ID: 1104544151

View in Genome Browser
Species Human (GRCh38)
Location 12:129696022-129696044
Sequence ATCCTATTCTGGGCCAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104544148_1104544151 -2 Left 1104544148 12:129696001-129696023 CCTGAAATAGAATAAGAAGAAAT 0: 1
1: 0
2: 9
3: 85
4: 860
Right 1104544151 12:129696022-129696044 ATCCTATTCTGGGCCAACACAGG 0: 1
1: 0
2: 1
3: 6
4: 74
1104544147_1104544151 13 Left 1104544147 12:129695986-129696008 CCAGGGCACATTTTACCTGAAAT 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1104544151 12:129696022-129696044 ATCCTATTCTGGGCCAACACAGG 0: 1
1: 0
2: 1
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104544151 Original CRISPR ATCCTATTCTGGGCCAACAC AGG Intronic
909879165 1:80850760-80850782 AAGCTATTGTGGGCCAACACAGG + Intergenic
910855231 1:91688277-91688299 ATCCTATTCAGGGGCCACAAAGG - Intronic
913072345 1:115311025-115311047 ATTCTATTTTGGGCAAACAAGGG + Intronic
916212960 1:162373410-162373432 ATTCTATTCTGCCCCAGCACTGG + Exonic
918363401 1:183782107-183782129 ATCCTTTTCTGGCCAAGCACAGG - Intronic
919164481 1:193874911-193874933 ATCATATTCAGGGCAAAAACTGG + Intergenic
921619230 1:217308214-217308236 ATCCTGTTCTGGACCAATAATGG - Intergenic
922181194 1:223234177-223234199 AGGCCATTCTTGGCCAACACAGG - Intronic
923316932 1:232789479-232789501 ATTCTAGTGTGGGCCAAAACTGG - Intergenic
1063311182 10:4953832-4953854 ATGCTATTCTGGGCCATTCCAGG + Intronic
1063316613 10:5012587-5012609 ATGCTATTCTGGGCCATTCCAGG - Intronic
1067827908 10:49592691-49592713 ATCCTAATCTTGGCCAACACAGG - Intergenic
1075316842 10:121459913-121459935 ATTCTAATCTTGGCCAAAACTGG + Intergenic
1076334857 10:129699574-129699596 ATCCTATTATAGGCCACCAACGG - Intronic
1082129819 11:48474531-48474553 AGCCTATTCTGTGCCAAGAATGG + Intergenic
1084327453 11:68410013-68410035 AACCTCTACTGGGCCGACACTGG + Exonic
1085808169 11:79655838-79655860 AAACTACTCTGGGCCAACAAAGG + Intergenic
1088118689 11:106341780-106341802 ATGCTAGCCTGGGCCTACACAGG - Intergenic
1089695199 11:120212201-120212223 ACCCTAATCTGGGCCAAAATAGG - Intronic
1093642912 12:21548630-21548652 AGCCAGTTCTGGGCCCACACTGG + Intronic
1094807314 12:34106424-34106446 ATCCCATTCAGGGCCAACAGAGG + Intergenic
1095905461 12:47372960-47372982 ATCATATTCTTGGACCACACTGG + Intergenic
1104544151 12:129696022-129696044 ATCCTATTCTGGGCCAACACAGG + Intronic
1109660702 13:65457049-65457071 ATCTTAGCCTGGGCCTACACGGG + Intergenic
1111642589 13:90988406-90988428 ATCCTTATCTTTGCCAACACTGG - Intergenic
1112396066 13:99033355-99033377 ATCCTATTTTAGGGCAACACTGG - Intronic
1124856694 15:33396188-33396210 ATACTATTCTGGGCCAGAATAGG - Intronic
1125797121 15:42411114-42411136 ATCCCATTCTGGGCCTAAAGAGG - Intronic
1129452825 15:75660204-75660226 TTCCTGTACTGGGCCAAGACTGG - Exonic
1142664267 17:1453490-1453512 ATCTGGTTCAGGGCCAACACAGG + Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1156267549 18:35502120-35502142 ATCCTGGTATGTGCCAACACTGG - Intergenic
1157757524 18:50231928-50231950 CCCCTCTCCTGGGCCAACACAGG + Intronic
1158094772 18:53758230-53758252 ATCCTACTCTTGGCAATCACTGG + Intergenic
1159263989 18:66055521-66055543 ATATATTTCTGGGCCAACACTGG + Intergenic
1162399412 19:10435831-10435853 ATCTGATTCTGGGGCATCACTGG + Intronic
1165381869 19:35487500-35487522 ATCCTATACTGGGCACCCACGGG - Intronic
928437525 2:31265000-31265022 ATGCTAGTCTAGGCCTACACAGG + Intronic
928733371 2:34258649-34258671 ATCCTATTCCCTTCCAACACAGG + Intergenic
932291954 2:70589137-70589159 ATGCAATTCTGGCCCAACAATGG - Intergenic
932794459 2:74682498-74682520 ATCCTGTTCTGGGTCACCTCTGG + Intronic
932834966 2:75027769-75027791 ACCCTATTTTGTACCAACACAGG + Intergenic
936079134 2:109420396-109420418 ATCCTGTTCTGTAACAACACAGG - Intronic
1170912858 20:20592272-20592294 ATCCTAGTCAGGGTGAACACAGG + Intronic
1177947388 21:27488741-27488763 ATTCAATTCTGGGCCCACCCCGG - Intergenic
1181996204 22:26884786-26884808 AGCTTATTCTGGGCCACCACTGG + Intergenic
957796245 3:85011648-85011670 AACCTTTTGGGGGCCAACACAGG + Intronic
966743680 3:183255190-183255212 ATCCTTTTCTGGGTCAACTTCGG - Intronic
969778754 4:9380185-9380207 AGTCTTTTCTGGGCCAACAAGGG - Intergenic
971223770 4:24732909-24732931 AGCCAATTCTGGGCCTGCACAGG - Intergenic
973531204 4:51838579-51838601 ATACCAGTCTGGGCCAACACAGG - Intergenic
974060788 4:57033216-57033238 ATGCTTTTCTGGGCCACCCCGGG + Exonic
985974195 5:3402400-3402422 ACCTTAGTCTGGGCCTACACAGG - Intergenic
992449057 5:76859276-76859298 ATCCTAATCTTAGTCAACACTGG - Intronic
993489210 5:88525619-88525641 AACCCATTGTGGCCCAACACAGG + Intergenic
996843793 5:127877632-127877654 ATATTATTCTGGGACAACAATGG - Intergenic
997947019 5:138211831-138211853 ATCCTATTCAGGACCAACGATGG + Intronic
998953438 5:147414490-147414512 ACAGTATTCTGGGCCAAAACTGG + Intronic
1001609417 5:172988111-172988133 ATATTATTCTAGGCCCACACAGG + Intronic
1001946087 5:175779244-175779266 ATCCAATTCTGAGACAGCACAGG + Intergenic
1014347013 6:120283942-120283964 ATCTTATCCTAGGCCTACACAGG + Intergenic
1019692822 7:2426209-2426231 GTCCTATCCTGGGGCAACCCTGG - Intronic
1031347161 7:120682536-120682558 ATACTATTCTTGGAGAACACTGG - Intronic
1036137283 8:6173889-6173911 ATTCTTTTCTGGGCAAAGACAGG + Intergenic
1036276205 8:7354158-7354180 AGTCTTTTCTGGGCCAACAAGGG - Intergenic
1036345142 8:7956189-7956211 AGTCTTTTCTGGGCCAACAAGGG + Intergenic
1036840475 8:12116956-12116978 AGTCTTTTCTGGGCCAACAAGGG + Intergenic
1036862273 8:12363201-12363223 AGTCTTTTCTGGGCCAACAAGGG + Intergenic
1037187442 8:16080923-16080945 TTCCTGATCTGGGCCAATACAGG + Intergenic
1041831647 8:62161819-62161841 ATTCTATCCTGTGCCACCACAGG + Intergenic
1049569537 8:143362723-143362745 ATCCTCATCTGAGCCACCACGGG + Intergenic
1050211816 9:3268069-3268091 ATGATATTCTGGGCCACCTCTGG + Intronic
1050495823 9:6241005-6241027 ACCCTAGTCTAGGCCTACACAGG + Intronic
1056733330 9:89184059-89184081 ATCCTATTATGAGACAGCACTGG - Intergenic
1057951153 9:99369951-99369973 ATCCTATACGGTGCCTACACAGG + Intergenic
1059448738 9:114356774-114356796 CTCTTATTCTGGGCCATCACAGG + Intronic
1061262144 9:129486336-129486358 ATCCCATTCTGGGCCAAATGGGG + Intergenic
1190125081 X:47697789-47697811 AAACTATTCTGGGACAACATTGG + Intergenic
1190693079 X:52928223-52928245 AAACTCCTCTGGGCCAACACTGG - Intronic
1191801623 X:65087240-65087262 ACCCTATGCTAAGCCAACACAGG + Intergenic
1197345330 X:125321770-125321792 ATCATGTTCTGGGGCATCACTGG - Intergenic
1197345342 X:125321833-125321855 ATCATGTTCTGGGGCATCACTGG - Intergenic