ID: 1104548074

View in Genome Browser
Species Human (GRCh38)
Location 12:129730689-129730711
Sequence GATGGTGCCCACCGAGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2808
Summary {0: 1, 1: 9, 2: 458, 3: 1015, 4: 1325}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104548074_1104548080 12 Left 1104548074 12:129730689-129730711 CCTCATTCTCGGTGGGCACCATC 0: 1
1: 9
2: 458
3: 1015
4: 1325
Right 1104548080 12:129730724-129730746 AGCACGGCTGGGATAAAAACAGG 0: 1
1: 0
2: 18
3: 106
4: 279
1104548074_1104548078 1 Left 1104548074 12:129730689-129730711 CCTCATTCTCGGTGGGCACCATC 0: 1
1: 9
2: 458
3: 1015
4: 1325
Right 1104548078 12:129730713-129730735 AATCAGCTGCCAGCACGGCTGGG 0: 16
1: 99
2: 144
3: 196
4: 285
1104548074_1104548077 0 Left 1104548074 12:129730689-129730711 CCTCATTCTCGGTGGGCACCATC 0: 1
1: 9
2: 458
3: 1015
4: 1325
Right 1104548077 12:129730712-129730734 TAATCAGCTGCCAGCACGGCTGG 0: 6
1: 26
2: 21
3: 47
4: 169
1104548074_1104548082 25 Left 1104548074 12:129730689-129730711 CCTCATTCTCGGTGGGCACCATC 0: 1
1: 9
2: 458
3: 1015
4: 1325
Right 1104548082 12:129730737-129730759 TAAAAACAGGCAGAGGAACCTGG 0: 3
1: 7
2: 130
3: 304
4: 662
1104548074_1104548076 -4 Left 1104548074 12:129730689-129730711 CCTCATTCTCGGTGGGCACCATC 0: 1
1: 9
2: 458
3: 1015
4: 1325
Right 1104548076 12:129730708-129730730 CATCTAATCAGCTGCCAGCACGG 0: 252
1: 472
2: 594
3: 535
4: 521
1104548074_1104548081 18 Left 1104548074 12:129730689-129730711 CCTCATTCTCGGTGGGCACCATC 0: 1
1: 9
2: 458
3: 1015
4: 1325
Right 1104548081 12:129730730-129730752 GCTGGGATAAAAACAGGCAGAGG 0: 1
1: 15
2: 138
3: 151
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104548074 Original CRISPR GATGGTGCCCACCGAGAATG AGG (reversed) Intronic