ID: 1104547828

View in Genome Browser
Species Human (GRCh38)
Location 12:129728187-129728209
Sequence CTGAATATAAAGAATGCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 390}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104547825_1104547828 12 Left 1104547825 12:129728152-129728174 CCCACATCAATCCATCATGAAAC 0: 1
1: 0
2: 2
3: 7
4: 171
Right 1104547828 12:129728187-129728209 CTGAATATAAAGAATGCAATAGG 0: 1
1: 0
2: 0
3: 34
4: 390
1104547826_1104547828 11 Left 1104547826 12:129728153-129728175 CCACATCAATCCATCATGAAACA 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1104547828 12:129728187-129728209 CTGAATATAAAGAATGCAATAGG 0: 1
1: 0
2: 0
3: 34
4: 390
1104547823_1104547828 25 Left 1104547823 12:129728139-129728161 CCCTCAAGAATGTCCCACATCAA 0: 1
1: 0
2: 1
3: 19
4: 238
Right 1104547828 12:129728187-129728209 CTGAATATAAAGAATGCAATAGG 0: 1
1: 0
2: 0
3: 34
4: 390
1104547827_1104547828 1 Left 1104547827 12:129728163-129728185 CCATCATGAAACAGAATATAGAC 0: 1
1: 0
2: 0
3: 13
4: 222
Right 1104547828 12:129728187-129728209 CTGAATATAAAGAATGCAATAGG 0: 1
1: 0
2: 0
3: 34
4: 390
1104547824_1104547828 24 Left 1104547824 12:129728140-129728162 CCTCAAGAATGTCCCACATCAAT 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1104547828 12:129728187-129728209 CTGAATATAAAGAATGCAATAGG 0: 1
1: 0
2: 0
3: 34
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104547828 Original CRISPR CTGAATATAAAGAATGCAAT AGG Intronic
900687633 1:3958707-3958729 CTGAACCTAAATAATACAATGGG - Intergenic
900770362 1:4537069-4537091 ATAAATAAAAAGAATCCAATAGG + Intergenic
901433336 1:9231724-9231746 CTGAAAATAGAAACTGCAATGGG + Intergenic
902052953 1:13578610-13578632 GTAAATATAAAGTATGAAATGGG + Intergenic
904643973 1:31952106-31952128 CTGAAGTTAAGGAATGCAAAAGG - Intergenic
905334473 1:37234920-37234942 CTGAAGTTAAAGATTGCATTTGG - Intergenic
906765230 1:48424006-48424028 TTTAAAATAAAGAATGTAATTGG - Intronic
908119740 1:60974889-60974911 CTGAATAGAAAGAATAGAAAGGG - Intronic
908348010 1:63255512-63255534 GTGAATAAAAATAATGCCATAGG + Intergenic
909614272 1:77589300-77589322 ATGAATATAAATAATTCAAGAGG - Intronic
910089594 1:83446440-83446462 TTGAATATAGAGAATGCCTTAGG - Intergenic
910938951 1:92512287-92512309 CTGAATATAATTTAAGCAATGGG - Exonic
911394960 1:97293996-97294018 CTGAATATTAAGAATAAAATGGG + Intronic
911656081 1:100445444-100445466 ATGAACATGAAGAATGCAAATGG + Intronic
911826149 1:102487009-102487031 CTGGAGATAAAAAATACAATTGG + Intergenic
913734609 1:121764028-121764050 CTGTTTATAAAGACTGCAAGTGG + Intergenic
913804764 1:122774304-122774326 CTGTTTATAAAGTCTGCAATTGG + Intergenic
913850354 1:123591400-123591422 CTGTATATAAAGTCTGCAAGTGG + Intergenic
916180585 1:162080159-162080181 CTGAATATAAAAATTGTAAAGGG - Intronic
918127826 1:181599830-181599852 TTGAATTAAAAAAATGCAATTGG - Intronic
918295031 1:183148549-183148571 CTGAATATTCAGAAAGGAATTGG - Intergenic
920186986 1:204165889-204165911 CTGAATATTAAGAAGGGCATGGG - Intronic
921660588 1:217796515-217796537 TTAAATATAAAGAATGCAAGTGG - Intronic
921662141 1:217816582-217816604 CTGAATATAAAGTTTGCTATTGG + Intronic
921723686 1:218501334-218501356 CCAAATCTAAGGAATGCAATGGG + Intergenic
922623196 1:227007701-227007723 CTTAACATAGAGAATACAATAGG + Intronic
923080768 1:230652271-230652293 CTGAATATCATGTATGCAGTAGG + Intronic
923081803 1:230664352-230664374 CTAAAAATATAGAATGCTATAGG + Intronic
923496974 1:234534339-234534361 CTAAAAACAAAAAATGCAATTGG + Intergenic
924097511 1:240568585-240568607 CTGAATATAAAAACTAAAATAGG + Intronic
1063129951 10:3169574-3169596 CTAAATAGAAACAATGCAAAAGG + Intronic
1063717576 10:8543689-8543711 GTGAAAAGAAACAATGCAATTGG - Intergenic
1063738462 10:8790079-8790101 TTGAATATAAAGAAAAGAATAGG + Intergenic
1064068507 10:12204630-12204652 CTAAAAATAAAGACTGTAATTGG - Intronic
1064698726 10:17995451-17995473 CTAAATATGAAGAGTGCAAAAGG + Intronic
1066555161 10:36604425-36604447 CTGAATATGAAGGATTTAATAGG + Intergenic
1067157420 10:43793826-43793848 TAGAATCTAAACAATGCAATTGG - Intergenic
1068178471 10:53492548-53492570 CTTAATTTAAAGAATTTAATTGG - Intergenic
1068957064 10:62827750-62827772 CTTAATATAATGAAAGGAATTGG + Intronic
1072173278 10:92889021-92889043 CTAAATGTAAAAAATGCAAAAGG + Intronic
1072906065 10:99455061-99455083 CAGAATATAAAGAATTGAAGAGG + Intergenic
1073368534 10:102966093-102966115 CTGAATATAAAATCTGCAAGTGG - Intronic
1073905251 10:108272445-108272467 CTGGAGATGAAAAATGCAATTGG - Intergenic
1075343050 10:121662527-121662549 TTGAATATGAACAATGCAATGGG + Intergenic
1076414012 10:130271967-130271989 CTGAATGGAAAGAATGCTGTCGG - Intergenic
1077348930 11:2081413-2081435 TTTAAAATAAAGAATGTAATTGG - Intergenic
1077471713 11:2766059-2766081 ATGGAAATGAAGAATGCAATAGG - Intronic
1077852046 11:6082563-6082585 TTTAAAATAAAGAATGTAATTGG + Intergenic
1078195136 11:9130867-9130889 CTGAACATAAAGCCTGCTATTGG - Intronic
1078968378 11:16374396-16374418 CTGAATCTGAAGAATGCAGAAGG - Intronic
1081178043 11:39953259-39953281 GTGAACACAAATAATGCAATAGG - Intergenic
1081307261 11:41528527-41528549 CTGAATTTAATGAATTTAATCGG - Intergenic
1082171515 11:49010973-49010995 TTGAATACAAACAATGCAAGTGG - Intergenic
1082633913 11:55573412-55573434 CTAAATATAAACAGTCCAATAGG + Intergenic
1082780032 11:57280131-57280153 CTGAATATACTAAATGCCATTGG + Intergenic
1083689613 11:64399317-64399339 CTCAATAATAATAATGCAATAGG + Intergenic
1084108195 11:66994769-66994791 CCAAATAGAAATAATGCAATTGG - Intergenic
1085290461 11:75395622-75395644 CTGAATAGAATGAATAAAATAGG + Intergenic
1086694384 11:89826108-89826130 TTGAATACAAACAATGCAAGTGG + Intergenic
1086711762 11:90018403-90018425 TTGAATACAAACAATGCAAGTGG - Intergenic
1086805269 11:91233594-91233616 TTGAATAAAAAGGAAGCAATTGG + Intergenic
1086919571 11:92571157-92571179 CTAAATATGAAGAATGAATTAGG + Intronic
1087862213 11:103173397-103173419 CAGAATAAAAATCATGCAATAGG - Intronic
1088317403 11:108521082-108521104 CTGAAAATAAAGACTGGAAAGGG - Intronic
1090033962 11:123231978-123232000 CTGACTATAAACAATTCAAATGG + Intergenic
1091467346 12:696712-696734 CTGAAGATGGAGAACGCAATGGG + Intergenic
1092296786 12:7207101-7207123 ATGATTATTAAGAATGAAATCGG + Intronic
1092405016 12:8215132-8215154 CTGAATTTAAAGAAAGAAAAAGG + Intergenic
1092605127 12:10110388-10110410 CTGAATAGAAATAATGAAAGTGG - Intronic
1093211216 12:16311352-16311374 CTGAAAATAAGAAGTGCAATTGG - Intergenic
1093741085 12:22690045-22690067 CAGAAGAAAAAGAATGAAATTGG + Exonic
1094334711 12:29335986-29336008 CCTAATATAAACAAAGCAATGGG + Intronic
1096714128 12:53480920-53480942 CTGAATATAAGGAATGGGGTGGG + Intronic
1096929262 12:55187009-55187031 CTGACTATAATGAATAAAATTGG + Intergenic
1098474863 12:70888897-70888919 CAAAATATAAAGAATTCAATAGG + Intronic
1098514656 12:71359716-71359738 CTGCAGATAAAGAATTCAATAGG + Intronic
1098768695 12:74524053-74524075 CAGGAAATAAAGAATACAATTGG - Intergenic
1099281331 12:80651514-80651536 CTGAAAAGAGAGAAAGCAATAGG + Intronic
1099736611 12:86575225-86575247 TTTAAAATAAAGAATGCAATTGG - Intronic
1100360626 12:93876629-93876651 CTGAAGCTGAAAAATGCAATTGG - Intronic
1100821433 12:98434915-98434937 CTGAATCTAAAGAATGCTTTGGG - Intergenic
1101643592 12:106607100-106607122 CAGATCATAAAGAAGGCAATGGG + Intronic
1102833051 12:116025086-116025108 CTGAAAATAAAACATGCAAATGG + Intronic
1104179320 12:126363100-126363122 CTGAAGCTACAGAATGCATTGGG + Intergenic
1104547828 12:129728187-129728209 CTGAATATAAAGAATGCAATAGG + Intronic
1104589432 12:130072430-130072452 TTGAATATAAAGAAAATAATAGG + Intergenic
1105807066 13:23959420-23959442 CAGACCAAAAAGAATGCAATGGG - Intergenic
1106274051 13:28186819-28186841 GTTAATATAATGAATGCATTTGG + Intronic
1106636927 13:31539124-31539146 CTGAATATGAATAATGGAAATGG + Intergenic
1107656840 13:42600078-42600100 CTGAGAATAAAGGATGAAATAGG - Intronic
1107807716 13:44170732-44170754 CTGCATCTGAAAAATGCAATTGG - Intergenic
1108341082 13:49498678-49498700 AGTAATATAAAGAATGCAGTGGG + Intronic
1108900195 13:55393309-55393331 ATGCAAAAAAAGAATGCAATTGG + Intergenic
1108936037 13:55880677-55880699 CTGACTATAAAAAATGCCAAAGG - Intergenic
1109065888 13:57689650-57689672 CTGTATATGCATAATGCAATCGG + Intronic
1109349476 13:61159850-61159872 GAGAGTATAAAAAATGCAATAGG + Intergenic
1110151113 13:72254613-72254635 CTGAATATATAGAATACATTTGG + Intergenic
1110630943 13:77707730-77707752 AGGAATATAAAGAAAGAAATGGG + Intronic
1110880851 13:80570321-80570343 CTTACTCTAAAGAAGGCAATGGG - Intergenic
1110926367 13:81159122-81159144 TAGAATTTAAAGAAGGCAATTGG - Intergenic
1111665199 13:91258763-91258785 CTGAATTTAAAGCATCAAATAGG + Intergenic
1112394407 13:99015486-99015508 TTGAATATACAGCATACAATTGG - Intronic
1112575437 13:100631702-100631724 TTGAATATAAAGTAAGAAATTGG - Intronic
1112677885 13:101724697-101724719 CCGAATATAAATAATGTTATTGG - Intronic
1113208728 13:107949399-107949421 ATAAATAAAGAGAATGCAATTGG + Intergenic
1113402911 13:110011283-110011305 TTGAACATAAAGAATAAAATTGG - Intergenic
1114926606 14:27409032-27409054 CTAAATATAAGGAATGTATTAGG + Intergenic
1116108050 14:40537054-40537076 CTGAATCTATAGAATGCTTTGGG - Intergenic
1116565782 14:46442542-46442564 CTGAAAAAAAAACATGCAATTGG + Intergenic
1116690021 14:48093871-48093893 GTGAATAGAAGGAAAGCAATGGG + Intergenic
1116733952 14:48664572-48664594 CTGAAAATAAACAATTCAAGAGG + Intergenic
1117482659 14:56163514-56163536 CTAAGTATAAAGAATGAAACCGG - Intronic
1118103442 14:62630990-62631012 GTGAAAATAAAGAATGCCATGGG + Intergenic
1118375934 14:65177090-65177112 GTGAATATGATGAATACAATAGG - Intergenic
1118627186 14:67670430-67670452 CTGAATATAAGGGATTGAATGGG - Intronic
1119601169 14:75978360-75978382 CTAACTATAAAGAAGGCAGTGGG - Intronic
1120447001 14:84611580-84611602 CTGAATATAATAAATGTGATTGG + Intergenic
1122808369 14:104273897-104273919 TTTAAAATAAAGAATGTAATAGG - Intergenic
1124723178 15:32131397-32131419 CAGAATAGAAATTATGCAATCGG - Intronic
1125366503 15:38921942-38921964 CTGAATATAATAATTGCAAAGGG + Intergenic
1125379457 15:39071904-39071926 TAGAATATAAAGTATGAAATTGG - Intergenic
1126028692 15:44474553-44474575 GTGGCTATAAAGAATGCAATGGG + Intronic
1126938430 15:53738290-53738312 GTAAATACAAAGAATGCAAAAGG + Intronic
1127366280 15:58293702-58293724 TGGAATAAGAAGAATGCAATGGG + Intronic
1128843185 15:70867013-70867035 CTGATTATAGAGAATTCAAGTGG + Intronic
1129099264 15:73243889-73243911 CTCAATAAAAAGAATGCTAGAGG - Intronic
1130033516 15:80337114-80337136 CTGAATATAAAGTTGGGAATGGG + Intergenic
1130729137 15:86472561-86472583 CTGACTATAAATATTGCAACTGG + Intronic
1130758328 15:86790303-86790325 CTGAATAGAAAGGAAGCCATGGG + Intronic
1133254006 16:4505283-4505305 CTGAATATGAACAATGTATTAGG - Intronic
1134501915 16:14775995-14776017 CTGAAAATAAATAAATCAATTGG - Intronic
1134578646 16:15352899-15352921 CTGAAAATAAATAAATCAATTGG + Intergenic
1134702832 16:16279845-16279867 CTGAATATATGGAATGAAAGAGG + Intronic
1134723942 16:16404646-16404668 CTGAAAATAAATAAATCAATTGG - Intergenic
1134943488 16:18307224-18307246 CTGAAAATAAATAAATCAATTGG + Intergenic
1134964711 16:18432270-18432292 CTGAATATATGGAATGAAAGAGG - Intronic
1134968998 16:18514805-18514827 CTGAATATATGGAATGAAAGAGG - Intronic
1135928598 16:26717324-26717346 CTTAATATTAAAAATGAAATAGG + Intergenic
1137046535 16:35668630-35668652 CTGAATAAAAAACATGCAATGGG + Intergenic
1137358448 16:47789915-47789937 CTTTCTATAAAGAATGCCATTGG + Intergenic
1137511888 16:49107877-49107899 CTGAATTTAAAGGATGCAGCAGG + Intergenic
1137914771 16:52417501-52417523 TTGAAAATAAAAAATTCAATGGG - Intergenic
1139314090 16:66053219-66053241 GTGAATATAAAAAAAGAAATAGG + Intergenic
1140630977 16:76851904-76851926 CTTAATTAAAAGAATGCAAATGG - Intergenic
1140957834 16:79883099-79883121 TTGAATATATAAAATACAATTGG - Intergenic
1141257194 16:82413628-82413650 CTGAATATTGAAAATGCAAATGG + Intergenic
1142784320 17:2208561-2208583 GTGAATATAAAGAAACGAATTGG - Intronic
1143176540 17:4958744-4958766 CTGTATTTTAAGAGTGCAATCGG - Intergenic
1143985523 17:10910317-10910339 CTGAATAGTAACAATACAATGGG + Intergenic
1144103143 17:11961844-11961866 CTGAAGATAAAGAATGGGAGGGG - Intronic
1145305283 17:21670783-21670805 CTGATTATAAATAAGACAATAGG + Intergenic
1148378414 17:47171751-47171773 CATAATATAAATAATGCCATAGG + Intronic
1148601876 17:48900403-48900425 GAGAATATAATGAATACAATGGG - Intergenic
1149360112 17:55886235-55886257 TTGGATATAAAGAGTGCAAGAGG + Intergenic
1149835895 17:59911889-59911911 CTTGATTTAAAGAATCCAATGGG - Intronic
1151024659 17:70663708-70663730 CTAAATAAAAAGAATGGCATGGG - Intergenic
1153147476 18:2050172-2050194 CTGAATATAAAACATTCAAAGGG + Intergenic
1153716887 18:7859341-7859363 CTGTGTCTAAAGAATGCAGTGGG - Intronic
1155986655 18:32237519-32237541 GTAAATATAAAAAAGGCAATTGG + Intronic
1156179630 18:34587703-34587725 CTGAAAATAAAGATTTCATTTGG - Intronic
1157093025 18:44658912-44658934 GTAAACATAAAGAATACAATGGG - Intergenic
1159479938 18:68977128-68977150 TTGACTATAAGAAATGCAATTGG + Intronic
1159494951 18:69190791-69190813 CTGATGATTAAGAATGCAAATGG + Intergenic
1159521867 18:69536108-69536130 CTGAGTATAAAGAAAGCATATGG + Intronic
1159710330 18:71750158-71750180 CTGTATATTAAGAAAGCATTTGG + Intronic
1162582135 19:11537946-11537968 CTCAGCATAAAGAATGCTATAGG + Intergenic
1164974603 19:32562807-32562829 CTGATGCTAAAGAATGCATTAGG - Intergenic
925566938 2:5265978-5266000 GTGTTTAAAAAGAATGCAATTGG + Intergenic
927362703 2:22254857-22254879 CTGAATATTAATAATGCAGGAGG - Intergenic
928248649 2:29654531-29654553 CTGAATATGAAAATTGCAACTGG + Intronic
929059707 2:37911125-37911147 CTGAAAATTAATAATGAAATTGG - Intergenic
929630612 2:43457785-43457807 GTGAATAAAAAGAATGAAATTGG - Intronic
931120248 2:59209755-59209777 GTGAAGATAAATAATGCAATTGG + Intergenic
933013619 2:77094726-77094748 CAGAATCAAAAGAATGAAATTGG + Intronic
933339339 2:81002894-81002916 CTGAAGTTGAAAAATGCAATTGG - Intergenic
933450120 2:82438431-82438453 CTAAATATAATGAAAGCAGTTGG - Intergenic
934848845 2:97683693-97683715 CTGAAAAAAAAGAAAACAATTGG + Intergenic
935098783 2:99972324-99972346 GTGAATATAAAGAATTCTCTTGG - Intronic
935391621 2:102559134-102559156 CTGAATACCATGAATGCACTAGG - Intergenic
936000068 2:108818304-108818326 CTGAAGAAAAATAATGGAATCGG + Intronic
938609036 2:132927431-132927453 CTGAATATACAGATTGCTTTAGG + Intronic
938665950 2:133537238-133537260 TTGAAAATAAAGAATGAAGTTGG - Intronic
939475325 2:142679511-142679533 ATGAAGAAACAGAATGCAATGGG - Intergenic
940504513 2:154535811-154535833 TTGAATAAAAAGAATGAAAAAGG + Intergenic
940718159 2:157251981-157252003 CTCAATATCAAGAAAGCAACTGG + Intergenic
940750654 2:157623726-157623748 TTTAAAATAAAGAATGTAATTGG + Intronic
941109670 2:161405254-161405276 GAGAGTATAAAGAATGCATTAGG - Intronic
941420093 2:165273838-165273860 ATGAATATATAGAATGCAAATGG + Intronic
942750236 2:179278299-179278321 CTGAAGCTGAAAAATGCAATTGG + Intergenic
943181836 2:184554372-184554394 CTGAATATTCAGAGTGAAATTGG + Intergenic
943190462 2:184671594-184671616 CTGAATATTGAGAAAGCACTAGG - Intronic
943527406 2:189034217-189034239 CTGAAATTAAATGATGCAATGGG + Intronic
944095612 2:195964212-195964234 CTGAATATGAAGATTGCTTTGGG + Intronic
944790483 2:203119725-203119747 AGGGATATAAAGAATGCAACTGG - Intronic
948968858 2:241407829-241407851 TTGAAAATAAAAAATGGAATGGG + Intronic
1170066069 20:12311851-12311873 CTGAATATAGAGAAAGCAAATGG - Intergenic
1170116310 20:12864134-12864156 CTGAAAATTAAGAATGGAAAGGG + Intergenic
1170864932 20:20145665-20145687 CTAAATTTAAAGAATGGAAAAGG + Intronic
1174288839 20:49492460-49492482 TTTAAAATAAAGAATGCAGTTGG + Intergenic
1177214773 21:18114270-18114292 TTTAAAATAAAGAATGTAATTGG + Intronic
1177387184 21:20423759-20423781 ATGAATGGTAAGAATGCAATGGG - Intergenic
1177838903 21:26215100-26215122 TTGAATGAAAACAATGCAATGGG + Intergenic
1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG + Intronic
1180114620 21:45692421-45692443 ATGAATATCAAGAATGAAAGAGG + Intronic
1182176785 22:28298337-28298359 CTAAATCTAAAGACTGCTATAGG + Intronic
1183922539 22:41180739-41180761 CTGAATACAAAGAAGTCAGTTGG + Intergenic
949428685 3:3948343-3948365 CTGGAGTTGAAGAATGCAATTGG - Intronic
949526355 3:4908490-4908512 CTGAAGATATAAAATGAAATAGG - Intergenic
949756020 3:7411617-7411639 CAGAAAATAAAGAATGCATTCGG - Intronic
949756679 3:7419554-7419576 CTGAGTTTAAAAAATGCATTTGG - Intronic
950307988 3:11931052-11931074 CTCAAAAAAAAGAAAGCAATGGG - Intergenic
950744580 3:15076797-15076819 CTGTATATAAAAAATACAAATGG + Intronic
951971740 3:28453398-28453420 CAGTATATAAAGAATGGAACAGG + Intronic
952217401 3:31291045-31291067 CTGAAAACAAAGAATGCCACAGG + Intergenic
953964714 3:47295293-47295315 CTGAATATCAAGAATACAGCTGG - Intronic
955115239 3:55991878-55991900 TGGAATACTAAGAATGCAATTGG - Intronic
956672401 3:71703687-71703709 CTGAAGAAAAAGAATGCACTTGG + Intronic
957268050 3:77993024-77993046 CTGGAGCTAAAAAATGCAATTGG - Intergenic
957474581 3:80706606-80706628 CTGAATAAAGAAAATGCAGTGGG + Intergenic
957622067 3:82605888-82605910 CTGGAGCTAAAAAATGCAATTGG + Intergenic
957973669 3:87415996-87416018 CTATATATAAAGAATGAAACTGG + Intergenic
958765167 3:98359469-98359491 CTGAAGCTGAAAAATGCAATTGG - Intergenic
959328592 3:104972464-104972486 CTGGAGCTGAAGAATGCAATTGG - Intergenic
960188446 3:114673208-114673230 CTGAAGATGAAGAATGCTGTTGG - Intronic
961062226 3:123839321-123839343 TTGAATATAAAGACAGAAATGGG + Intronic
961321001 3:126075549-126075571 CTGAAAAAAAAGAATGAAGTTGG + Intronic
962698237 3:137972066-137972088 CTGAGTATCAAGAGTGTAATTGG - Intergenic
963494686 3:146044486-146044508 CAGAATATCAAGAATTCAATTGG + Intergenic
963821328 3:149897933-149897955 CTAAAGATAAAGAATGTTATTGG - Intronic
964062450 3:152539698-152539720 CTGAATAGCAAGAATGGCATGGG - Intergenic
964156483 3:153591073-153591095 CTGAAAATAAAGCATGCCAGAGG + Intergenic
964942227 3:162173016-162173038 CTGCATATTAAGAATGCACCTGG + Intergenic
967827702 3:193891619-193891641 TTGTAGATAAAGAAAGCAATGGG + Intergenic
967899436 3:194434437-194434459 CTGAGTATCAAGAATGCAGCAGG + Intronic
968157239 3:196392070-196392092 CTGAAAAAAAAAAATGCAAAGGG + Intronic
968837790 4:2978383-2978405 CTGAATTTAATGAATGAATTAGG + Intronic
969981079 4:11155543-11155565 ATGAATATCAAGAATCCTATAGG - Intergenic
970782737 4:19758491-19758513 CTTAATATACAAAATGCTATTGG + Intergenic
970859373 4:20684122-20684144 CTGAAGATAAAGAAGGCTAAGGG + Intergenic
971643729 4:29168741-29168763 CTTAATAGAAAGAATGCATGAGG + Intergenic
971808927 4:31398192-31398214 CAGAATATAAAAAAGGCATTGGG - Intergenic
971984438 4:33803292-33803314 CTGAAAATAAATAATGGATTTGG + Intergenic
972384521 4:38551945-38551967 CTAAATACAAAGAAAGCAAAAGG - Intergenic
972876132 4:43362812-43362834 CTGAATATAAAAAATAAATTTGG + Intergenic
974630176 4:64478967-64478989 CTGGAGATGAAAAATGCAATTGG - Intergenic
974753728 4:66175687-66175709 ATGAATTCAAAGAAAGCAATAGG + Intergenic
974986811 4:69037533-69037555 CTGAATAAAGAAAATGGAATGGG - Intronic
975672971 4:76800580-76800602 CTGAACAAAAAGAATGAAACTGG + Intergenic
976246624 4:83012090-83012112 CTGCATATAAAAACAGCAATTGG - Intronic
976432263 4:84976058-84976080 TTGAATATAAAGTATCCAGTAGG - Intergenic
976943158 4:90731591-90731613 TTGAATATAAACCATACAATAGG + Intronic
977044977 4:92058216-92058238 TTTAAAATAAAGAATGTAATTGG + Intergenic
977115895 4:93028039-93028061 CTGAATAGAAAGTATGCAGCAGG - Intronic
978070785 4:104465623-104465645 ATGAAGATAAAGAAAGCATTAGG + Intergenic
978892020 4:113841269-113841291 GTAAATAAAAGGAATGCAATTGG - Intergenic
979100120 4:116602668-116602690 CTGAAGCTAAAAAATGCTATTGG - Intergenic
979643405 4:123036729-123036751 CTGAATAGAATGAATGAATTTGG + Intronic
980086139 4:128392123-128392145 CTGAATATTAAAAAGACAATGGG + Intergenic
980283264 4:130750347-130750369 CTGAATAAAATGAATGAAAATGG + Intergenic
981384547 4:144113724-144113746 GTGAATAAAACAAATGCAATTGG + Intronic
982516076 4:156351767-156351789 CTGAATAAATAAAATGCCATTGG - Intergenic
983456421 4:167969967-167969989 CTGGAGATGAAAAATGCAATTGG + Intergenic
986075492 5:4332872-4332894 CTGTATATGAAGAAAGCATTAGG + Intergenic
986202784 5:5593110-5593132 ATGTCTATAAAGAATGCCATTGG + Intergenic
986475440 5:8125755-8125777 TTTAAAATAAAGAGTGCAATTGG + Intergenic
986903407 5:12465203-12465225 CTGCATATAAAAAATACAATGGG - Intergenic
987352768 5:17036065-17036087 ATTAACATAAAGAATTCAATAGG + Intergenic
987797363 5:22646083-22646105 CTGGATATAAAGGAAACAATAGG + Intronic
988414657 5:30930971-30930993 CTGAAAAAAAAAAATGCACTGGG + Intergenic
989449766 5:41573017-41573039 CTAAGTATAATGAAGGCAATTGG - Intergenic
989671522 5:43923497-43923519 CTGAAGCTGAAAAATGCAATTGG - Intergenic
989706328 5:44335585-44335607 CTAAATAAATAGAATGTAATTGG - Intronic
989760315 5:45007901-45007923 ATGAATAAAAAAAATTCAATTGG + Intergenic
990762247 5:59142634-59142656 ATGGTTATAAAGAATGAAATGGG + Intronic
990859157 5:60306951-60306973 CGTAATATAATGAATACAATAGG - Intronic
990923656 5:60995004-60995026 CTGGAGATGAAAAATGCAATGGG - Intronic
991141244 5:63246076-63246098 ATGAATATAATGAATACAAAGGG - Intergenic
991422813 5:66458395-66458417 CTAAAGAAAAAGAATGCAAAGGG + Intergenic
991484304 5:67118633-67118655 CTTAATAAAAATATTGCAATTGG - Intronic
992454080 5:76900539-76900561 CTGAAGCTAAAAAATGCAATTGG - Intronic
992746025 5:79821232-79821254 CTGGATATAAAGAATTCTCTTGG + Intergenic
994381274 5:99074508-99074530 TGGAATTTGAAGAATGCAATTGG + Intergenic
994428573 5:99627022-99627044 CTGGAGTTAATGAATGCAATTGG - Intergenic
994613052 5:102070270-102070292 CTGAATATTAGAAATGCATTTGG - Intergenic
995040693 5:107584832-107584854 CTCCATATAAAGAATGTAAGAGG + Intronic
995432755 5:112099939-112099961 CTGATAATAAGGAATGCATTTGG - Intergenic
995777820 5:115744753-115744775 CTGAAGCTGAAAAATGCAATTGG - Intergenic
995925871 5:117372966-117372988 CTTAATATTAAGAATGAAAATGG - Intergenic
998975161 5:147637203-147637225 CTGAAAATAAAGAATGCTACAGG - Intronic
1000734460 5:164881740-164881762 CTGAAGATTAAGCATCCAATTGG - Intergenic
1001341069 5:170846008-170846030 ATAAAAATAAATAATGCAATTGG - Intergenic
1001516663 5:172360017-172360039 CGGAACCTAAAGAAAGCAATGGG + Intronic
1003161245 6:3636398-3636420 ATGAAGATGAAGGATGCAATGGG - Intergenic
1003422993 6:5974621-5974643 CTGAAGATAAAGAAAGAAAGTGG + Intergenic
1003740554 6:8933504-8933526 TTGAATCATAAGAATGCAATTGG - Intergenic
1005068874 6:21845965-21845987 CTGCATATCAAGAATGCTATTGG - Intergenic
1005113280 6:22309544-22309566 CTGAAAAGAAACAATGCAAAAGG + Intergenic
1005291181 6:24380426-24380448 CTGAAGATGAAGAAAGCAAGTGG + Intergenic
1005486795 6:26308149-26308171 CAGAATATAAAAAATGTGATAGG + Intergenic
1008043557 6:46828764-46828786 CTGAATGTAAAGGAAGGAATTGG - Intronic
1008213417 6:48754619-48754641 CTAAATAAAAACAAAGCAATGGG + Intergenic
1008304143 6:49880496-49880518 CTGAGTAAAAAGAATGAAACTGG - Intergenic
1008469458 6:51867177-51867199 CTAAATATATACAATGCATTTGG + Intronic
1008839415 6:55882486-55882508 CTAAATATACAGATTTCAATGGG + Intergenic
1010538842 6:77065789-77065811 TTGAAAATGAAGAATGCAGTGGG - Intergenic
1010568942 6:77454465-77454487 CTGAATACAAAGTATTCAAATGG + Intergenic
1010676807 6:78754829-78754851 CTGCAGATGAAAAATGCAATTGG + Intergenic
1011524718 6:88252020-88252042 ATGTATATAAGTAATGCAATGGG + Intergenic
1013668126 6:112368471-112368493 CAGAATATAAAGTATGGAATAGG + Intergenic
1014350446 6:120336775-120336797 CTGAATCCAAAGCATGCAAAAGG + Intergenic
1015125256 6:129747244-129747266 CTTAAAAGAAAAAATGCAATAGG + Intergenic
1015173853 6:130284726-130284748 ATTAACATAAAGAATGCACTCGG + Intronic
1015710232 6:136131047-136131069 CTGAATATACAGAATGGATATGG - Intronic
1016065168 6:139674643-139674665 CTAAAAATAAAGAATGTAATTGG + Intergenic
1016421464 6:143888460-143888482 CTGAATATATAGAATGTTTTGGG + Intronic
1016772779 6:147870640-147870662 TTGAATAAAAAAAATTCAATCGG + Intergenic
1016896337 6:149057069-149057091 CTTAAAACAAAAAATGCAATAGG + Intronic
1017273940 6:152543753-152543775 CTAAATATAGAAAAAGCAATGGG - Intronic
1017859891 6:158386160-158386182 TTGATTTTAAAGACTGCAATTGG + Intronic
1018095832 6:160386375-160386397 CTGCACTTGAAGAATGCAATTGG - Intronic
1018602086 6:165555151-165555173 TTTAAAATAAAGAATGTAATTGG + Intronic
1020124154 7:5523498-5523520 CTGATTGTAAAAAATGAAATAGG + Intergenic
1020671885 7:11126063-11126085 CAGAATATAAAGAATACTATTGG - Intronic
1020917909 7:14220322-14220344 CTACATACAAAGAATGCAGTTGG - Intronic
1021056155 7:16048851-16048873 CTGAAATGAAATAATGCAATTGG - Intergenic
1021214159 7:17895393-17895415 TTTAATATAAAGAATGCTTTTGG - Intronic
1022768085 7:33438135-33438157 CTATATATAAAAAATGCAATTGG + Intronic
1024374231 7:48619324-48619346 CTGAGAAAAAAAAATGCAATAGG + Intronic
1024662265 7:51509829-51509851 CTGCAGTTAAAGAATGCAATTGG - Intergenic
1024676587 7:51643101-51643123 CTCAATAGAATAAATGCAATTGG - Intergenic
1024923760 7:54590576-54590598 CTAAATAGAAAGAATGGAATAGG - Intergenic
1025229843 7:57195619-57195641 CTGACTATAAAGCATTTAATTGG - Intergenic
1025283241 7:57643182-57643204 CTGATTATAAATAAGACAATAGG + Intergenic
1027306453 7:76902878-76902900 TTGAATATAGAGAATGCCTTAGG - Intergenic
1027721885 7:81753351-81753373 CTGAATATTAAAAATGTAACTGG - Intronic
1027805735 7:82819797-82819819 GAGAATAAAAAGAACGCAATAGG + Intronic
1027982891 7:85249744-85249766 CTGAATCTTAAGAATACAATAGG - Intergenic
1029879536 7:103793021-103793043 TTCATTAAAAAGAATGCAATAGG + Intronic
1030599044 7:111571882-111571904 CTGGAACTAAAAAATGCAATTGG + Intergenic
1030805001 7:113906311-113906333 TTAAAAATTAAGAATGCAATAGG - Intronic
1030863530 7:114668828-114668850 CTGATTATGAAGAATCAAATTGG + Intronic
1031092450 7:117376100-117376122 GCCAATATAAAGAATGAAATGGG + Intronic
1031787215 7:126047685-126047707 TTAAAAATAAAGAATGTAATTGG + Intergenic
1031915178 7:127556193-127556215 ATGAAAATAGAGAATGGAATAGG - Intergenic
1032448573 7:132005482-132005504 ATGAATATAATAAATGGAATAGG - Intergenic
1033035313 7:137870651-137870673 CTGAGTAGAAACAATGCTATTGG - Intergenic
1033529709 7:142249365-142249387 CTGAACTTAAAGAATGTGATTGG + Intergenic
1035943956 8:3938367-3938389 CTGAATATGCTGAATGCAATCGG + Intronic
1036064348 8:5362263-5362285 ATCAATATAAAGAATGAGATCGG + Intergenic
1036271211 8:7304694-7304716 CTGAATTTAAAGAAAGAAAAAGG - Intergenic
1036350138 8:8005649-8005671 CTGAATTTAAAGAAAGAAAAAGG + Intergenic
1038527315 8:28287596-28287618 CTAAATTTAAAAAATGAAATAGG - Intergenic
1038529014 8:28301972-28301994 TTGAAAATAAAGAATGTAATTGG - Intergenic
1038556337 8:28520813-28520835 CTGAAGATATGGAATGCAGTAGG + Exonic
1038871745 8:31502857-31502879 CTGAAGCTGAAAAATGCAATTGG - Intergenic
1039057765 8:33550232-33550254 CTGGATTTAAAGAATGTAACTGG - Intronic
1041507720 8:58619622-58619644 GTTGATATATAGAATGCAATAGG - Intronic
1041598826 8:59690869-59690891 CTTGATATAAACATTGCAATGGG + Intergenic
1041795785 8:61746485-61746507 CTGACTATAAAAAATGTAAGTGG - Intergenic
1041869111 8:62613825-62613847 CTGGAGATGAAAAATGCAATTGG - Intronic
1042098374 8:65244960-65244982 CAGAATATCAACAATGCATTTGG + Intergenic
1042150357 8:65776206-65776228 TAGAAGATAAATAATGCAATGGG - Intronic
1042683605 8:71413323-71413345 CTGAATATTGAGAGGGCAATTGG - Intronic
1043096930 8:75987204-75987226 ATCAATAGAAAGAATGCAAAGGG + Intergenic
1043417517 8:80066435-80066457 CTGAATATAAAATATTTAATAGG + Intronic
1044571799 8:93727331-93727353 CGGAATAAAAAAAATACAATTGG - Intronic
1044914170 8:97094562-97094584 CAGAAAATAAAGAATGAAAATGG - Intronic
1045864945 8:106854348-106854370 CTCAATATAAAGATTTCAACTGG + Intergenic
1046169791 8:110490318-110490340 TTTAAAATAAAGAATGTAATTGG + Intergenic
1046216817 8:111159392-111159414 CTCAATTTAAAGAAAGCAATAGG - Intergenic
1046453565 8:114426798-114426820 CTGAATACCAACAATGCAAGGGG + Intergenic
1046911292 8:119630406-119630428 CTGAAAGTAAAGAAAGAAATAGG - Intronic
1047441736 8:124884750-124884772 CAGAATTTAAAGAAAACAATGGG + Intergenic
1047631487 8:126713495-126713517 CTGAATGTGAAGAATGGAAGTGG - Intergenic
1048114627 8:131507961-131507983 CTCATTATAAAGAATACTATGGG + Intergenic
1048227684 8:132604946-132604968 TTGAATTTATAGATTGCAATAGG - Intronic
1048839585 8:138553049-138553071 CTGAATATACAGAACAAAATAGG - Intergenic
1049935141 9:494206-494228 TTGAATATAAAGAATTTATTGGG + Intronic
1050560020 9:6825715-6825737 CTGAAGATAACAAAAGCAATAGG - Intronic
1050964712 9:11784324-11784346 CTAAATATACAGAATACAAAAGG - Intergenic
1051795370 9:20862702-20862724 CTGAATATGAGGTATGCATTTGG + Exonic
1055313416 9:75008749-75008771 CTGAATATATAGATTGCTTTGGG - Intronic
1056007470 9:82287330-82287352 CTGGAGCTAAAAAATGCAATTGG + Intergenic
1058065402 9:100543351-100543373 CTAGATATAAGAAATGCAATGGG - Intronic
1058285063 9:103167762-103167784 CTGGAGATGAAAAATGCAATTGG - Intergenic
1058402042 9:104630697-104630719 CTGAATATAAAGAACTGAAATGG - Intergenic
1059921228 9:119162189-119162211 ATGGATGCAAAGAATGCAATGGG - Intronic
1060123545 9:121019453-121019475 TTTAATATAAATGATGCAATAGG + Intronic
1060961851 9:127686370-127686392 CTGAATATACAGAATGTCAGAGG - Intronic
1061915419 9:133750320-133750342 CTGAAGCTGAAAAATGCAATTGG - Intergenic
1187143603 X:16617645-16617667 CTGCATGTAAAGAAAGCATTGGG - Intronic
1190510250 X:51167064-51167086 CTGAATATATAAAATGAGATTGG - Intergenic
1190661334 X:52656656-52656678 CTGAAAATACAGAAAACAATAGG + Intronic
1191983948 X:66958632-66958654 CTGAAGCTGAAAAATGCAATTGG - Intergenic
1192977889 X:76305538-76305560 CTGGAGCTGAAGAATGCAATTGG - Intergenic
1193063829 X:77235881-77235903 CTGGAGCTAAAGAATACAATTGG + Intergenic
1193516946 X:82477681-82477703 CTGAAGTTGAAGAATACAATGGG - Intergenic
1193524347 X:82571530-82571552 CTGGAGATGAAAAATGCAATTGG - Intergenic
1193555642 X:82950693-82950715 CTGGAACTAAAAAATGCAATTGG - Intergenic
1193887210 X:86997264-86997286 CTGGAGCTGAAGAATGCAATTGG - Intergenic
1193915613 X:87358631-87358653 CTGGAGGTTAAGAATGCAATTGG + Intergenic
1193981777 X:88189196-88189218 CTGAAGTTGAAAAATGCAATTGG + Intergenic
1194285527 X:92006416-92006438 CTGAAGCTGAACAATGCAATTGG - Intronic
1194352376 X:92836064-92836086 CTGAAACTGAAAAATGCAATTGG + Intergenic
1194378743 X:93167438-93167460 CTGCAGTTAAAAAATGCAATTGG + Intergenic
1194555721 X:95356317-95356339 CCGAAGACCAAGAATGCAATGGG - Intergenic
1195122785 X:101773858-101773880 CTGAAGCTGAAAAATGCAATTGG - Intergenic
1195318437 X:103701009-103701031 GTGAATAAAAAGAGGGCAATAGG + Intergenic
1195804943 X:108753881-108753903 CTGAGCAAAAAGAATGAAATGGG - Intergenic
1196115136 X:111991179-111991201 ATGAGTATAACAAATGCAATTGG - Intronic
1196251964 X:113471429-113471451 CTGAAAATAAAGATTCAAATGGG + Intergenic
1196471198 X:116030557-116030579 CTGAAGATGAAAAATGCAATTGG - Intergenic
1196938182 X:120750332-120750354 CTGCATATAAAGCATGAATTTGG - Intergenic
1197028082 X:121779941-121779963 TTAAAAATAAAGAATGTAATTGG - Intergenic
1197103172 X:122680505-122680527 CTCATTTTAAAGAATGTAATTGG + Intergenic
1197145349 X:123166185-123166207 CTTAATATAAATACTGCAGTAGG - Intergenic
1197224714 X:123945466-123945488 CTGTATATAAAGTATGCATAAGG + Intergenic
1197382614 X:125764433-125764455 CTGAAGGTGAAAAATGCAATTGG - Intergenic
1198044326 X:132885400-132885422 CTCAATAAAAAAAATGAAATCGG + Intronic
1199607637 X:149588452-149588474 TGGAATATAAAGAATGAACTAGG - Intergenic
1199631486 X:149780915-149780937 TGGAATATAAAGAATGAACTAGG + Intergenic
1200357498 X:155567316-155567338 CTGAACATAATGACTGCATTAGG + Intronic
1200603093 Y:5230954-5230976 CTGAAGCTGAACAATGCAATTGG - Intronic
1200660683 Y:5952802-5952824 CTGAAACTGAAAAATGCAATTGG + Intergenic
1201691607 Y:16772656-16772678 TTGAATAAACAGAATGAAATAGG - Intergenic