592531 6:65690734-65690756 TGGGGGCCTGTTGTGGGCTGGGG - Intronic
1009696880 6:67117513-67117535 CTGGGGCCTCTTGGGGGGTGGGG - Intergenic
1009756524 6:67947311-67947333 CTGGGCCCTTTTGGGGGGTGGGG - Intergenic
1010068601 6:71715781-71715803 TAGGGACCTTTTGGGGAATGAGG - Intergenic
1011161659 6:84397508-84397530 TTGGGGCCTGTTGGGGAATGGGG + Intergenic
1011578770 6:88833410-88833432 TGGGGTCCTGTTGGGGGTTGGGG + Intronic
1011636148 6:89375635-89375657 TGGGGCCCTCTTAGGCAATGAGG - Intronic
1011766851 6:90629547-90629569 CCAGGGCCTCTTGGGGGATGGGG + Intergenic
1012778776 6:103530018-103530040 CGGGGGCCTGTTGGGGGGTGGGG + Intergenic
1013967601 6:115973395-115973417 CTGGGGCCTGTTGGGGGATGTGG + Intronic
1013991442 6:116258510-116258532 TGTGGCCTTCTTGGAGCATGTGG - Intronic
1014335383 6:120127222-120127244 TGGGGCCTTCTTGAGGGTAGAGG - Intergenic
1015006074 6:128283217-128283239 TGGGGCACCCTTGGGGGAAGTGG - Intronic
1015327534 6:131940495-131940517 TGGGGGCCTGTTGGGGGGTGGGG + Intergenic
1015781874 6:136876493-136876515 TTGGGGCCTTTTGGGGGGTGGGG - Intronic
1016417833 6:143851727-143851749 CTGGGGCCTGTTGGGGGATGGGG - Intronic
1016768246 6:147819314-147819336 TGGGGCCTACTTGGGGGTGGAGG + Intergenic
1017388931 6:153917007-153917029 TGAAGGCCTGTTGGGGGATGCGG - Intergenic
1017750185 6:157484130-157484152 TGGGGCCTTCTTGAGGGTAGGGG + Intronic
1018211229 6:161484012-161484034 TGGGGCCTGCTGGGGGGTTGTGG + Intronic
1018379091 6:163241458-163241480 CCTGGCCCTCTTGGGAGATGTGG + Intronic
1020068324 7:5207328-5207350 TGGTTGCCTCTTGGGGAATGTGG - Intronic
1020135523 7:5585904-5585926 TTGGGCCCTCTTGGGGCACTGGG + Intergenic
1020184026 7:5945027-5945049 TGGACCCTTGTTGGGGGATGGGG - Intronic
1020298891 7:6779739-6779761 TGGACCCTTGTTGGGGGATGGGG + Intronic
1021213301 7:17883715-17883737 CCGGGGCCTCTTGGGGGGTGAGG - Intronic
1021231906 7:18095125-18095147 TGGGGTTCTGTTGGGGGATTAGG + Intronic
1021916458 7:25438190-25438212 CCGGGGCCTCTTGGGGGCTGGGG - Intergenic
1022500262 7:30878287-30878309 TGGGGCCCTCACTGGGTATGTGG + Intronic
1022509898 7:30928394-30928416 CACGGCACTCTTGGGGGATGCGG + Intergenic
1022739080 7:33104292-33104314 TGGGGCCCACTTGAGGGTGGAGG + Intronic
1022826274 7:34017529-34017551 TGGGTCCCTCCTGTGGCATGTGG + Intronic
1023050336 7:36245539-36245561 TGGGGGCCCCTTGTGGGATCAGG + Intronic
1023207362 7:37764931-37764953 TGGGGACCTGTAGGGGGAGGAGG + Intronic
1024031315 7:45462591-45462613 TGGGGGCCTGTTGTGGGGTGGGG - Intergenic
1024365791 7:48518968-48518990 CTGGGGCCTGTTGGGGGATGGGG - Intronic
1024434319 7:49331756-49331778 TGGGGGCCTGTCGGGGGGTGAGG + Intergenic
1024668437 7:51567912-51567934 AGGGGCACTCATGGGGGATGGGG - Intergenic
1026781637 7:73271937-73271959 TGGGGCACTCCTGGAGGCTGAGG - Intergenic
1026800689 7:73397980-73398002 TGGGGCCTTGTTGGGGGTGGGGG + Intergenic
1027022491 7:74825377-74825399 TGGGGCACTCCTGGAGGCTGAGG - Intronic
1027065526 7:75120545-75120567 TGGGGCACTCCTGGAGGCTGAGG + Intronic
1027556952 7:79676690-79676712 CTGGGGCCTGTTGGGGGATGGGG - Intergenic
1027874926 7:83756672-83756694 TCGGGTCCTGTTGGGGGAGGGGG - Intergenic
1028043413 7:86087868-86087890 TGGTGCCCACTTGGAGTATGGGG - Intergenic
1028146131 7:87322036-87322058 CTGGGGCCTGTTGGGGGATGGGG + Intergenic
1028576624 7:92359225-92359247 CTGGGGCCTGTTGGGGGATGGGG - Intronic
1029122251 7:98276676-98276698 TGGCCCCCGCCTGGGGGATGAGG - Intronic
1029422330 7:100477920-100477942 GGGGGCCCGGTTGGGGGCTGTGG + Exonic
1029449772 7:100634281-100634303 TGAGGCCCACGTGGAGGATGGGG - Intronic
1029457286 7:100677680-100677702 TCGGGCCCTTTTTGGGGTTGGGG + Intronic
1029863670 7:103602668-103602690 CTGGGGCCTGTTGGGGGATGGGG + Intronic
1029919208 7:104244564-104244586 CCGGGGCCTCTTGGGGGGTGGGG - Intergenic
1030455060 7:109762059-109762081 CGGGGGCCTGTCGGGGGATGGGG + Intergenic
1031152489 7:118070428-118070450 CCGGGGCCTGTTGGGGGATGGGG + Intergenic
1031225444 7:119032153-119032175 TTGGGGCCTGTTGGGGGTTGCGG - Intergenic
1031506633 7:122592825-122592847 TGGGGCCTTCCAGGGGGATGGGG + Intronic
1031985454 7:128161812-128161834 GGGGGCTCTCTTGGGTGTTGGGG - Intergenic
1033143493 7:138849719-138849741 TGGGGCCCACTTGAGGGTAGAGG - Intronic
1033529666 7:142249049-142249071 TGAGGCTCTCTAGGGAGATGGGG + Intergenic
1033618115 7:143036896-143036918 CGGGGGCCTGTTGGGGGTTGAGG + Intergenic
1034382875 7:150714263-150714285 TGGGGGCCTGTCGGGGGTTGGGG + Intergenic
1034428299 7:151026559-151026581 TGGGGAGCTCTTGGTGTATGGGG - Intergenic
1037259308 8:16989517-16989539 CTGGGGCCTGTTGGGGGATGGGG + Intergenic
1037300942 8:17451369-17451391 TGGGGCCTTCTTGAGGGTGGAGG - Intergenic
1037524867 8:19714922-19714944 TGGGGCCCACTTGAGGGTAGAGG - Intronic
1037785181 8:21898699-21898721 TGGGGCTCTCTTCTGGGATTCGG - Intergenic
1037829202 8:22178065-22178087 AGTGGCCCTCTGGGGGGCTGTGG + Intronic
1038351927 8:26784012-26784034 TGGGGCCTGTTTGGGGGGTGTGG + Intronic
1038456025 8:27672428-27672450 AGGAGCCCCCTTGGGGAATGGGG - Exonic
1039639809 8:39206754-39206776 TGCAGCCCTCTGGGTGGATGTGG + Intronic
1039848901 8:41345412-41345434 AGAGTCCATCTTGGGGGATGTGG + Intergenic
1040986435 8:53298833-53298855 TGGGGCCCACTTGAGGGTCGAGG - Intergenic
1041914040 8:63121695-63121717 TGGGGCCTCCTTGAGGGAGGAGG - Intergenic
1042128515 8:65563325-65563347 TGGGGGCCTGTTGTGGGGTGGGG - Intergenic
1042429507 8:68688819-68688841 CTGGGGCCTGTTGGGGGATGAGG + Intronic
1043224698 8:77710703-77710725 TGGGGGCCTATTGCGGGGTGAGG + Intergenic
1044999680 8:97868974-97868996 GGGTGTCCTCTTTGGGGATGGGG - Intronic
1045125192 8:99081597-99081619 TGGGGGCCTGTTGTGGGGTGGGG - Intronic
1045384860 8:101662382-101662404 TTGGGCCTTATTAGGGGATGGGG + Intronic
1045510440 8:102808664-102808686 TGGGGCCCCCTGCAGGGATGTGG - Intergenic
1046121178 8:109848832-109848854 TGCAGCCCTCTGGGTGGATGTGG + Intergenic
1046161574 8:110373943-110373965 TGGGGGCCTGTTGTGGGGTGGGG - Intergenic
1046217888 8:111173432-111173454 CGGGGGCCTGTTGGGGGATGGGG + Intergenic
1046382135 8:113465189-113465211 TTGGGGCCTGTTGGGGGATCGGG + Intergenic
1046476536 8:114751926-114751948 TGGGGGCCTGTTAGGGGGTGGGG + Intergenic
1047146292 8:122203040-122203062 TTGGGGCCTGTTGGGAGATGGGG + Intergenic
1047225179 8:122950410-122950432 CCGGGGCCTGTTGGGGGATGGGG + Intronic
1047403156 8:124562787-124562809 TGGGGGCCTCTGGCGGCATGGGG + Exonic
1047528747 8:125656583-125656605 TGGGAGCCTCATGGGGGTTGGGG - Intergenic
1047744634 8:127835433-127835455 CTGGGGCCTGTTGGGGGATGGGG + Intergenic
1048153244 8:131914812-131914834 TGGGGCCCACTTGAGGGTGGAGG - Intronic
1048223126 8:132561571-132561593 TGGGGTCCTGTTGGGGGAAGAGG + Intergenic
1048716097 8:137272022-137272044 TGGGGCCTGCTTGGGGGCAGAGG + Intergenic
1049086058 8:140479461-140479483 TGGGGTCCTGGTGGGGGGTGGGG + Intergenic
1049218768 8:141419396-141419418 TGGGTCCCTCTTGGGGCAGCAGG - Intronic
1049431771 8:142568653-142568675 TGGGGCCCTCATTGTGGGTGTGG - Intergenic
1049542730 8:143215781-143215803 TGCAGCCCTCATGGGGGCTGGGG + Intergenic
1050868057 9:10529555-10529577 ACGGGGCCTGTTGGGGGATGGGG + Intronic
1050924193 9:11242037-11242059 TAGAGGCCTCTTGGGGGTTGTGG + Intergenic
1051199059 9:14597288-14597310 TGCAGCCCTCTTGGTGGATGTGG - Intergenic
1051349991 9:16190154-16190176 TGGGGGCCAGTTGGGGGGTGGGG + Intergenic
1051558333 9:18410378-18410400 TGGGCACCTGTTGGGGGCTGTGG - Intergenic
1051899627 9:22024891-22024913 TAGGGCCATCTTGGGTGCTGTGG - Intronic
1052073770 9:24115460-24115482 TGGGGGCCTGTCCGGGGATGGGG - Intergenic
1052511637 9:29429023-29429045 CTGGGGCCTGTTGGGGGATGGGG + Intergenic
1053392437 9:37745555-37745577 TGAGGGTCTCTAGGGGGATGTGG - Exonic
1055148261 9:72962351-72962373 CGGGGGCCTGTTGGGGGGTGGGG + Intronic
1055949687 9:81719304-81719326 TTGGGGCCTGTTGGGGGGTGGGG - Intergenic
1056124284 9:83519980-83520002 CTGGGGCCTGTTGGGGGATGGGG + Intronic
1056571967 9:87824603-87824625 TGGGTCCCTCTGTGGGGCTGTGG - Intergenic
1056959039 9:91105689-91105711 TGGGGTCCTCTGGGGAGCTGTGG - Intergenic
1057662896 9:97019254-97019276 TGGGGGCCTGTTGTGGGTTGGGG + Intergenic
1057823483 9:98352862-98352884 TGCAGCCCTCTGGGTGGATGTGG + Intronic
1057940032 9:99273792-99273814 TGGGGGCCTGTTGGGGGTGGAGG + Intergenic
1058257549 9:102787747-102787769 CTGGGGACTCTTGGGGGATGGGG + Intergenic
1058266200 9:102901782-102901804 CTGGGCCCTGTTGGGGAATGGGG + Intergenic
1059093848 9:111391191-111391213 GGGGTCACTCTGGGGGGATGAGG - Intronic
1059160145 9:112026378-112026400 TGGGGCCTGTTGGGGGGATGGGG - Intergenic
1059708157 9:116842864-116842886 GGGAGCTCTCCTGGGGGATGGGG - Intronic
1059729127 9:117039416-117039438 TTGGGGCCTGTTGGGGGTTGGGG + Intronic
1060664312 9:125423809-125423831 CAGGGCCCTGTTGGGGGAGGTGG + Intergenic
1061247116 9:129406189-129406211 TGGGGCCCTCTTGGGCAACAGGG + Intergenic
1061855247 9:133438402-133438424 TGTGGCCATCTTGGAGGCTGGGG - Intronic
1061999922 9:134210779-134210801 TGGGGCCACCCTGGGGGCTGTGG - Intergenic
1062155416 9:135045612-135045634 TGGTGCCCTCGCTGGGGATGAGG + Intergenic
1062479356 9:136744291-136744313 CTGGGCTCTCTTGGGGGAAGGGG - Intronic
1185511852 X:669720-669742 TGGGGGCCTGTTGGGGGGTGAGG + Intergenic
1185988195 X:4860290-4860312 TCAGGACCTGTTGGGGGATGAGG + Intergenic
1186153998 X:6706972-6706994 TAGGTGCTTCTTGGGGGATGAGG + Intergenic
1186158077 X:6746570-6746592 CTGGGGCCTGTTGGGGGATGGGG - Intergenic
1186994355 X:15103889-15103911 CGGGGGCCTGTTGGGGGGTGGGG + Intergenic
1187574486 X:20540168-20540190 CGGGGACCTGTTGGGGGCTGGGG - Intergenic
1189191380 X:39110668-39110690 TGGGGCCTGCTTGAGGGAGGAGG + Intergenic
1189288747 X:39870535-39870557 TGGGGCCCTCTGGGGTCCTGAGG - Intergenic
1189736961 X:44081033-44081055 TGGGGCCCACTCGGGGGTGGAGG - Intergenic
1189958742 X:46305292-46305314 CCGGGGCCTGTTGGGGGATGGGG + Intergenic
1190812047 X:53894372-53894394 TCGGGGCCTGTTGGGGGGTGGGG + Intergenic
1192064863 X:67872226-67872248 TGGGGCCCTGTCGTGGGGTGGGG + Intergenic
1192241766 X:69336769-69336791 TGGGGCCTACTTGAGGGTTGGGG - Intergenic
1192418188 X:71003486-71003508 TGGGGCCTACTTGAGGGAGGAGG - Intergenic
1192657123 X:73003480-73003502 GGGGCCCCCCTTGGGGGAGGCGG + Intergenic
1192664997 X:73079521-73079543 GGGGCCCCCCTTGGGGGAGGCGG - Intergenic
1193209821 X:78793691-78793713 CGGGGGCCTGTTGGGGGGTGTGG + Intergenic
1193428759 X:81373950-81373972 TGGGGCCCACTTGAGGGTGGTGG - Intergenic
1193722198 X:85000282-85000304 TGGGGCCCACTTGAGGGTAGAGG - Intergenic
1194057034 X:89148275-89148297 AGGGGCCTACTTGGGGGTTGAGG + Intergenic
1194166129 X:90519359-90519381 TGGGGGCCTGTTAGGGGAGGTGG + Intergenic
1194797829 X:98235017-98235039 CTGGGGCCTGTTGGGGGATGGGG - Intergenic
1194964532 X:100272201-100272223 CCGGGCCCTGTTGGGGGGTGGGG + Intergenic
1195329631 X:103786519-103786541 TGGGGCCCTCCTGCTGGCTGAGG + Exonic
1195421378 X:104678810-104678832 ATGGGGCCTGTTGGGGGATGAGG + Intronic
1196039288 X:111184554-111184576 CCGGGGCCTGTTGGGGGATGGGG - Intronic
1196166952 X:112545959-112545981 TGGGGCCTGTTTGGGGGTTGGGG - Intergenic
1197003805 X:121472188-121472210 CTGGGGCCTGTTGGGGGATGTGG - Intergenic
1197241020 X:124123333-124123355 TGGGGCCTGCTTGGGTCATGTGG + Intronic
1197579367 X:128262871-128262893 TGGGGCCCTTTTATGGGATTTGG + Intergenic
1197926154 X:131648529-131648551 TGGGGCCTACTTGAGGGAGGAGG - Intergenic
1198610452 X:138393916-138393938 TTGGGGCCTGTTGGGGGTTGGGG + Intergenic
1199175886 X:144786778-144786800 CTGGGGCCTGTTGGGGGATGGGG - Intergenic
1199340555 X:146671976-146671998 TGGAGCCAGGTTGGGGGATGAGG - Intergenic
1199461450 X:148090155-148090177 CGGGGGCCTGTTGGGGGGTGGGG - Intergenic
1199718019 X:150520388-150520410 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
1199894950 X:152119340-152119362 GGGGGTTCTCATGGGGGATGGGG + Intergenic
1200133581 X:153864097-153864119 TGGGGCCCTCTGGGGGGCTAAGG + Intronic
1200209908 X:154342534-154342556 GGCGGCCGTCTTGGGGGAAGTGG + Intergenic
1200220944 X:154389558-154389580 GGCGGCCGTCTTGGGGGAAGTGG - Intergenic
1200512398 Y:4097124-4097146 TGGGGGCCTGTTAGGGGAGGTGG + Intergenic
1201497745 Y:14607381-14607403 CCGGGGCTTCTTGGGGGATGGGG - Intronic
1202232544 Y:22671274-22671296 TGAGGTCCTCTTGGGGTCTGGGG - Intergenic
1202310612 Y:23524884-23524906 TGAGGTCCTCTTGGGGTCTGGGG + Intergenic
1202560190 Y:26145710-26145732 TGAGGTCCTCTTGGGGTCTGGGG - Intergenic