ID: 1104548342

View in Genome Browser
Species Human (GRCh38)
Location 12:129732603-129732625
Sequence TTGTGGAAGGGGAAGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 986
Summary {0: 1, 1: 1, 2: 7, 3: 98, 4: 879}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104548342_1104548354 19 Left 1104548342 12:129732603-129732625 CCCTCCCACTTCCCCTTCCACAA 0: 1
1: 1
2: 7
3: 98
4: 879
Right 1104548354 12:129732645-129732667 GCCTCCCCAGAAGCAAATGCTGG 0: 1
1: 67
2: 275
3: 670
4: 1061
1104548342_1104548351 -3 Left 1104548342 12:129732603-129732625 CCCTCCCACTTCCCCTTCCACAA 0: 1
1: 1
2: 7
3: 98
4: 879
Right 1104548351 12:129732623-129732645 CAAGGTGTAAATGCTCCCTGAGG 0: 1
1: 0
2: 0
3: 36
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104548342 Original CRISPR TTGTGGAAGGGGAAGTGGGA GGG (reversed) Intronic
900808990 1:4786941-4786963 TTGTGGAAGGGGCAGGGGTAGGG - Exonic
900996017 1:6124126-6124148 AGGTGGAAGGGAAAGAGGGAGGG + Intronic
901004372 1:6164793-6164815 TCTTGGAAGGGGAAGGGGGCTGG - Intronic
901821586 1:11833775-11833797 TGTTGGAAGGGGAACTGGTATGG + Intronic
902268976 1:15289486-15289508 TGGTGGAAGGGGATATGTGATGG - Exonic
902300982 1:15502581-15502603 CTGGGGAAGGTGAAGTGGCAGGG + Intronic
902601275 1:17541150-17541172 TGGTGGAAGGGGAAGGGACAGGG - Intronic
902642585 1:17776232-17776254 TGGTGGAAGGGGCAGGGTGAAGG - Intronic
902665522 1:17935059-17935081 TTTTAAAAAGGGAAGTGGGAGGG - Intergenic
902806070 1:18862077-18862099 TTGTGGCGTGGAAAGTGGGAGGG - Intronic
902872810 1:19324610-19324632 CTGTGGAAGAGGAAGAGGAAGGG - Intronic
902894396 1:19468849-19468871 TTGTTGAAGTGGAGGTGAGAGGG - Intronic
903057306 1:20645152-20645174 TCCTGGAAGGGGAAGAGGAACGG + Intronic
903320038 1:22537585-22537607 GTGTGTGATGGGAAGTGGGAGGG - Intergenic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903441065 1:23388145-23388167 TGGTGGAAGGGGAAGGAGGGTGG + Intronic
903650446 1:24918644-24918666 TTAAGGCTGGGGAAGTGGGAGGG - Intronic
904190358 1:28737997-28738019 ATGGGGGAGGGGAAGCGGGAGGG + Intronic
904273451 1:29365237-29365259 TGGAGGAAGGGAAAGAGGGAAGG - Intergenic
904273465 1:29365308-29365330 TGGAGGAAGGGAAAGAGGGAAGG - Intergenic
904823787 1:33261777-33261799 TTGGGGAAACTGAAGTGGGAAGG + Intronic
904893065 1:33793751-33793773 GTGTGGACGGAGAAGAGGGAGGG + Intronic
904911475 1:33937454-33937476 ATGGGGAAGTGGAAGTGGGCAGG + Intronic
904995412 1:34627706-34627728 GTGGGGAAGGGGAGGTAGGAAGG + Intergenic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905920660 1:41716575-41716597 TTGTAGGAGGAGCAGTGGGAGGG + Intronic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
906127806 1:43438223-43438245 TTGGGGAAGGGGAGCTGGGGTGG + Intronic
906587748 1:46994606-46994628 GTGGGGAAGGTAAAGTGGGAAGG + Intergenic
906643944 1:47459539-47459561 TTGTGGAGGGCTAAGTGAGATGG + Intergenic
906733532 1:48103156-48103178 TTGTGGGAAAGGAAGTGGGGAGG + Intergenic
907039568 1:51246329-51246351 CTTTGGAAGGCCAAGTGGGAAGG + Intronic
907615503 1:55920719-55920741 CTGTGAAAGGGGGGGTGGGAAGG + Intergenic
908389928 1:63675240-63675262 GTGTGGGAGGGGGAGAGGGAAGG - Intergenic
908494661 1:64682342-64682364 TTATGGAAAAGCAAGTGGGATGG - Intronic
908549206 1:65192510-65192532 TTTTGGAGGGGGAGGTGGGTAGG - Intronic
908883459 1:68759520-68759542 TGGTGGAAGGGGCAGTGGAGTGG - Intergenic
908995089 1:70141991-70142013 TTGGGGAAGGGTAAGAGGAATGG - Intronic
910123744 1:83818281-83818303 TGGTGGACGGGGAAGGGGAAGGG - Intergenic
910607662 1:89104767-89104789 TTGTGAACGGGGCAGGGGGAGGG + Intergenic
910645514 1:89510094-89510116 GTGGGGTAGGGGAAGTGGGGCGG - Intergenic
910840680 1:91558426-91558448 TTGGGGAGGGGGAAGGGGGATGG - Intergenic
910975185 1:92898868-92898890 CTCGGGAAGGTGAAGTGGGAGGG - Intronic
911069084 1:93817878-93817900 TAGGGGAAGGTGAACTGGGAGGG - Intronic
911215393 1:95187688-95187710 GTATGGAAGGGGCAGGGGGAGGG - Intronic
911405397 1:97431849-97431871 TAGTGGGAGGGGAAGGGGAAGGG - Intronic
911513452 1:98837386-98837408 TTGTGGAAGGGGCAGTGGAAAGG + Intergenic
911710359 1:101064547-101064569 GTGGGGACGGGGAGGTGGGATGG + Intergenic
912130698 1:106596512-106596534 GTGGGGTGGGGGAAGTGGGAGGG - Intergenic
912297509 1:108484609-108484631 TTTTGGAAGTGGAAGGGGGCCGG - Intergenic
912435799 1:109660211-109660233 TTATGTAAGAGGTAGTGGGAGGG + Intronic
912560997 1:110551484-110551506 ATGGGGAAGAGGGAGTGGGAGGG + Intergenic
912563270 1:110565568-110565590 CTGGGGAAGGGGATGTGGGGTGG + Intergenic
912778550 1:112522880-112522902 TTAAGGAGGGGGAAATGGGAGGG + Intronic
912810897 1:112793677-112793699 TTGAGGAAGGGCAAGGGGAAAGG + Intergenic
912935926 1:114003571-114003593 TTGGGGTAGGGGAAGTGGGAGGG - Intergenic
912954340 1:114143915-114143937 ATTTGGAGAGGGAAGTGGGATGG - Intronic
913010443 1:114677845-114677867 TTGAGGAAAGGGAAGAAGGAAGG - Intronic
913057896 1:115179117-115179139 TTGGGGGAGGAGAATTGGGAAGG + Intergenic
913069485 1:115286033-115286055 GTGTAGAAGGGGCAGGGGGAGGG + Exonic
913099721 1:115551923-115551945 TAGTGGCAGTGGATGTGGGAGGG - Intergenic
914326135 1:146618674-146618696 TTGTGGAAGGGGAAAGGGCATGG + Intergenic
914674262 1:149896368-149896390 TTGTGGGAGGGAAAGTGTCAAGG - Intronic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915007758 1:152655875-152655897 TTGGGGAAGGGAAGGAGGGAGGG - Intergenic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
915831998 1:159140035-159140057 TGGGGGAAGGGGAAGGGGAAGGG - Intronic
916168356 1:161982677-161982699 TCCTGGAAGGGAAGGTGGGAGGG + Intergenic
916620374 1:166490170-166490192 TGGTGGAAGGGGACCTGGAAGGG + Intergenic
917056686 1:170990014-170990036 TTGTGGAAGGGACAGAGGGTTGG - Intronic
917243233 1:172972194-172972216 TTGTGGCAGGAGAGGTGGTAAGG + Intergenic
917650433 1:177071361-177071383 TTGTGGTCAGGGAAGAGGGAAGG + Intronic
917964217 1:180168261-180168283 CTGTGGGAGGGGCACTGGGAGGG + Intronic
917991931 1:180389146-180389168 TTGTGGGCGGGGGAGCGGGAAGG - Intronic
919542719 1:198871506-198871528 TTGTGGGATGGGAGGTGGGGAGG - Intergenic
919617225 1:199822800-199822822 TTGTGGGAGAGAAAGTGGAAAGG - Intergenic
920039005 1:203084030-203084052 ATCTGTAAGGGGAGGTGGGAAGG + Exonic
920273648 1:204787289-204787311 TGGTGGAAGGGGAAGGGGAAGGG - Intergenic
920517535 1:206597385-206597407 AGGTGGAAGGGAAAGTGAGATGG + Intronic
921023849 1:211259766-211259788 CTGGGGGAGGGGAAGAGGGAGGG - Intronic
921241599 1:213189774-213189796 GTTCGGAAGGGGAAGTGGGAAGG - Intronic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921294363 1:213688231-213688253 TTGGGGAGAAGGAAGTGGGAGGG - Intergenic
921650379 1:217671511-217671533 TATTGCAAGAGGAAGTGGGAGGG - Intronic
922056573 1:222048065-222048087 ATGGGGAAGGGGAGGTGAGATGG - Intergenic
922069070 1:222173549-222173571 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
922780623 1:228249872-228249894 GCCTGGGAGGGGAAGTGGGAGGG - Intronic
922781893 1:228259408-228259430 GCCTGGAAGGGGAAGTGCGAGGG - Intronic
923438496 1:233992887-233992909 GTCTGAAAGGGAAAGTGGGAGGG + Intronic
923563226 1:235057499-235057521 TGGTGGCAGTGGAAGTGAGAAGG + Intergenic
923689135 1:236176070-236176092 TTGAGGCTGGGGATGTGGGAGGG + Intronic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1063790978 10:9447521-9447543 GAGAGGAAGGGGAAGGGGGAAGG - Intergenic
1063813454 10:9742055-9742077 TGGTGGAAGGGGAGGCAGGAAGG - Intergenic
1063920541 10:10927820-10927842 TTGCAAAAGAGGAAGTGGGAAGG - Intergenic
1064267342 10:13835833-13835855 TGGTGAAAGGGGGAGGGGGATGG - Intronic
1064709901 10:18112326-18112348 TAGCGGAAGGGAAAGTGGGCAGG - Intergenic
1065461995 10:25977834-25977856 ATCTGGAAGTGGAAGTGAGATGG - Intronic
1065815776 10:29481275-29481297 ATGGGGAAGGGGGTGTGGGAAGG + Intronic
1065957150 10:30703957-30703979 ATGGGGAAGGGGGTGTGGGAAGG - Intergenic
1067086994 10:43247740-43247762 TTGGGGAAGGGGCAGTTTGAGGG + Intronic
1067155975 10:43781736-43781758 TTGAGGCAGTGGGAGTGGGAAGG + Intergenic
1067473825 10:46553705-46553727 TTGTGGAGGGGGAATGGGGAAGG - Intronic
1067722311 10:48737750-48737772 TTGAGGTAAGGGAAGTGAGAGGG + Intronic
1068217592 10:54002900-54002922 TGGTGGAAGGGGACCTGGAAGGG - Intronic
1068438367 10:57019568-57019590 TTGTGGAAGGGGCAGTGGGAGGG - Intergenic
1068485696 10:57655572-57655594 GTCTGGAAGGTGAAATGGGAAGG + Intergenic
1069603947 10:69728309-69728331 TGGAGGAAGGGGAAGCAGGAAGG - Intergenic
1069860558 10:71468615-71468637 TTGTGGAAGGGCACCTAGGAGGG - Intronic
1070186654 10:74069862-74069884 TGGTGGAAGGGGAGCTGGGCGGG - Intronic
1070335501 10:75451605-75451627 TTGGGGTAGGGGAAGTGGAGGGG + Intronic
1070965749 10:80529274-80529296 TTGTGTCAGGGGAAATCGGATGG + Exonic
1071549144 10:86552841-86552863 AGGTGGAAGGGTAAGAGGGAAGG - Intergenic
1072108022 10:92291830-92291852 TTGGGGAGGGGGAAGGGGGAGGG - Intronic
1072783692 10:98266821-98266843 TTGTGGAAGGCTTTGTGGGAGGG - Intronic
1073184717 10:101608992-101609014 TTATGGGATGGGAAGTGGGCAGG - Intronic
1073259021 10:102174671-102174693 TTATCCAATGGGAAGTGGGAAGG - Intergenic
1073453294 10:103622076-103622098 TGGAGGATGGGGGAGTGGGATGG + Intronic
1073592128 10:104767624-104767646 AAGTGGGAGGGGAAGGGGGAAGG - Intronic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1074827915 10:117228223-117228245 TGGAGGAAGGGAAAGAGGGAGGG - Intergenic
1075379990 10:122011234-122011256 GTGTGGCTGGGGAAGTGGGAAGG + Intronic
1075585430 10:123653782-123653804 ATGGGGAAGGGGAAGGGAGAAGG + Intergenic
1076087705 10:127649794-127649816 TTGAGGAAGAGGAAGGGGAACGG - Intergenic
1076198467 10:128539176-128539198 TTGGGGTAGGGGGAGGGGGAAGG - Intergenic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1076578174 10:131485597-131485619 ATGTGGAAGGGGAAATGGGTAGG + Intergenic
1076762357 10:132611861-132611883 GTGTGGGAGGTGAAGTGGGCAGG + Intronic
1077063011 11:625990-626012 TTCTGTAAGGGGTAGTGGGGAGG - Intronic
1077091269 11:779405-779427 TTGGGGGAGGGGAAGAGGAATGG - Intronic
1077133471 11:986757-986779 TGGAGGGAGGGGAAGTGGGTGGG - Intronic
1077556226 11:3227429-3227451 TTGAGGAAGCTGGAGTGGGAGGG + Intergenic
1077616115 11:3675300-3675322 TTCTGGAAGGGGTAGATGGAGGG + Exonic
1077648113 11:3944464-3944486 GAGTGGAGGGGGAAGTGGGATGG + Intronic
1077761544 11:5104910-5104932 GTGAGGAAGGAGAAGAGGGAGGG - Intergenic
1077806591 11:5596547-5596569 ATGGGGGAGGGGAAGGGGGAAGG - Intronic
1077954014 11:6993525-6993547 TCATGGAAGGGTAAGTGAGAGGG - Intergenic
1078245436 11:9570097-9570119 TTCAGGAAGGGGAACTGGGCTGG + Intergenic
1078386954 11:10900743-10900765 TTGTGGAAAGAGCAGTGGGTTGG + Intergenic
1078660648 11:13282863-13282885 TTGTGGAGGAGGAGATGGGATGG + Intronic
1078875179 11:15387260-15387282 TTGTGAAAGGGGCAATGGCAAGG + Intergenic
1079431827 11:20397486-20397508 TTGAGGAAGAGGAAAGGGGAGGG - Intronic
1079571487 11:21949094-21949116 TCCTGGATGGGGAAGTTGGAGGG - Intergenic
1080250535 11:30228480-30228502 TTGTGGATGGGGAGGAGTGATGG - Intergenic
1080663453 11:34315600-34315622 TTGGGGCAGGGGAGGAGGGATGG - Intronic
1080665123 11:34329358-34329380 GGGTGGAGTGGGAAGTGGGATGG - Intronic
1080711298 11:34750236-34750258 CTTTGGAAGGGGACCTGGGAAGG + Intergenic
1081112736 11:39157003-39157025 TGGGGGAAGGGGAAGGGGGGAGG - Intergenic
1081126248 11:39326646-39326668 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
1081347717 11:42010847-42010869 TTAAGGAAAGGGCAGTGGGAAGG - Intergenic
1081806776 11:45895186-45895208 TAGTGGCAGGTGGAGTGGGATGG + Intronic
1082314515 11:50700445-50700467 TGGTGTGAGGGGAAGGGGGAGGG + Intergenic
1082803607 11:57432404-57432426 TGGAGGATGGGGAAGTGGGTAGG + Intergenic
1083210859 11:61184716-61184738 TTGGGGAGGCGGAGGTGGGAGGG + Intergenic
1083210870 11:61184749-61184771 TTGGGGAGGCGGAGGTGGGAGGG + Intergenic
1083929603 11:65833565-65833587 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1084022512 11:66426128-66426150 TTGGGGGGGGGGAGGTGGGAGGG + Exonic
1084149112 11:67279915-67279937 GTGTGGGAGAGGAAGGGGGAGGG + Intronic
1084569913 11:69953131-69953153 ATGGGGAAGGGGGAGAGGGACGG + Intergenic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1084720913 11:70905066-70905088 TGGTGGAAGGTGGAGTGGGGTGG + Intronic
1085068394 11:73519124-73519146 TTGTGGTAGAGCATGTGGGATGG - Intronic
1085235931 11:75015510-75015532 TTGTGGAGGGGGAAGCTTGAGGG - Intronic
1085306958 11:75492008-75492030 TGGTGGAAGGAGCACTGGGATGG - Intronic
1085639970 11:78187529-78187551 TTCTGGAAGGGGCTGGGGGATGG - Intronic
1085759973 11:79233433-79233455 TTGTGGAAGAGGCAGGGGGACGG + Intronic
1085833646 11:79929705-79929727 TTGTGGAAGGATAATTGGGTTGG + Intergenic
1086001573 11:81990942-81990964 GTGAGGTAGGGGAGGTGGGAGGG + Intergenic
1086101313 11:83102750-83102772 GTGTGGGAAGAGAAGTGGGAAGG - Intergenic
1086135603 11:83441219-83441241 TGGCGGAAGGGGAAGGGGAAGGG + Intergenic
1086964491 11:93013738-93013760 GGGTGGAAGGGCAAGGGGGACGG - Intergenic
1087269722 11:96098955-96098977 TTGTGGAAAGGGATGGGGGCAGG - Intronic
1087429182 11:98029929-98029951 TTGTGGAAGGAAATGTGGAAAGG - Intergenic
1088087672 11:106001097-106001119 TTGTGGTAGGAGAACTTGGAGGG + Intronic
1088111641 11:106268070-106268092 TGGTGGCAGGGGGAGTGGGGCGG + Intergenic
1088188089 11:107195949-107195971 GTGGGGTAGGGGAAGTGGGGAGG + Intergenic
1088968814 11:114753108-114753130 TAGTGAAAGGTGAAGTGGGCTGG + Intergenic
1089012378 11:115141750-115141772 ATCTGGGTGGGGAAGTGGGAGGG - Intergenic
1089143310 11:116305638-116305660 TTGTGGAGAAGGAAGTGTGAAGG - Intergenic
1089163521 11:116457672-116457694 CTGAGGAAGGGGAAGAGGCAGGG + Intergenic
1089200191 11:116720165-116720187 TTGTGGAAGGGCAAGTGCTGGGG - Intergenic
1089378699 11:118012684-118012706 TTGGGGATGGGGCAGGGGGAGGG + Intergenic
1089458414 11:118639031-118639053 TTGGAGTAGGGTAAGTGGGAGGG + Intronic
1089628212 11:119765140-119765162 TGGTGGCAGTGGAGGTGGGAGGG - Intergenic
1089677133 11:120097685-120097707 TTCAGGAAGGGGTAATGGGAAGG - Intergenic
1090265453 11:125350654-125350676 TTGGGGAAGGGAAAGAGGCAGGG - Intronic
1090337902 11:125986297-125986319 TGGGGGGAGGGGATGTGGGAGGG + Intronic
1090417854 11:126552965-126552987 CTGGGGAAGAGGATGTGGGAAGG - Intronic
1090601872 11:128380645-128380667 GAGGGGAAGGGGAAGAGGGAAGG - Intergenic
1091694521 12:2618756-2618778 AGAAGGAAGGGGAAGTGGGATGG + Intronic
1091845767 12:3655314-3655336 CTGTGGATGGGGAAATGGGGAGG + Intronic
1092468785 12:8760086-8760108 GTGGGGTAGGGGAAGGGGGAGGG - Intronic
1093206826 12:16261236-16261258 ATGAGGAAGGGGAAATGAGAAGG - Intronic
1093412967 12:18888408-18888430 TTGTGTATAGGGAAATGGGAAGG - Intergenic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1094016236 12:25867189-25867211 TTCTGGCAGGGGAAGTGGTTGGG - Intergenic
1094244231 12:28269278-28269300 TTGTGGCAGGCGGAGTGGGAGGG + Intronic
1094733833 12:33209678-33209700 TGGTGGAGGGAGAAGTGAGAAGG + Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095775855 12:46009265-46009287 TTGAGGAGGGAGAAGTCGGAAGG + Intergenic
1095919260 12:47513043-47513065 TTGTGGAGGGGGAGGGGAGAGGG + Intergenic
1095954809 12:47799874-47799896 CTGGAGAAGGGGAAGTGGGTGGG + Intronic
1096749165 12:53747918-53747940 TACTGGAAGGGGGTGTGGGAAGG - Intergenic
1096819302 12:54221364-54221386 TTGTAGGATGGGAAGTGAGAAGG - Intergenic
1096877904 12:54644843-54644865 TAGGGGAAGGGGAAGGGGAAGGG + Intronic
1096884007 12:54698894-54698916 GTGGGGAAGGGGGAGGGGGAGGG - Intergenic
1096957081 12:55536993-55537015 TTGTGGGGGGGGAGGGGGGAGGG + Intergenic
1097114563 12:56687999-56688021 TTGTGAACGGGGCAGGGGGACGG + Exonic
1097223608 12:57464140-57464162 TTCTGAAAGAGAAAGTGGGAGGG + Intronic
1097339149 12:58417578-58417600 TTGTTGATGGTGAAGTTGGAAGG + Intergenic
1097453330 12:59764473-59764495 TGGTGGAGGGGGAGGGGGGAGGG - Intronic
1097540699 12:60938522-60938544 TGGTGAAAGGGAAAGGGGGAAGG - Intergenic
1097710870 12:62915576-62915598 GGATTGAAGGGGAAGTGGGAGGG - Intronic
1097766108 12:63528890-63528912 TTGGGGAAGTGAAAGTGAGAAGG + Intergenic
1098043834 12:66379838-66379860 TTGTGAAAGAGGAAATGAGAAGG - Intronic
1098435378 12:70463349-70463371 TTTTGAATGGGAAAGTGGGATGG - Intergenic
1098739537 12:74154951-74154973 CTGGGGAAGCTGAAGTGGGAGGG - Intergenic
1099255804 12:80309840-80309862 TTCAGGAAGGAGATGTGGGATGG + Intronic
1099360124 12:81690488-81690510 TTGGGGGAGGAGGAGTGGGAGGG - Intronic
1099669273 12:85669580-85669602 TTGTGGAAGGATAGGAGGGAAGG - Intergenic
1099717777 12:86318459-86318481 TTGTGAAGAGTGAAGTGGGATGG - Intronic
1099796972 12:87411654-87411676 TGGTGGAAGGGGAAGCAGGCAGG - Intergenic
1099811916 12:87593661-87593683 TTGTGGGGGGGGAAGGGGGGAGG + Intergenic
1100109287 12:91218563-91218585 TTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1100145700 12:91674953-91674975 CTGTGGGAAGGGGAGTGGGAAGG - Intergenic
1100399944 12:94220754-94220776 TGGTGGAGGGGGAAGGGGTAAGG + Intronic
1100604811 12:96142925-96142947 TTGGGGAAGGAGAAGAGAGAGGG + Intergenic
1101053842 12:100892358-100892380 TTGAGGAAAGGAGAGTGGGAAGG + Intronic
1101594881 12:106155450-106155472 TAGGGGAAGGGGAAGAGAGAGGG - Intergenic
1101685911 12:107020618-107020640 TGGTGGAAGGGGAAGGGAAAGGG - Intronic
1101752225 12:107591397-107591419 TGGCGGAAGGGGAAGTAGGCTGG + Intronic
1102223095 12:111208034-111208056 AAGGAGAAGGGGAAGTGGGAGGG + Intronic
1102426497 12:112848111-112848133 TTGAAGAAGGGGCAGGGGGAGGG + Intronic
1102825294 12:115943663-115943685 TTGGGGAAGAGGAAGAGGGCTGG - Intergenic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1103782405 12:123407725-123407747 TTGAAGAAGGGAAAGTGGGGCGG - Exonic
1103924801 12:124417535-124417557 TCATGGGAGGGGAACTGGGAAGG + Intronic
1103947125 12:124532856-124532878 TGGGGGAAGGAGGAGTGGGACGG - Intronic
1104108022 12:125681576-125681598 ATGTGGAAGGGGAAATGGTGGGG + Intergenic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104842735 12:131832380-131832402 TGGGGGAACGGGAAGGGGGAAGG + Intronic
1105217691 13:18298755-18298777 TTGAAGAAGGGAAAGTGGGGCGG - Intergenic
1105309041 13:19190096-19190118 TTGTGGAAGGGAGGGAGGGAGGG + Intergenic
1105496422 13:20934671-20934693 ATGTGGAATGGGAAATGAGAGGG - Intergenic
1106458535 13:29948442-29948464 TTGGGGATGAGGACGTGGGAGGG - Intergenic
1106841070 13:33685504-33685526 TTGTGGAAGGGGCAGTGGTGGGG - Intergenic
1107522742 13:41199621-41199643 TTGTGTAAGGGGTAGTGGGGAGG + Intergenic
1107680923 13:42849394-42849416 TAGTGGAATGGGAAGTGTAATGG + Intergenic
1108816158 13:54293122-54293144 TTGGGGTAGGGAAATTGGGATGG - Intergenic
1109124585 13:58503799-58503821 GTGTGGAAGGGGACCTGAGAGGG + Intergenic
1109433608 13:62269444-62269466 TAGTGGAAGGGAAAAAGGGAAGG - Intergenic
1110678773 13:78283322-78283344 TTGTGGAGGGGGGAGGGGGGAGG - Intergenic
1111353787 13:87070306-87070328 AAGGGGAAGGGGAAGTGGAAGGG - Intergenic
1111658909 13:91184807-91184829 TTTTTAAGGGGGAAGTGGGATGG - Intergenic
1111713993 13:91854529-91854551 TTGGGGAGGGGGAAGAGGGGAGG - Intronic
1112425857 13:99300273-99300295 ATGTGGACGTGTAAGTGGGATGG + Intronic
1113195822 13:107804364-107804386 TCAAGGAAAGGGAAGTGGGAAGG - Intronic
1113319112 13:109214837-109214859 TGGTGGAAGGTGAAGAGGAAGGG + Intergenic
1113367013 13:109685484-109685506 GGGTGGAAGGAGGAGTGGGAGGG + Intergenic
1113729421 13:112629381-112629403 TTGGGGGAGGGGAGGAGGGAAGG - Intergenic
1113749168 13:112766615-112766637 TAAGGGAAGGGGAAGGGGGAGGG + Intronic
1114193693 14:20459605-20459627 GTGAGGAAGGGGTATTGGGAAGG - Intronic
1114256023 14:21001931-21001953 TGGTGGAATGGGGAATGGGAAGG + Intergenic
1114288494 14:21268890-21268912 GTGGGGGAGGGGAAGGGGGAAGG - Intronic
1114586935 14:23824216-23824238 CAGTGTAAGAGGAAGTGGGAGGG - Intergenic
1115269154 14:31532436-31532458 GGGGGAAAGGGGAAGTGGGAAGG - Intronic
1115319991 14:32069439-32069461 TTGTGGAGGGGGATGGGGTAAGG + Intergenic
1115485661 14:33909061-33909083 TGGTTGAAGGGGAAGTGTAATGG - Intergenic
1116196227 14:41729340-41729362 TGATGGAAGGTGAAGTGGGGAGG - Intronic
1116448668 14:45039897-45039919 CTGTGGCAGGGGAAGTGCGCTGG - Intronic
1116495471 14:45554761-45554783 TGGTGGAAGGTGAAGAGGAAGGG + Intergenic
1116505294 14:45670250-45670272 TTGGGGTAGGGGGAGTGGAAAGG - Intergenic
1117018820 14:51548630-51548652 TTTTGGAAGGGGAAATGTGGGGG + Intronic
1117181638 14:53197885-53197907 TTGAGGTAGGGGAAATGGGGAGG - Intergenic
1117394985 14:55299940-55299962 TTCAGGAGGGGGAAGTTGGAGGG - Intronic
1117409510 14:55438557-55438579 ATGGGGAAGGGGAAGGGGAAGGG - Intronic
1118033371 14:61839878-61839900 TTGTGGAGGGGAAAGGGGGAGGG + Intergenic
1118079061 14:62337184-62337206 GAGTGGAATGAGAAGTGGGAGGG + Intergenic
1118398370 14:65356575-65356597 GTGTGGGTGGGGAATTGGGAGGG + Intergenic
1119217813 14:72882741-72882763 GGGTGGATGGGGCAGTGGGAGGG - Intronic
1119424785 14:74528287-74528309 ATATGGAAGAGGAAGTGGGTGGG + Intronic
1119533032 14:75376483-75376505 TGGTGGAAGGTGAAGAGGGAGGG - Intergenic
1119637856 14:76291368-76291390 TTTTGCAAGGGGTGGTGGGAGGG - Intergenic
1119862830 14:77948878-77948900 TAGGGGAAGGGGGAGGGGGAAGG - Intergenic
1120188334 14:81417311-81417333 GTGTGGATGGTGATGTGGGAGGG - Intronic
1121124194 14:91395526-91395548 AGGTGGAATGGGAGGTGGGAAGG - Intronic
1121273390 14:92652192-92652214 GTCTGGGAGGGGCAGTGGGAAGG - Exonic
1121535313 14:94686864-94686886 TTGTGGCAGGGGAGGTGAGGTGG - Intergenic
1121572873 14:94960752-94960774 TTCTGGAAGGAAAAGTGGGAAGG - Intergenic
1121670110 14:95702509-95702531 TTGTGAAAGGTGATGTGGGAGGG + Intergenic
1121798383 14:96754120-96754142 GTGTGGAAGGGGGAGAGGGAAGG + Intergenic
1122054228 14:99081751-99081773 TTGTAGATGGGGATGTGTGATGG - Intergenic
1122081222 14:99269157-99269179 TTGAGGAGGGGGAATTGGGGGGG - Intronic
1122100105 14:99401789-99401811 TTGAGGAAGGAGATGAGGGAAGG - Intronic
1122267112 14:100551862-100551884 GTGGGGAAGGGGAAGTGGGTCGG + Intronic
1122427395 14:101619958-101619980 TGGGGGTGGGGGAAGTGGGATGG - Intergenic
1122983276 14:105201096-105201118 TTGTGGGAGGGGAAGTCCGAAGG + Intergenic
1123632139 15:22268840-22268862 GGGAGAAAGGGGAAGTGGGAGGG - Intergenic
1123916329 15:25032287-25032309 TTTTGGCAGGGGATGTGGGGAGG - Intergenic
1124062683 15:26308479-26308501 TGTTGAATGGGGAAGTGGGATGG + Intergenic
1124373628 15:29117008-29117030 TTGTGGGAGGGGAGGTGGGAGGG + Intronic
1124654546 15:31497851-31497873 GTGGGGAAGAGGAAATGGGAAGG + Intronic
1124989006 15:34652165-34652187 ATGAGGAAGTGGAAGTGGAATGG + Intergenic
1125605450 15:40937559-40937581 TTGTGGGAGGGAAAGTGGCCTGG + Intronic
1125684660 15:41556808-41556830 GAGGGGAAGGGGAAGTGGAAGGG + Intergenic
1126293974 15:47116632-47116654 GTGTGAGAGGGGAGGTGGGATGG - Intergenic
1126699722 15:51357138-51357160 TGGTGGAAGGGGACCTGGAAGGG - Intronic
1127186330 15:56484609-56484631 TTGTGGAAGGGAAGGAGGCAGGG - Intergenic
1127840562 15:62827992-62828014 TGGTGGTAGGGGAAGTGGTGTGG - Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129181182 15:73876899-73876921 GGGTGGGAGGGGCAGTGGGAAGG - Intronic
1129210308 15:74064509-74064531 CTGTGGCAGGGGAGGTGGGTGGG - Intergenic
1129218887 15:74119543-74119565 GTGAGGAAGGGTAAGGGGGAGGG - Intronic
1129403714 15:75300893-75300915 CTGTGGCAGGGGAGGTGGGTGGG + Intergenic
1129480108 15:75817305-75817327 CTGTGGAGGGGGAAGTGATAGGG - Intergenic
1129614122 15:77084385-77084407 TTGTGGAAAGGGGATTGGGCTGG + Intergenic
1129825884 15:78634740-78634762 CTGTGGATGGGGACATGGGAAGG + Intronic
1129875337 15:78971762-78971784 TTCTGGAAGGGAAAGTGGACGGG + Intronic
1131166419 15:90145233-90145255 TTGAGGAAGGGGAGGTGCTAAGG - Intergenic
1131641577 15:94299035-94299057 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1131788293 15:95936596-95936618 TTGGGGAAGGGGCAGAGGGACGG - Intergenic
1131926597 15:97391237-97391259 TTGTGGAAGAGAAAGTAGGATGG + Intergenic
1132498925 16:276132-276154 TGGGTGAAGGCGAAGTGGGACGG + Intronic
1132528313 16:428953-428975 GTGAGGATGGGGAAGTGGAAGGG + Intronic
1132868177 16:2104056-2104078 TGGTGGAGGGGGGAGGGGGAAGG + Intronic
1133275996 16:4638823-4638845 CCGAGGAAGGGGGAGTGGGAAGG - Intronic
1133394887 16:5438933-5438955 GTGTGGATGGGGAGGTGGTAAGG + Intergenic
1133928957 16:10216653-10216675 TAGAAGAAGGGGAAGGGGGAGGG + Intergenic
1134479279 16:14603533-14603555 TGGTGGAGGAGGAAGGGGGAAGG - Intronic
1134549300 16:15131868-15131890 TGGTGGAGGGGGGAGGGGGAAGG + Intronic
1134562012 16:15219039-15219061 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1134777423 16:16865227-16865249 ATGTGGAAGGGGGAGTGAGAAGG + Intergenic
1134922550 16:18130665-18130687 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1135191621 16:20359208-20359230 TTGTGGTAGGGTAGGTGGGGCGG - Exonic
1135506169 16:23038367-23038389 TTCTGGAAGAGGAAGAAGGAAGG + Intergenic
1135678537 16:24437801-24437823 TGGTGGAAGGGGAAGAGGAATGG - Intergenic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1136748878 16:32615473-32615495 AAGTGGAAGCGGAAGTGTGAGGG + Intergenic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1138261135 16:55623526-55623548 GTGTGGAATGGGAATGGGGAAGG - Intergenic
1138710762 16:58967941-58967963 TTGAGGATGGGGAAGAGGGTGGG - Intergenic
1139094568 16:63690112-63690134 TGATGGAAGAGGAAATGGGATGG - Intergenic
1139660326 16:68416391-68416413 TTGTGGAGGGAAGAGTGGGACGG - Intronic
1140007432 16:71092272-71092294 TTGTGGAAGGGGAAAGGGCATGG - Intronic
1140451135 16:75071687-75071709 TTCTGGAAGTGCATGTGGGACGG + Intronic
1140965983 16:79966502-79966524 TTGAGGAAGGCCATGTGGGAAGG - Intergenic
1140980112 16:80100419-80100441 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1141253302 16:82378517-82378539 TTGTGGAAGGGGTAGAGTGGGGG + Intergenic
1141585376 16:85030006-85030028 CTGTGGAATGGGAAGTGGGGCGG + Intronic
1141615345 16:85206831-85206853 TTGTGGAGGGGGCGGTGGGCAGG - Intergenic
1141676135 16:85518318-85518340 TTGTGGAAGGAGATATGGAATGG + Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142204740 16:88777568-88777590 CTGAGGCAGGGGCAGTGGGATGG + Intronic
1142388820 16:89784707-89784729 TTGGGGAAGGGGAAGGGGAAGGG + Intronic
1203051011 16_KI270728v1_random:874687-874709 AAGTGGAAGCGGAAGTGTGAGGG + Intergenic
1142666712 17:1467682-1467704 AGGTGGATGGGGAGGTGGGAGGG - Intronic
1142666733 17:1467732-1467754 GGGTGGATGGGGAGGTGGGAGGG - Intronic
1142759274 17:2033956-2033978 TTGTGGGAGGGAAAGGGGGAAGG - Intronic
1142792284 17:2276749-2276771 ATGTGGAAGTGGACTTGGGAAGG - Intronic
1143245978 17:5486193-5486215 TGGCGGAAGGGGAAATGGGGTGG - Exonic
1143524345 17:7463493-7463515 TGGTGGAGGGGGGAGTGGGACGG - Exonic
1143585345 17:7847914-7847936 TTGGGGTTGGGGGAGTGGGAGGG - Exonic
1143639579 17:8188521-8188543 TTCTGGCTGGGGAAGTGGTATGG + Exonic
1143850070 17:9804336-9804358 TGGGGGAAAGGGAGGTGGGATGG - Intronic
1143855637 17:9846371-9846393 TTTGGGAAGCTGAAGTGGGAGGG + Intronic
1144410092 17:14992347-14992369 TTGTGGAAGGGGCAGAGAGATGG - Intergenic
1144740690 17:17580683-17580705 ATGGGGAATGGGGAGTGGGAGGG - Intronic
1145855851 17:28156564-28156586 TTGTGGGAGGGGGAGGGGGATGG + Intronic
1145908988 17:28531945-28531967 TTCTGGAAGGGAAAGAGGGAGGG + Intronic
1145932656 17:28697108-28697130 TTCTGGAAGCAGGAGTGGGATGG - Intronic
1146034281 17:29391501-29391523 TAGAGGATGGGGAAGGGGGAAGG - Intronic
1146044386 17:29491682-29491704 TGGTGGGAGGGGAAATGGAAAGG - Intronic
1146261392 17:31424190-31424212 TAGTGGAAGGTGAATTGGGGAGG - Intronic
1146497777 17:33338196-33338218 TTCTGGAAGGGAAAGGAGGATGG + Intronic
1146680987 17:34808124-34808146 TTGGTGGAGGGGAGGTGGGAGGG - Intergenic
1146688897 17:34859632-34859654 TTGTGGGAGGGGGACAGGGAAGG - Intergenic
1146794502 17:35771914-35771936 CTGTGGAAGGGGAATTGTTAGGG - Intronic
1147214368 17:38890789-38890811 GTGTGAATGGGGAAGAGGGAGGG - Intronic
1147427533 17:40353147-40353169 TTGTAGAGGGGGAGGTGAGAGGG + Intronic
1147683089 17:42266651-42266673 GTGTGGAGGTGGAGGTGGGAGGG + Intronic
1147759872 17:42790604-42790626 TTCTGGAGTGGGAAGCGGGAGGG + Intronic
1147933183 17:43995493-43995515 TTGTGGAAGGGCATGTGGGATGG - Intronic
1147998419 17:44374340-44374362 ATGTGGAAGGTGAGGTGTGAAGG - Exonic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149599133 17:57881968-57881990 TTGTGGCGGTGGCAGTGGGAGGG - Intronic
1150825162 17:68468000-68468022 TTGTGGAGGCTGAGGTGGGAGGG - Intergenic
1151288993 17:73134942-73134964 GTGTGGAAGGGGAAGATGGCTGG + Intergenic
1151522683 17:74641569-74641591 CTGGGGAAGGGGAGGTGGGTGGG - Intergenic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1151890431 17:76948043-76948065 TTCAGGAAGGGGAAGAAGGAGGG - Exonic
1152175540 17:78784531-78784553 CTCTGGAAGCTGAAGTGGGAGGG + Intergenic
1152208061 17:78986779-78986801 GGCTGGAGGGGGAAGTGGGAGGG + Intergenic
1152377963 17:79928394-79928416 ATGGGGAAGTGGGAGTGGGAGGG + Intergenic
1152560114 17:81073784-81073806 TTGTGAAAGCCGAAGTGTGAGGG + Intronic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1152755391 17:82084998-82085020 GTGGGGAAGGGGAAGTGGTGAGG + Intronic
1152766759 17:82145643-82145665 TTCTGGAAGGCGCAGAGGGAGGG + Intronic
1152878133 17:82800036-82800058 TGGAGGAAGGGGCAGTGGGGCGG - Intronic
1153898718 18:9594978-9595000 TTGTTAAAGTGGAAGTGGAAGGG - Intronic
1154109892 18:11558154-11558176 TTCTGGTAGGGCAAGTAGGATGG + Intergenic
1154409242 18:14127595-14127617 TTGGGCAAGGGGAGGTGGGAGGG + Intronic
1157574450 18:48734166-48734188 TTGTCCCAGGGGAAGTGGGTGGG - Intronic
1157866459 18:51190417-51190439 TGATTGAAGGGGAAGTGGGGAGG - Intronic
1158224133 18:55182888-55182910 TTGGGGAATGGAGAGTGGGAGGG - Intergenic
1158915331 18:62120203-62120225 TGGGGGAAGGGGAAGGGGAAGGG + Intronic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1159267262 18:66098427-66098449 TTCTGGAAAAGGAAGTAGGAAGG - Intergenic
1159482781 18:69012151-69012173 TGGTGGAAGAGTAAGTTGGAAGG + Intronic
1159502851 18:69296208-69296230 TTGTGGAAGGGTAGTGGGGATGG - Intergenic
1159983261 18:74811874-74811896 TGGGGTAAGGGGAAGGGGGAGGG + Intronic
1160342657 18:78102597-78102619 TTGTGGAGCGTGAAGGGGGAGGG + Intergenic
1160375031 18:78405422-78405444 TTGTGGGAGGGGATCTGGGGTGG - Intergenic
1161258920 19:3324848-3324870 TTGTCTAAGGGGAGGTGGAAGGG - Intergenic
1161306435 19:3571800-3571822 TTGAGGAAGAGGAAGTGGGCCGG + Intronic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161629563 19:5345894-5345916 TTTGGGAGGGGGAGGTGGGAGGG - Intergenic
1161716726 19:5880512-5880534 GTGGGGAAGGGGCAGGGGGAGGG - Intronic
1162352145 19:10157343-10157365 GTGTGAAAAGGGATGTGGGAAGG + Intronic
1162794263 19:13078492-13078514 TGGAGGAAGGGGCAGTGGGGAGG + Intronic
1162917360 19:13881567-13881589 TCGTGGAGGGGGAAGTGGGGAGG + Intergenic
1163008306 19:14409876-14409898 GTGTGGGAAGGGAGGTGGGAGGG + Intronic
1163445255 19:17342099-17342121 TAGGGGAAGGGGAAGGGGAAGGG - Intronic
1163537106 19:17883293-17883315 TTGGGGTGGGGGAATTGGGAAGG + Intronic
1163742250 19:19022624-19022646 CTGTGGGAGGGTAAGTGGGTGGG + Intronic
1164309840 19:24035937-24035959 TGGTGGAAGATGAAGTGGGCAGG - Intronic
1164869210 19:31629202-31629224 TTGGGGATGGGGACTTGGGAGGG - Intergenic
1165130441 19:33628804-33628826 GTGTGGGAGGGGATGTGGTAAGG + Intronic
1165477861 19:36042074-36042096 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
1165655532 19:37529084-37529106 TTGTGGGAGGGAAAGAGGGTAGG - Intronic
1165879257 19:39031449-39031471 TGGTGGGAGGGGAAGGGGGCGGG - Intronic
1166844904 19:45721411-45721433 GTGGGGATGGGGAAGTGGGGTGG - Intronic
1167055952 19:47111977-47111999 TCGGGGAAGGGGATGGGGGAGGG - Intronic
1167140105 19:47644470-47644492 TAGGGGAAGGGGAAGGGGTAGGG - Intronic
1167154185 19:47728324-47728346 TTGTGGATGGCCAGGTGGGAGGG - Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167358127 19:49016427-49016449 TTGGGGAATGGGGTGTGGGAAGG - Intronic
1167440683 19:49507036-49507058 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168613144 19:57816763-57816785 GTGTGGAAGGGGACCTGGGCGGG + Intronic
925262251 2:2538936-2538958 TTGTGGAAGTGGCTGTGAGAGGG - Intergenic
925340606 2:3132786-3132808 CTTTGGAAGGGAAAGTGGGGAGG + Intergenic
925927599 2:8681696-8681718 ATGGGGGAGGGGAAGGGGGAGGG - Intronic
926212776 2:10883451-10883473 GTGTGCAAGAGTAAGTGGGAAGG + Intergenic
926309801 2:11667282-11667304 TTGTGGAAGGGGAAAGAGGCTGG - Intronic
926461913 2:13140621-13140643 TGGGGGAGGGGGAAGTGGGGAGG - Intergenic
927035491 2:19170935-19170957 TTTGGGAAGGGTAGGTGGGAGGG - Intergenic
927060876 2:19418062-19418084 TTGTTCAAGGGGATATGGGAAGG + Intergenic
927396340 2:22655460-22655482 TAGTGGAAGGGGGAGTAGAAAGG - Intergenic
927711547 2:25329161-25329183 TTGTGGAGGGGGCCGAGGGAGGG + Intronic
927754351 2:25697002-25697024 CTTTGGAAGCTGAAGTGGGAGGG - Intergenic
927861857 2:26565070-26565092 TAGGGGAAGGGGAAGGGGAAGGG - Intronic
928118726 2:28566532-28566554 TTGGGGAAGGGGAGGTAGGTTGG - Intronic
929433538 2:41908951-41908973 TTTTGAAAGAGGAAGAGGGAAGG + Intergenic
929436320 2:41931240-41931262 TTGAGGAAGGCCAAGTGGGCAGG - Intergenic
929589200 2:43134283-43134305 TTGTTGCAGGGGAAGAGGGGCGG - Intergenic
929773272 2:44911072-44911094 TGGTGGAAGGGCAAAGGGGAAGG + Intergenic
929857671 2:45650601-45650623 TGGGGGAGGGGGAAGGGGGAGGG - Intergenic
930023768 2:47017269-47017291 TTTTGGGAGGCTAAGTGGGAAGG + Intronic
930126487 2:47801810-47801832 TTTTGGTGGGGGAAGGGGGAAGG + Intronic
930381725 2:50638216-50638238 TTGTTAAAGTGGAAGTGGGTAGG - Intronic
930441617 2:51415348-51415370 TTTAGGGAGGGCAAGTGGGAGGG - Intergenic
930954024 2:57182359-57182381 TTGGGGAAGGGGTAATGGGGGGG - Intergenic
931356105 2:61538520-61538542 GTGGGGGAGGGGAAGTGGGGAGG + Intronic
931667151 2:64617699-64617721 TTTTGGAAGGGGAGATTGGAGGG - Intergenic
931761817 2:65424186-65424208 TAGTGGCAGGGGAAGAGGTACGG + Intronic
931862726 2:66373274-66373296 TAGTAGAAGGGGAAGAGAGAGGG - Intergenic
931934801 2:67185434-67185456 ATGTGGGTGGGGAACTGGGAAGG - Intergenic
932291758 2:70586786-70586808 GTCTGGAAGGGTAAGGGGGAAGG - Intergenic
932583033 2:73004954-73004976 TTCTGGAAAGGGCAGCGGGAGGG - Intronic
932627114 2:73306392-73306414 TTCTGGAAGAGCAAGTGGGATGG + Intergenic
932819369 2:74886538-74886560 TGGTGGAAGGAGAAGAGGGGCGG + Exonic
932860417 2:75285841-75285863 TTGAAAAAGTGGAAGTGGGAAGG - Intergenic
933256715 2:80089238-80089260 TTGTGGGAGCAAAAGTGGGAAGG + Intronic
933513481 2:83270950-83270972 AGCTGGAAGGGGAAGAGGGAGGG - Intergenic
933788511 2:85864071-85864093 TTGTGGAAGGGGAGGTAGATAGG + Intronic
934054543 2:88240839-88240861 TTGTGGAGAAGGAAGAGGGAAGG - Intergenic
934296617 2:91747896-91747918 TTGAAGAAGGGAAAGTGGGGCGG + Intergenic
934751752 2:96798296-96798318 TTGTGGAATGGGAAGGAGAAGGG + Intronic
935096884 2:99953199-99953221 TTGGGGATGGGGGACTGGGACGG + Intronic
935365096 2:102280588-102280610 TTATGGAAGAGGAACTGGAATGG - Intergenic
935792879 2:106610154-106610176 TAGTGGAAGGGGAATAAGGAGGG - Intergenic
936248680 2:110850714-110850736 TGGTGGAAGGCGAAATGGTACGG + Intronic
936637280 2:114273219-114273241 TTGTGGGAGATGAAGTGAGAAGG - Intergenic
936759836 2:115763747-115763769 TTGTGGAAGTGCAAGTATGAGGG - Intronic
936779212 2:116011892-116011914 TTGGGGAAGGGCAGGTGGCAAGG + Intergenic
937022409 2:118670040-118670062 TTGTGGAAGGGGAATTGTCTTGG - Intergenic
937095034 2:119229735-119229757 TTAAGGAAGGGGGATTGGGATGG + Intronic
937542407 2:122974219-122974241 TTGTGGGAGGGGGAGGGGGAAGG - Intergenic
937572267 2:123379056-123379078 TTGGGGTAGGGGGAGGGGGAGGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937789322 2:125942509-125942531 GTGTGGAAGGGGACCTGGGCAGG + Intergenic
937911192 2:127076370-127076392 TTGGGGGAGGGGGAGGGGGAGGG - Intronic
938954243 2:136283408-136283430 TGGTGGAAGGAGAAATGGGCAGG + Intergenic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
940444821 2:153765089-153765111 GTGCAGAAGGGAAAGTGGGATGG + Intergenic
940919560 2:159292110-159292132 TTTTGGAAGAGCATGTGGGATGG - Intergenic
940945419 2:159611884-159611906 TGGTGGTAGAGGAAATGGGAGGG - Intronic
940973931 2:159922788-159922810 GTGTGGAGGGGCAGGTGGGAGGG - Intergenic
941003683 2:160226132-160226154 TTGAGAAAGGGGAGGTGTGAAGG - Intronic
941707385 2:168674335-168674357 CTGTGGAAGAGGAAAAGGGATGG - Intronic
941855588 2:170227282-170227304 TTTTGTGAGGGGAAGTGGGGGGG + Intronic
942913734 2:181277543-181277565 TTCTCGAAGGAGAAGTGGGATGG + Intergenic
943710381 2:191087509-191087531 TCCTGGATGGGGTAGTGGGATGG - Intronic
945226030 2:207531264-207531286 ATATGGTAGGGGGAGTGGGACGG - Intronic
945245112 2:207710968-207710990 TTATGGATGAGGAAGTGGAAGGG + Intergenic
945780977 2:214172237-214172259 GTGGGGTAGGGGAAGTGGGGAGG - Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946621538 2:221569272-221569294 TTGTGGAAGGGAAAATGTTAGGG - Intronic
947018888 2:225652470-225652492 TTGTGGATGGGGAATTAGTATGG + Exonic
947285317 2:228507552-228507574 TTGTGGAAGGGGAGTGGGTAAGG + Intergenic
947343626 2:229166979-229167001 AAGGGGAAGGGGAAGTGGAAGGG + Intronic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948558561 2:238835251-238835273 AAGGGGAAGGGGAAGTGGAAGGG - Intergenic
948983841 2:241508386-241508408 TTGGGGAGGGGGCAGAGGGAGGG - Intronic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1168927911 20:1598159-1598181 ATGTGGCAGGGGAGGAGGGAAGG + Intronic
1168953501 20:1818452-1818474 TTGTGGGGGGAGAGGTGGGAGGG - Intergenic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1169226031 20:3857571-3857593 TTCTGGGTGGGGAAGTGGCAGGG + Intronic
1169258441 20:4117551-4117573 TGGCAGAAGGGGAAGGGGGAGGG + Intergenic
1169703854 20:8480406-8480428 TGGGGGGAGGAGAAGTGGGAAGG + Intronic
1169875628 20:10294171-10294193 TTTAGAAGGGGGAAGTGGGAGGG - Intronic
1169895886 20:10504523-10504545 TTGTTGTAGAGGAAGTAGGAGGG + Intronic
1170604118 20:17863247-17863269 TTGTATAAGAGCAAGTGGGATGG - Intergenic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1171127844 20:22620010-22620032 TTGGGGGAGGGGAATGGGGAAGG + Intergenic
1171394761 20:24824801-24824823 TGGTGGAAGTGGAAGTCGGAGGG - Intergenic
1171779957 20:29409709-29409731 CTCTGGAAGGGAAAGAGGGAGGG - Intergenic
1171954953 20:31454599-31454621 TCCTGGATGGGGATGTGGGAGGG + Intergenic
1172101166 20:32484403-32484425 GTGCGGATGGGGAAGGGGGAGGG - Intronic
1172301380 20:33852875-33852897 TTGTGCGAGGGGATGGGGGAAGG - Intronic
1173310865 20:41894963-41894985 CGGTGGATGGGGAAGAGGGATGG + Intergenic
1173375228 20:42476985-42477007 TGGTGGAAGGAGAAGGGGGAAGG - Intronic
1173589996 20:44217241-44217263 TTGTGGATGGGGAATAGGCAAGG + Intergenic
1174573998 20:51524109-51524131 TTCTGGAAAGAGAAGGGGGAAGG + Exonic
1175111778 20:56653480-56653502 TTGTGGATGGGGAAATAGAAAGG + Intergenic
1175454825 20:59104577-59104599 TTTAGGAAGAGGAAGTGGGAGGG - Intergenic
1175537245 20:59723283-59723305 TAGGGAAAGGGGAAGTGGGGAGG - Intronic
1175554997 20:59845318-59845340 TTGTGGCGGGGGACGGGGGAAGG - Intronic
1175638186 20:60602968-60602990 TTGTGCAAAGGGACATGGGAGGG - Intergenic
1175639813 20:60619572-60619594 TGTTGGAAGGGCATGTGGGAGGG + Intergenic
1175976834 20:62715012-62715034 TGGGGGAAGGGGCTGTGGGAGGG + Intronic
1176048183 20:63103279-63103301 TTGGGGAGGAGGAAGTGGGGAGG + Intergenic
1176298422 21:5086630-5086652 ATGGGGCAGGGGAAGTGGGGTGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176863981 21:14032294-14032316 TTGGGCAAGGGGAGGTGGGAGGG - Intergenic
1177249383 21:18572288-18572310 TGGTGGAAGGGGAAGGGGAGGGG + Intergenic
1178054676 21:28784838-28784860 TTGTGGAAGGGGATCTGAGTGGG - Intergenic
1178480328 21:32974644-32974666 TTGGGGAAGGGGAAGGCTGAAGG + Intergenic
1178708581 21:34894484-34894506 TTGGGGAGGGGGAAGGGGTAGGG + Intronic
1178727839 21:35070660-35070682 TTGTGGAGTGGAAAGTGGGAGGG + Intronic
1179203522 21:39250004-39250026 TTCTGGAAGAGGAAGCTGGAAGG + Intronic
1179572994 21:42288908-42288930 TGGTGGAAGGCAAAGTGGGATGG + Intronic
1179858604 21:44175319-44175341 ATGGGGCAGGGGAAGTGGGGTGG - Intergenic
1180144736 21:45912849-45912871 GTGGGGAAGGGGATGTGGGGCGG - Intronic
1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG + Intergenic
1181868936 22:25882678-25882700 TTGGGGAAGATGAAGTGGGAAGG - Intronic
1181961863 22:26628115-26628137 TTCTGGAAGGGCAAATGGCAAGG + Intronic
1182551997 22:31105622-31105644 CTGGGGGAGGGGAAATGGGATGG - Intronic
1182570658 22:31235255-31235277 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1183348235 22:37319607-37319629 GTGCGGAAGAGGAGGTGGGAAGG - Intergenic
1183369194 22:37423010-37423032 TTGTGGAAAGGGCAGGGGCAGGG - Intronic
1183413257 22:37667713-37667735 TGGTGGAAGGGGAAGGGAAAGGG - Intergenic
1183520232 22:38292673-38292695 TTGGGGAAGGGGAGGCGGCAGGG - Intronic
1183703895 22:39465185-39465207 TGGGGGCAGGGGAAGAGGGAGGG + Intronic
1183781476 22:40001861-40001883 TAGAGGTAGGGGAATTGGGAGGG + Intronic
1184097269 22:42323293-42323315 TCGTGGAAGGGTGGGTGGGATGG + Intronic
1184132075 22:42522831-42522853 TGGTGGAAGGCGAAGTGTGAGGG - Intergenic
1184312216 22:43653778-43653800 TGGAGGAAGGGGCAGGGGGAGGG + Intronic
1184507823 22:44914700-44914722 TGGTGGATGGGGAAGGGGAAGGG + Intronic
1184786023 22:46672388-46672410 TTGAAGAAGGGCAGGTGGGAGGG + Intronic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
949212282 3:1517658-1517680 TAGTGACATGGGAAGTGGGATGG + Intergenic
949411826 3:3773911-3773933 TTGGGGAAGAAGAAGTGGGGAGG - Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949507872 3:4743732-4743754 TTGTTGAGGGGGAAGGGGGAGGG + Intronic
949673729 3:6428645-6428667 GTGGGGTAGGGGAAGTGGGGAGG - Intergenic
949939553 3:9144334-9144356 ATGTTGAAGGGGAAGAGAGAAGG - Intronic
950140232 3:10610351-10610373 TTGGGGGTGGGGAACTGGGATGG - Intronic
950825059 3:15809964-15809986 TTGTGGATGAGGAGGTGGGAGGG - Intronic
950895803 3:16449832-16449854 TTGTGGAAAGGGATGTGAGGAGG + Intronic
952238822 3:31508758-31508780 TTGAGAAAGAGGAAGTGGGTAGG + Intergenic
952331238 3:32366230-32366252 ATGGGGAAGGGGAAGAGGGTTGG - Intronic
953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG + Intergenic
953896797 3:46809259-46809281 TTGTGGAAAGGGCATTGAGAAGG + Intronic
953913069 3:46902475-46902497 TTGTTGAAGGGGAAGTGGCTTGG + Intronic
953942872 3:47116949-47116971 TTCAGGAGGTGGAAGTGGGAGGG - Intronic
953974499 3:47371811-47371833 CTGTGGCAGGAGAAGTGGGGAGG - Intergenic
954111783 3:48437650-48437672 TTGAGGAAGGGGCAGTTGGTAGG - Intronic
954254649 3:49395834-49395856 TAATGGAAGGGGAGGTGGAATGG + Intronic
954579621 3:51696237-51696259 CTGTGGAAGGGGATGTGCCAGGG + Intronic
954740821 3:52749080-52749102 TTGCAGAAGGGGAAGAGGGGAGG + Intronic
954847347 3:53571398-53571420 TTGTGGCAGGGGCAGTAGGGTGG + Intronic
955154430 3:56402599-56402621 TGGTGGGAGGAGAAGTGAGATGG - Intronic
955945083 3:64185931-64185953 TTGGGGATGGGGAAATGAGAGGG - Intronic
956139037 3:66127155-66127177 TTAAGGAAGGGGAAATGGAAGGG + Intergenic
956800569 3:72754303-72754325 TGGTGGAACGGGAAGAGGGCTGG - Intronic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
957279203 3:78128035-78128057 TTGGGGCATGGGAAGTTGGAGGG - Intergenic
957485072 3:80850301-80850323 TGGTGGAAGGGGAAGGGAAAGGG - Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957741665 3:84278663-84278685 TGGAGGAAGGGGAAGAGGGTAGG + Intergenic
957857215 3:85894345-85894367 GTGGGGTAGGGGAAGTGGGGAGG + Intronic
958018644 3:87971009-87971031 CTGTGGAAGGGGAGGAGGCAGGG - Intergenic
959014234 3:101114313-101114335 TTGGGGTGGGGGAAGGGGGAAGG + Intergenic
959386345 3:105713239-105713261 TTGGGGGAAGGGGAGTGGGAGGG + Intronic
959591770 3:108090424-108090446 TTGAGGGAGGGAGAGTGGGAGGG - Intronic
960141531 3:114155919-114155941 AGGCGGAAGGGGAAGTGGGAGGG - Intronic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
962326876 3:134441758-134441780 CTGGGGAAGGGGAGGTGGGGAGG - Intergenic
962345937 3:134619088-134619110 CTGTGGAAGAGGGAGAGGGATGG + Intronic
962868639 3:139469248-139469270 TTCTGGAGGAGGAAGTGGCATGG - Intronic
962906100 3:139804415-139804437 GTGGGGCAGGGGAAGAGGGAAGG + Intergenic
962978846 3:140469806-140469828 GTGAGGCAGGGGAAGAGGGAGGG + Intronic
963143257 3:141965541-141965563 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
963982328 3:151552492-151552514 TTATGTTAGGGGAAGAGGGAGGG + Intergenic
964213376 3:154252702-154252724 GTGTGGGAAGGGAAGTGGGGAGG + Intronic
964412048 3:156408031-156408053 TTGTGGAAGGTGACGGGGGAGGG + Intronic
964528229 3:157638804-157638826 TTTTGGCAGGGTATGTGGGAGGG - Intronic
964579691 3:158219104-158219126 ATATGGAAGAGGAAGTGAGAAGG + Intronic
964966292 3:162497158-162497180 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
965075607 3:163971176-163971198 GTCTGGAAAGGGTAGTGGGAGGG - Intergenic
965165992 3:165195018-165195040 GTGGGGAGGAGGAAGTGGGAAGG - Intronic
965288185 3:166843676-166843698 GTGTGGAAGGGGACCTGAGAGGG - Intergenic
965327470 3:167324890-167324912 TTGTAGAAGAAGAAGTTGGAAGG - Intronic
965723678 3:171689742-171689764 TTTGGGAAGCTGAAGTGGGAGGG - Intronic
967095205 3:186172304-186172326 TGATGGAAGGGGAAGTGGAGTGG - Intronic
967118794 3:186364519-186364541 ATGTGGAAGGCAAAGAGGGATGG + Intergenic
967321500 3:188199365-188199387 TTCTGGAAGAGCATGTGGGACGG + Intronic
967422878 3:189293288-189293310 GTGTGACAGCGGAAGTGGGAGGG - Intronic
968377599 4:56315-56337 GTGGGCAAGGGGAGGTGGGAGGG - Intronic
968912348 4:3482737-3482759 TTGGGGAAGGGGCAGGGGGGCGG + Intronic
968934287 4:3601865-3601887 TTCCTGATGGGGAAGTGGGAGGG - Intergenic
969349316 4:6589135-6589157 TTGGAGAAAGGGATGTGGGACGG - Exonic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
969632813 4:8348220-8348242 TGGTGGAAGAGGAAGTGAGATGG + Intergenic
969976912 4:11112668-11112690 TTTGGGAAGGGGAGTTGGGAAGG - Intergenic
971466535 4:26969253-26969275 TTGTGGAAGGGGATGGAGGCGGG + Intronic
971620763 4:28851669-28851691 TTGGGGTCGGGGAAGTGGGGAGG - Intergenic
972110830 4:35557209-35557231 CTGTGGAAGTGGAAGTGGTATGG - Intergenic
972422838 4:38905792-38905814 CTGATGAAGGGGAAGTGGGTGGG - Exonic
972742382 4:41900040-41900062 TTTTGTAAAGGGAAGTGGGTAGG - Intergenic
972896267 4:43624806-43624828 TGGGGGAAGGGGAAGGGGGTTGG - Intergenic
972974001 4:44610919-44610941 TTGTGGAATTGGAAATGAGATGG + Intergenic
973602899 4:52559636-52559658 TTGAGGAAGGGGAAGGGAGGTGG + Intergenic
973647680 4:52966446-52966468 ATGTGGAAGGTAATGTGGGAAGG - Intronic
973855860 4:55009201-55009223 TGAGGGAAGGGGAAGTGTGATGG + Intergenic
973931153 4:55793926-55793948 CTGGGGATGGGGAAGAGGGACGG + Intergenic
975036174 4:69685931-69685953 GTGGGGTAGGGGGAGTGGGAAGG - Intergenic
975270381 4:72425475-72425497 TGGGGTAAGGGGAAGGGGGAGGG - Intronic
975315324 4:72945661-72945683 TTGTCGTTGGGCAAGTGGGAGGG + Intergenic
975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG + Intronic
975731128 4:77338210-77338232 TGGGGGGAGGGGAAGGGGGAGGG - Intronic
976203488 4:82602158-82602180 TAGTGGAAAGGTGAGTGGGAAGG - Intergenic
976571541 4:86617566-86617588 TGCTGGAAGGGGAAGGGGGAGGG - Intronic
976588810 4:86828595-86828617 TGGTTGAAGGGGCGGTGGGAGGG - Intronic
977627145 4:99199906-99199928 TGGTAGAAGGCAAAGTGGGAGGG + Intergenic
977980053 4:103310689-103310711 GTGGGGTGGGGGAAGTGGGAAGG - Intergenic
978194581 4:105956286-105956308 TTGGGGTTGGGGAAGAGGGAGGG - Intronic
978285114 4:107068398-107068420 TTGTGTGGGGGGAAGAGGGAAGG - Intronic
978775879 4:112506487-112506509 TTTGGGAAGCTGAAGTGGGAGGG + Intergenic
980061783 4:128138540-128138562 TTGTGGAAAGGGTAGTGGTGGGG + Intronic
980098477 4:128517989-128518011 GTGTGGAATGGGAAGTGAAAGGG - Intergenic
980208699 4:129756406-129756428 TAGTGGCAGGGGAAGGAGGAGGG - Intergenic
980874628 4:138648555-138648577 TGGTGGAAGGTGAAGCAGGAGGG - Intergenic
981438126 4:144750128-144750150 TTGGGGAAGGGAGAGGGGGAAGG + Intergenic
981457568 4:144971756-144971778 GTGTGGCAGTGGAAGTGGCAAGG - Intronic
981752194 4:148103192-148103214 ATCTGGAAAGGGAAGTGGCAGGG - Intronic
981936476 4:150245509-150245531 ATGGGGTAGGGGAAGGGGGAGGG - Intronic
981990060 4:150907338-150907360 GGGAGGAAGGGGAAGGGGGAGGG + Intronic
982335260 4:154229406-154229428 TTTTGTAAGGGGAATTGGGATGG + Intergenic
982336899 4:154250115-154250137 TTTTGGATGGGGGAGTGGGAGGG + Intronic
984017544 4:174443703-174443725 TGATGGAAGTAGAAGTGGGAGGG - Intergenic
984222452 4:176994695-176994717 AGGGGGAAGGGGAAGAGGGAGGG - Intergenic
984310383 4:178051003-178051025 TGGTGTAAGGGGATGGGGGAGGG - Intergenic
984727304 4:183034205-183034227 TTGGGGTAGGGGAAGGGGGGAGG - Intergenic
985690114 5:1304252-1304274 AAGTGGAAGGGGAAGGGGAAGGG - Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
987911752 5:24155501-24155523 AAGTGGAAGGAAAAGTGGGAAGG + Intronic
988727569 5:33939308-33939330 ATGTGCAAGGGGAATTGGGGCGG + Intergenic
989188917 5:38650619-38650641 TTGGGGGAGGGGGAGGGGGAGGG + Intergenic
989194934 5:38707442-38707464 GGGTGAAAGGGGAGGTGGGAGGG - Intergenic
990304345 5:54480171-54480193 TGGTGGAAGGGGAAGGGAAAGGG - Intergenic
990399871 5:55427774-55427796 TTGGGGGGGGGGATGTGGGAGGG + Intronic
990469819 5:56105035-56105057 TTGTGGAAAGTGAAGTGTGTAGG + Intronic
991020178 5:61972069-61972091 TTGTGGAAGGAGGTGAGGGAGGG - Intergenic
991481943 5:67090342-67090364 GGGGGGAAGGGGAAGTGGGGAGG - Intronic
991510543 5:67371779-67371801 TAGGGGAAGGGAAAGAGGGATGG + Intergenic
991542446 5:67744900-67744922 TTGGGGTGGGGGAAGCGGGAGGG + Intergenic
992192313 5:74305418-74305440 TCTTGGAAGGGGCAGTGGGCTGG - Intergenic
992324656 5:75648909-75648931 TTGATGATGGGGAGGTGGGAGGG - Intronic
992415095 5:76544768-76544790 TTTGGGAAGGGGAACTGGGTGGG - Intronic
992773479 5:80070068-80070090 TCCTGGAAGTGGGAGTGGGAGGG + Intronic
993270568 5:85791049-85791071 GTGGGGTAGGGGAAGTGGGGAGG - Intergenic
993833144 5:92784522-92784544 TTTTGGAAGGCAAAGTGGGAAGG + Intergenic
994829725 5:104764409-104764431 TATTGAAAGGGGAAGTGTGAAGG - Intergenic
995468485 5:112475432-112475454 ATAGGGAAGGGGAAGTGGGGTGG + Intergenic
995731588 5:115249138-115249160 TTGTGGAGGGGGAAGTAGATGGG - Intronic
996550927 5:124729225-124729247 TTGTGAAAGGGACAGTGAGATGG - Intronic
996995734 5:129695041-129695063 TTAAGGAAGGGGTATTGGGAGGG + Intronic
997122146 5:131185683-131185705 TTTTGGAGGCTGAAGTGGGAGGG + Intronic
997291866 5:132742913-132742935 GGGTGGAAGGGAAAGAGGGAGGG - Intergenic
997380235 5:133430682-133430704 TTGAGGAAGGGAAAGAGGGAGGG - Intronic
997525560 5:134550925-134550947 TTGGGGAAGGGGGGGTAGGAAGG - Intronic
997601629 5:135142613-135142635 TTGGGGAAGGGGGAGTGTGTGGG - Intronic
997813777 5:136996873-136996895 GTGTGGAAGGGGAACCGAGAGGG - Intronic
998186093 5:139981261-139981283 TGGAGGAAGGGGATGTCGGAGGG - Intronic
998353478 5:141515876-141515898 TTATGGAGGGGAAAGGGGGAAGG + Exonic
998667329 5:144312847-144312869 TTCTGTAAGGGGAAGTGACAAGG + Intronic
999177248 5:149640099-149640121 TTGGGAAATGGGAAGTGGGATGG + Intergenic
999448877 5:151663872-151663894 TTGAGGAAGGGAAAGAGAGAGGG + Intronic
999518190 5:152321964-152321986 GTGTGGCAGGGTAAGTGGGTGGG + Intergenic
1000469741 5:161626681-161626703 TGGTAGAGTGGGAAGTGGGATGG - Intronic
1001215418 5:169851726-169851748 TGGTGGAAGGGGAAGCAGGGAGG + Intronic
1001543977 5:172558703-172558725 GTGTGGAAGGGGAACTGGGTGGG - Intergenic
1001569426 5:172720374-172720396 TTGTGGAAGGGAGGGAGGGAAGG + Intergenic
1001696451 5:173673817-173673839 GTGTGGAAGGGCATGAGGGAGGG + Intergenic
1002176977 5:177406019-177406041 TACTGGAAGGGGAAGTGGCAGGG + Exonic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002465270 5:179405211-179405233 TTGGGGAAGGTGAGGTGGGCTGG - Intergenic
1002820506 6:720240-720262 TTCTGAAAGGGGCAGTGGGATGG + Intergenic
1003060405 6:2858268-2858290 GGGTGGAAGGGGGAGGGGGAGGG - Intergenic
1003874743 6:10425748-10425770 TTTGGGATGGGGAAGTAGGATGG - Intergenic
1003973335 6:11320304-11320326 TTGTGGCTTGGGAAGTGAGAGGG + Intronic
1004140340 6:13012368-13012390 TTGTGGAAGAGGCAGTGACAGGG + Intronic
1004274409 6:14222699-14222721 TTATGGAAGGGGCAGGGAGATGG + Intergenic
1004322189 6:14640644-14640666 TTTGGGCAGGAGAAGTGGGAGGG - Intergenic
1004845177 6:19633896-19633918 GTGTGGAAAGGGAGGTGGGATGG + Intergenic
1005229258 6:23681342-23681364 TTATAGAAGAGGAAGGGGGATGG - Intergenic
1005399240 6:25414760-25414782 ATGTGGAAGGGGATGGGGGTTGG - Intronic
1005478673 6:26234162-26234184 TTTTGGAGGGGGGAGTGGGGTGG - Intergenic
1005492971 6:26363719-26363741 TTGGGGAGGGGGAAGGGGGAGGG + Intergenic
1006224066 6:32521660-32521682 TTGTGGGAGGGGAAGCAGGAGGG - Intronic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006742509 6:36319660-36319682 TTGTGGGAGGGGCAGTTGGCGGG - Intronic
1007225620 6:40311740-40311762 TTGTGGCAAGGGCTGTGGGAGGG - Intergenic
1007335659 6:41153545-41153567 GTGTGGAAGGGGGAAAGGGATGG + Intronic
1007392904 6:41560900-41560922 TTGTGGAAGGAGAAAAGAGAAGG - Intronic
1007449851 6:41934538-41934560 TTTTGGAAGTGGACGTCGGAAGG - Intergenic
1007746137 6:44044014-44044036 TTCTGGAGGGGACAGTGGGAGGG - Intergenic
1007957454 6:45930318-45930340 TTGTAGAAGGAGAAGAGGAAAGG + Intronic
1008418854 6:51273476-51273498 TAGTGAAAGTGGAAGTGGGGAGG - Intergenic
1008420429 6:51292922-51292944 TAGTGGAAAGAGAAGTGGAATGG + Intergenic
1008813475 6:55534304-55534326 TTCTGGAAGAGCAAGTGGGAGGG - Intronic
1008860110 6:56138831-56138853 ATGTGGTAGAGGAAGTGGGGAGG + Intronic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009438843 6:63651704-63651726 TTGGGGAAGGGGAAGGAGCAGGG - Intronic
1009683084 6:66923860-66923882 TTGTGGTATGGGAAAAGGGAAGG + Intergenic
1009696957 6:67118571-67118593 TTGAGGAAGGGCAAGTGCTAAGG - Intergenic
1009706300 6:67256605-67256627 CTGTGAGAGGGGCAGTGGGAGGG - Intergenic
1009796570 6:68476893-68476915 CTGGGGAAGGAGAAGTGGCAAGG - Intergenic
1010097461 6:72063355-72063377 TAGAGGAAGGGAACGTGGGAGGG + Intronic
1010529706 6:76952664-76952686 GTGTAAAAGGGGATGTGGGATGG + Intergenic
1011002321 6:82604718-82604740 TTGAGGGAGGGAAAGTGGCAGGG + Intergenic
1011002479 6:82606620-82606642 TTGTTTGAGGGGAAGTGGGATGG + Intergenic
1011310603 6:85975739-85975761 TGGTGGAAGGGGACTTGGAAGGG + Intergenic
1011317454 6:86051957-86051979 TTGTGGTGGGGGGAGTGGGGAGG - Intergenic
1011380909 6:86741245-86741267 TTGTGGAAAGAGAAGTGGCTTGG - Intergenic
1011626793 6:89289677-89289699 ATCTGGAAGGGGAAGGGGAAGGG + Intronic
1011966510 6:93164697-93164719 TAGTGGAAGAGGAAGTGGCTAGG - Intergenic
1012336474 6:98065397-98065419 CGCTGGAAGTGGAAGTGGGATGG - Intergenic
1012632048 6:101482724-101482746 TTGAGGTAGTGGAAGTAGGAAGG + Intronic
1012985225 6:105868393-105868415 TTGTTGTAAGGGAATTGGGATGG + Intergenic
1013313348 6:108918204-108918226 TTGTGGAATGGGAAGAGAAAAGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013450104 6:110272120-110272142 TTGTGGACGGGGGAATGGGTGGG - Intronic
1013689262 6:112620839-112620861 TTTTGGAAAGAGAAGTGAGAAGG - Intergenic
1013873402 6:114795543-114795565 GTGAGGAAGGGGGACTGGGAAGG + Intergenic
1013888308 6:114998165-114998187 CAGTGGAAGGGGAACTGGAAGGG - Intergenic
1014001965 6:116374279-116374301 TTGGGGAAGGGGCAGTGGGGTGG - Intronic
1014244944 6:119058102-119058124 TTGTAGAAGAGCATGTGGGATGG - Intronic
1015122189 6:129711809-129711831 CTATGGAAGTGGAAATGGGAAGG - Intergenic
1016283962 6:142451795-142451817 CTGAGGAAGGGGTAGTGGGGAGG - Intergenic
1016801632 6:148174627-148174649 TTTTGGTGGGGGGAGTGGGATGG + Intergenic
1017728684 6:157295273-157295295 TTATGGAAGAGGGAGTGGGGAGG - Intronic
1018165225 6:161087576-161087598 TTGGGAAAGGGAAAGTGGGAAGG - Intronic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1018471127 6:164099369-164099391 ATGGGGAAGGGGAAATGAGAGGG - Intergenic
1018965520 6:168484937-168484959 CTGGGGAAGGGGAAATGGGGAGG + Intronic
1019063688 6:169277139-169277161 TTGTGGCAGTGTAAGTGGCAAGG - Intergenic
1019115423 6:169757295-169757317 TTTTGAAAGGGAAGGTGGGAAGG - Intronic
1019851551 7:3563183-3563205 ATAGGAAAGGGGAAGTGGGATGG + Intronic
1020035111 7:4959534-4959556 TGGTAGTAGGGGGAGTGGGAAGG + Intergenic
1020240140 7:6388057-6388079 GTGTTGAAGGGGGAATGGGAGGG + Intronic
1020446604 7:8275435-8275457 TGGTGGAAGTGGAAAAGGGAGGG - Intergenic
1020640969 7:10753064-10753086 ATGGGGTGGGGGAAGTGGGAAGG + Intergenic
1020673545 7:11151311-11151333 TTTGGGAAGCTGAAGTGGGAGGG + Intronic
1021424809 7:20487296-20487318 TTGTGGCAGTGGAAATGGGTGGG - Intergenic
1021614526 7:22488319-22488341 TTGGGGAAGGAGAAGAGGAAGGG + Intronic
1021807637 7:24373109-24373131 TTGTAGAAGAGCATGTGGGATGG - Intergenic
1022023709 7:26426303-26426325 CTGAGGAAAGGGAAGTGGTAGGG - Intergenic
1022059340 7:26775685-26775707 TTAGGGAAGGGGGCGTGGGAGGG - Intronic
1022554971 7:31284030-31284052 TTGCGAAAGGAGAAATGGGAGGG - Intergenic
1022865415 7:34413680-34413702 TTAAGGAGGGAGAAGTGGGAGGG - Intergenic
1023640791 7:42254985-42255007 AAGTGGAAGGGGCAGTGGGCAGG - Intergenic
1023687131 7:42748067-42748089 GTGGGGTGGGGGAAGTGGGAGGG - Intergenic
1023695373 7:42840545-42840567 TTGGGAAATGGGAAGTGGAAAGG + Intergenic
1023800991 7:43834680-43834702 TGGTGGAAGGGGACCTGGAAGGG + Intergenic
1024021208 7:45372720-45372742 TTGTGGTGGGGGCAGTGTGAGGG - Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024377419 7:48655588-48655610 GTGTGGAAGGGAAACTGGGTGGG + Intergenic
1024616338 7:51117074-51117096 TTGTGCAGGGGGAGGGGGGAGGG - Intronic
1024822377 7:53347910-53347932 ATGGGGTGGGGGAAGTGGGAGGG + Intergenic
1024977326 7:55125945-55125967 GAGTGTGAGGGGAAGTGGGATGG - Intronic
1025095030 7:56090070-56090092 ATGAGGAAGGAGCAGTGGGATGG - Intronic
1026501759 7:70948684-70948706 TGGTGGAAGGTGAAGGGGGCCGG - Intergenic
1026679041 7:72451396-72451418 TGGGGGAAGGGGGAGTAGGAGGG + Intergenic
1026728992 7:72894933-72894955 ATGTGGAAGCTGAGGTGGGAGGG - Intronic
1027196294 7:76032832-76032854 TTGGGCAAGAGGAAGAGGGAGGG + Intronic
1027508558 7:79050299-79050321 TTCTGGAAGGGACTGTGGGAGGG + Intronic
1027581000 7:79995662-79995684 GTGTGGTAGGGGGAGAGGGAAGG - Intergenic
1027935005 7:84590590-84590612 GTGGGGTAGGGGAAGGGGGAGGG - Intergenic
1028835101 7:95366020-95366042 TTTTGGCAGGGGGAGTGGGGTGG + Intronic
1028950205 7:96626147-96626169 GTTTGGAAGGGGAGGTGGGATGG - Intronic
1029123715 7:98283951-98283973 CTAGGGAAGGGGAAGTGGCAGGG - Intronic
1029201737 7:98843720-98843742 TTGTTGAAAGGAAAGAGGGATGG - Intergenic
1029247116 7:99210125-99210147 TTGTTGGAGGTGAAGTGGGCTGG - Intergenic
1030345754 7:108431279-108431301 CTGTGGCAGTGGAAGTGGCACGG - Intronic
1030384065 7:108847416-108847438 GAGGGGAGGGGGAAGTGGGAGGG - Intergenic
1030902399 7:115140615-115140637 TCGTGGAAGGGGAAGGAGAACGG - Intergenic
1031043612 7:116863149-116863171 TTGAGGAGGGGGAAGTAGAAGGG - Intronic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1031937776 7:127753475-127753497 TGGTGGCAGGGGAAGAGGAAAGG - Intronic
1032338467 7:131048510-131048532 TTGTGGAAGAGGCAGAGGGGTGG - Intergenic
1032436212 7:131902382-131902404 TAGTGGAAGGGGAAGGGAAAGGG - Intergenic
1032577692 7:133072977-133072999 TTCAGGAAGTGGAAATGGGAAGG - Intronic
1032840572 7:135710579-135710601 TGGTAGGGGGGGAAGTGGGAGGG + Intronic
1033052015 7:138014247-138014269 TGGTGGAAGGGGAAGCAGGCAGG + Intronic
1033066814 7:138163927-138163949 GTGTGCATTGGGAAGTGGGATGG + Intergenic
1033147988 7:138887575-138887597 TTGGGAAAGGGAAGGTGGGAGGG - Intronic
1033184184 7:139210862-139210884 TGGTGGAAGGTGAAGGAGGAAGG + Intergenic
1033274797 7:139963596-139963618 TTGAGGAAAGGGTAGAGGGAGGG + Intronic
1033453552 7:141482546-141482568 TTGTGGAGGTGGATGGGGGAAGG - Intergenic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1034083557 7:148302700-148302722 ATGGGGAAGGGGAAGTAGGCAGG - Intronic
1034206418 7:149319596-149319618 TTGGGGAAGGGCACGAGGGAGGG + Intergenic
1034400253 7:150857305-150857327 TTGTGGGAGGAGAAGAGGGGCGG - Exonic
1034510437 7:151530066-151530088 TTCTGGAAGCTGAGGTGGGAGGG - Intergenic
1034582685 7:152059342-152059364 TTTTGGAGGTGGAGGTGGGAGGG - Intronic
1034982902 7:155489946-155489968 AGGTGGAAGGGCAGGTGGGAGGG + Intronic
1035490471 7:159272261-159272283 TTGTGATATGGGAAGTGGGCAGG + Intergenic
1036463493 8:8974735-8974757 TTGGGGAGGGTGAAGGGGGAGGG - Intergenic
1036854651 8:12231461-12231483 CTGTGGAGGTTGAAGTGGGAGGG + Intergenic
1037727666 8:21496391-21496413 CTGTGGAAAGGGAAGTGTGCAGG + Intergenic
1037907787 8:22725562-22725584 TTGGGGCGGGGGAAGTGGGGTGG + Intronic
1038594404 8:28873834-28873856 TTGAGGAAGAGATAGTGGGAAGG - Intronic
1038599869 8:28929352-28929374 TTGTGAGAAGGGAAGTGAGAAGG + Intronic
1038627330 8:29206844-29206866 TTGCGGAAGTGGAAGTGGGGTGG + Intronic
1038702486 8:29861730-29861752 ATGCGGAAGGGGAAGTTGGGAGG + Intergenic
1039359679 8:36862711-36862733 TGGGGGAAGGATAAGTGGGAGGG - Intronic
1039385860 8:37135036-37135058 TGCTGGAATGGGGAGTGGGAAGG - Intergenic
1039606601 8:38885730-38885752 TTGGGAAAGGAGAGGTGGGAAGG - Intergenic
1039984280 8:42435084-42435106 ATGAGGAGGAGGAAGTGGGACGG + Intronic
1040599329 8:48869211-48869233 CAGTGGACGGGGAAGTGGGAAGG + Intergenic
1040667266 8:49649870-49649892 GTGTGGAAGGGGAACTGAGCAGG + Intergenic
1041413942 8:57587017-57587039 GGGTGGAAGGGGAAGTAGAAAGG + Intergenic
1041727051 8:61028193-61028215 TAGTGGAAGGGGATGTCGGGAGG + Intergenic
1041729311 8:61048818-61048840 GTGAGGGAGGGGAAGAGGGAAGG - Intergenic
1042129036 8:65568347-65568369 CTGTGGGAATGGAAGTGGGAAGG - Intergenic
1042177832 8:66054877-66054899 CTGGGGTAGGGGAGGTGGGAGGG + Intronic
1042190282 8:66178831-66178853 AGGAGGAAGGGGAAGTGGGAAGG + Intergenic
1042431036 8:68706647-68706669 TTAAGGAAGGTGAAGTGGAAGGG + Intronic
1042590913 8:70397968-70397990 TTTTGGTTGGGGAGGTGGGAGGG - Intronic
1042591376 8:70402453-70402475 TAGAGGGAGGGGAAGAGGGAGGG + Intronic
1042684213 8:71419531-71419553 TTGTTGGTGGGGAATTGGGATGG + Intronic
1042784060 8:72527032-72527054 TTTTGGAAGGGGAGATGGGAAGG + Intergenic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1043331475 8:79122678-79122700 TTGGGGAAGGAGTAGTTGGAGGG - Intergenic
1043510895 8:80949222-80949244 GTGTGGATGTGGGAGTGGGATGG + Intergenic
1043802691 8:84630493-84630515 TTTTGGGTGGGTAAGTGGGAAGG + Intronic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1044417716 8:91954883-91954905 GTGTGGCTGGAGAAGTGGGATGG + Intergenic
1045289972 8:100824787-100824809 AGGTGGAAAGTGAAGTGGGAGGG - Intergenic
1045440224 8:102201712-102201734 TTGTTGCTGGGGAAGTGGGTGGG - Intergenic
1045481688 8:102597849-102597871 TGGTGGAAGGGGAAGAGGCATGG + Intergenic
1045507283 8:102787836-102787858 TTGAGGAAGGAGAGCTGGGAGGG - Intergenic
1046708314 8:117480132-117480154 TGGTGAAGGGGGAGGTGGGAGGG + Intergenic
1046773048 8:118135906-118135928 GTGTGGAAGGAGATGTGGAAAGG - Intergenic
1046860573 8:119086693-119086715 TTATAGAAGGGGAAGAAGGAAGG + Intronic
1047419933 8:124699151-124699173 TTGTGGAATGGGAAGCAGTAGGG - Intronic
1047507354 8:125490350-125490372 ATTGGGATGGGGAAGTGGGAGGG - Intergenic
1048019809 8:130527859-130527881 GTGGGGAATGGGGAGTGGGAGGG + Intergenic
1048151588 8:131900386-131900408 TGGTGGAAGGGGAAGGGAGGAGG + Intergenic
1048539694 8:135331450-135331472 TGGTGAGTGGGGAAGTGGGATGG - Intergenic
1049093182 8:140532326-140532348 TTCTGGAAGGGGAAGGGGCAGGG - Intronic
1049347513 8:142146681-142146703 ATGTGGCTGGAGAAGTGGGAGGG + Intergenic
1049589096 8:143447687-143447709 TGGCAGAAGGTGAAGTGGGAGGG + Intronic
1049615371 8:143573539-143573561 TGGTGGAAGCGGAAGCGGGCAGG - Intergenic
1049919291 9:348144-348166 TTTTGGAAGGTGTAGTGGGGAGG + Intronic
1050203486 9:3173894-3173916 TCGTGGAAGGAGAAGGAGGAGGG + Intergenic
1050253704 9:3772268-3772290 AGGTGGAAGAGGAGGTGGGAAGG + Intergenic
1050417178 9:5429949-5429971 TTGTGGCAGGGGGAGAGGGTGGG - Intronic
1050923948 9:11240300-11240322 GTGTGGAAGGGGACCTGAGAGGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051524768 9:18031602-18031624 CTGGGGAAGGGGAGATGGGAGGG + Intergenic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1052376566 9:27724255-27724277 TTGTGTAGGGAGAGGTGGGAGGG + Intergenic
1052973698 9:34397207-34397229 TAGTGGAAGTGGAAATGGAAAGG - Intronic
1053652408 9:40182339-40182361 TTGTGGAAGGCAAAGAGAGATGG + Intergenic
1053902807 9:42811651-42811673 TTGTGGAAGGCAAAGAGAGATGG + Intergenic
1054532173 9:66193876-66193898 TTGTGGAAGGCAAAGAGAGATGG - Intergenic
1054766374 9:69045830-69045852 GTGTGCAAGGGCAAGTGGGGGGG + Intronic
1054884207 9:70178305-70178327 TGGTGGAAGGGGCAGAGAGAGGG + Intronic
1055758001 9:79574725-79574747 TTATGGAAAGGGAAGGGGAAAGG - Intronic
1056343230 9:85660184-85660206 TTGTGGAGGGTGGAGTGGGGTGG + Intronic
1056407978 9:86294177-86294199 TTGTGAAAGGGGAATTAGAAAGG - Intronic
1056832354 9:89927510-89927532 TTTGGGAAGGGGAAGTTGGCAGG - Intergenic
1058268895 9:102943944-102943966 GTTTGGTAGGGGAGGTGGGAAGG + Intergenic
1058484840 9:105433593-105433615 GGGTGGCAGGGGCAGTGGGAGGG - Intronic
1058522742 9:105828367-105828389 TTGAGGAAAGGGGAGGGGGAAGG - Intergenic
1058542029 9:106021377-106021399 TTGGGGAAGGGGATGAGGGGAGG + Intergenic
1058626538 9:106939251-106939273 GTGTGGAAGTTGGAGTGGGAAGG + Intronic
1059336123 9:113569399-113569421 CTGTGGAATGGGAGGTGGCATGG + Intronic
1059454164 9:114389136-114389158 TTCTGGGAGGGCAAGTGGAAAGG + Intronic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1059751969 9:117256138-117256160 ATGCGGAATGGGGAGTGGGAAGG + Intronic
1059771938 9:117434851-117434873 AAGTGGAAGGGGAAGTGAGGAGG + Intergenic
1060149029 9:121275605-121275627 TGGTGGGAGGGGAGGTGGGAGGG - Intronic
1060163935 9:121392976-121392998 TGGGGGAAGGGGAAGGGGAAGGG + Intergenic
1060683778 9:125589519-125589541 TAGAGGAAGGGCAAGAGGGATGG - Intronic
1060967669 9:127720871-127720893 GGGAGGAAGGGGAAGGGGGAGGG - Intronic
1061360433 9:130138486-130138508 GAGCGGAAGGGGAAGGGGGAGGG - Exonic
1061860262 9:133464329-133464351 TGGTGGATAGGGAAGGGGGATGG + Intronic
1061977891 9:134081184-134081206 TTGAGGCAGGGGAAGTGCTAAGG + Intergenic
1062123625 9:134847875-134847897 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1062143736 9:134976726-134976748 TGGGGGAGGGGGAAGGGGGAGGG - Intergenic
1062182268 9:135196783-135196805 TATGGGAAGGGGAAATGGGAGGG - Intergenic
1203571638 Un_KI270744v1:137932-137954 GTGGGCAAGGGGAGGTGGGAGGG + Intergenic
1185540489 X:899393-899415 AAGGGGAAGGGGAAGTGGAAGGG - Intergenic
1186845896 X:13530863-13530885 TTGGGGAAGTGGTAGTGGGATGG - Intergenic
1186925475 X:14329042-14329064 TTGAGGACTAGGAAGTGGGAGGG - Intergenic
1187023826 X:15411781-15411803 TGGTGGAAGGAGGAGCGGGAGGG - Intronic
1187128873 X:16481677-16481699 GAGAGGGAGGGGAAGTGGGAAGG - Intergenic
1187348355 X:18488568-18488590 TTCTGGGAGGGGAAAAGGGAAGG + Intronic
1187468679 X:19548872-19548894 TTGTGGAAGGTGAGCTTGGAGGG + Intronic
1187805030 X:23110432-23110454 TTGTGGGAGGGAAAGGGGGAGGG - Intergenic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1188335065 X:28921510-28921532 GGGAGGAAGGGGAAGAGGGAGGG - Intronic
1188694334 X:33171264-33171286 TTGAGAAAGGGGAAGTAGTAGGG + Intronic
1189110539 X:38285918-38285940 AAGTGGAAGGGGAGGTGGAAGGG - Exonic
1189110544 X:38285930-38285952 AAGAGGAAGGGGAAGTGGAAGGG - Exonic
1189201654 X:39201435-39201457 GTGTGTAAGAGGAAGTGGGAAGG - Intergenic
1189385229 X:40531553-40531575 TGGAGGAAGGGGAAGGGGGTTGG + Intergenic
1189397508 X:40636029-40636051 TTGTGGATGGTAAAGTGGGCTGG - Intronic
1189416205 X:40816594-40816616 CTGTTGAATGGAAAGTGGGATGG - Intergenic
1190274161 X:48889811-48889833 TTGTGGAGGCCGAAGTGGGCAGG - Intergenic
1190298192 X:49040744-49040766 GTGGGGAAGGGAAAGGGGGATGG - Intronic
1190429786 X:50367967-50367989 TAGAGTAAGGGGGAGTGGGAAGG + Exonic
1190748139 X:53338816-53338838 AAGAGGAAAGGGAAGTGGGAGGG - Intergenic
1190798815 X:53770024-53770046 AAGAGGAAAGGGAAGTGGGAGGG - Intergenic
1190877646 X:54471057-54471079 TTGTGGAAGGGGTTGTGGCCTGG - Intronic
1191044608 X:56122130-56122152 TTGTGGTATGGGCTGTGGGAGGG + Intergenic
1191147028 X:57177943-57177965 TAGGGGAAGGGGAAATGGGGAGG - Intergenic
1191724328 X:64263183-64263205 TTGTGGAGAAGGAGGTGGGAAGG - Intergenic
1192173092 X:68868716-68868738 TGGTGGAAGAGGAGGTGGGGAGG + Intergenic
1192451877 X:71249918-71249940 CTGTGGAAAGGGGAGTGGGGAGG - Intronic
1193170638 X:78331884-78331906 GTATGGATGGGGAAGTGGGCTGG + Intergenic
1193360249 X:80572501-80572523 TGGTGGAAGGAGAAGAGGGGCGG - Intergenic
1194035310 X:88863868-88863890 GTGTGGAGGGGGAAGTGTGGAGG + Intergenic
1194382493 X:93211922-93211944 GTGTGGAGGGGGCAGTGGGGTGG - Intergenic
1194789030 X:98122646-98122668 TAGTGGGAGGGAGAGTGGGAAGG + Intergenic
1195069162 X:101262813-101262835 TTGTGGGCGGGAATGTGGGACGG + Exonic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1195550574 X:106164953-106164975 TTGGGAAAGGACAAGTGGGAAGG + Intergenic
1195853025 X:109303734-109303756 TTGTGGAAAGGGAAGTAGGCAGG + Intergenic
1196087862 X:111705905-111705927 TTGAGGAAGGGAATGGGGGAAGG - Intronic
1196810513 X:119625487-119625509 AGCAGGAAGGGGAAGTGGGAAGG + Intronic
1197063628 X:122212843-122212865 TGGGGGAAGGGGAAGTGGGGAGG + Intergenic
1197747348 X:129940505-129940527 TTGTTGAAAGGGATGTGGGGTGG - Intergenic
1197780387 X:130153395-130153417 TTTTGGAGGGTAAAGTGGGAGGG + Intronic
1197845818 X:130801260-130801282 TTATGGTGGGGGAAGGGGGAAGG + Intronic
1197899374 X:131353711-131353733 TTGAAGAAGGGGAGGTGGAACGG + Intronic
1198568100 X:137925976-137925998 ATTTGGAAGGGGAAATGGTAAGG - Intergenic
1198605417 X:138332051-138332073 TTGTGGAAGGAGAAGAGGCCAGG - Intergenic
1199491728 X:148407343-148407365 TTGTGGAGGGGGGAGGGGGGAGG + Intergenic
1199550483 X:149056560-149056582 ATGTGGAAGGGGTAATGTGAGGG - Intergenic
1199825742 X:151497922-151497944 TTGGGGAAGAGGATGGGGGAGGG - Intergenic
1200063109 X:153492303-153492325 CTGAGGAGGGGGGAGTGGGAGGG + Intronic
1201458929 Y:14201326-14201348 ATAAGGAAGGGGAAGTGGGGAGG + Intergenic