ID: 1104548552

View in Genome Browser
Species Human (GRCh38)
Location 12:129734017-129734039
Sequence TGATACTGGATTGCAGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104548552_1104548555 -1 Left 1104548552 12:129734017-129734039 CCCACAGCTGCAATCCAGTATCA 0: 1
1: 0
2: 2
3: 9
4: 131
Right 1104548555 12:129734039-129734061 AGAGAAGATGTCCTTTAAACAGG 0: 1
1: 1
2: 0
3: 18
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104548552 Original CRISPR TGATACTGGATTGCAGCTGT GGG (reversed) Intronic
902081390 1:13823396-13823418 TGATACTTGGATGCAGCTCTTGG + Exonic
905272277 1:36794893-36794915 GGACCCTGGATTGCAGCTCTAGG + Intergenic
906491795 1:46274236-46274258 TGATACTGCATTGGTGGTGTGGG - Intronic
906495717 1:46302818-46302840 TGAGGCTGGATTGCGGCTGTGGG - Intronic
907103530 1:51859459-51859481 TGATTCTGCCTTGCAGCTGGTGG - Intronic
907988367 1:59555033-59555055 TGAGACTGTTTTGCAACTGTAGG + Intronic
917341857 1:173987837-173987859 TGATAATGGATTGGAGTTGGAGG - Intronic
1065646547 10:27840862-27840884 AGATCCTGCATTGCATCTGTAGG + Intronic
1066190842 10:33054630-33054652 TGAAACTGGTTTGCAAGTGTGGG + Intergenic
1071238588 10:83678505-83678527 TGGAACTGGACTCCAGCTGTGGG + Intergenic
1076800303 10:132819332-132819354 TGATAGTGCATTGCATCTGTAGG - Intronic
1077945547 11:6893770-6893792 TTATATTGTATTGCAGTTGTTGG - Intergenic
1078252030 11:9624051-9624073 TGATTCAGGATTGCAGGAGTGGG + Intergenic
1078596259 11:12689264-12689286 TAACACTGGATTGAATCTGTTGG + Intronic
1086145891 11:83551314-83551336 TGCTACTGGATAGCAGAGGTAGG - Intronic
1087394595 11:97581180-97581202 TGACAGTGGATTGCAGCTAAAGG + Intergenic
1088079848 11:105898316-105898338 TGTTACTGGATTCCAGTTGGTGG + Exonic
1092732870 12:11550789-11550811 TGATACTGGATTGGAATTGAAGG + Intergenic
1093872028 12:24304530-24304552 TGACAGAGGATTGCAGCTTTGGG + Intergenic
1094817205 12:34200014-34200036 TGATTCTGGCTTGTAGCTGCTGG - Intergenic
1097616496 12:61890408-61890430 TGACTCTGAAATGCAGCTGTGGG + Intronic
1100436867 12:94579041-94579063 TGATTATGGATTTCAGCTCTTGG + Intronic
1102983238 12:117258928-117258950 TGCTACTGAATAGCAGGTGTAGG + Intronic
1104548552 12:129734017-129734039 TGATACTGGATTGCAGCTGTGGG - Intronic
1104825262 12:131703028-131703050 TGATGCTGGGTTCCAGATGTAGG - Intergenic
1105056697 12:133107314-133107336 TCATACTGGATGGAATCTGTAGG + Exonic
1106458755 13:29949848-29949870 TGAGACTGGATTGCAGGAGGAGG - Intergenic
1107482934 13:40800133-40800155 TGAAACCTGATTGCAGCTGCAGG + Intronic
1109511831 13:63386812-63386834 TGAAACTGGATTGCTGCTGTTGG - Intergenic
1110474836 13:75901854-75901876 TGACAATGGATGGCAGCAGTGGG - Intergenic
1115415159 14:33123903-33123925 TGAGACTGGAGTGCAGTGGTGGG + Intronic
1117080785 14:52150304-52150326 TAATACTGGGTTGCACCTGCTGG + Intergenic
1119027389 14:71164902-71164924 ATATACTGGTTTGCAGCAGTAGG - Intergenic
1124513955 15:30350459-30350481 TGAATCTGAATTGCAGCTGTGGG + Intergenic
1124728966 15:32180306-32180328 TGAATCTGAATTGCAGCTGTGGG - Intergenic
1125527446 15:40386298-40386320 TGTTACAGGGTTGCAACTGTCGG + Intronic
1126255682 15:46622558-46622580 TAAAACTTGATTGCAGATGTTGG + Intergenic
1128939841 15:71779048-71779070 TGATGATGGTTTGCAGCTTTTGG + Exonic
1135482486 16:22832638-22832660 GGATACTGGAAGGCAGCTATGGG + Intronic
1135931717 16:26743612-26743634 TGATTCTGGAGTGCAGCTGCTGG - Intergenic
1136462510 16:30420482-30420504 TGACCCTGGAATGCAGCTTTAGG - Intronic
1149583355 17:57767189-57767211 TGAAGCTGGGTTGTAGCTGTGGG - Intergenic
1150635259 17:66908629-66908651 TGAGACTGGATGGCGGCTGGAGG + Intergenic
1157310865 18:46552283-46552305 TAATGCTAGTTTGCAGCTGTGGG - Intronic
1158363127 18:56699113-56699135 AGATACTTGATTTTAGCTGTGGG + Intronic
1158695727 18:59701764-59701786 TGAAAGTTGATTGAAGCTGTTGG + Intergenic
1159801081 18:72900019-72900041 CTATACTGCATTGCAGCAGTAGG + Intergenic
1160068123 18:75597332-75597354 TGATACAGGACTGCATTTGTGGG - Intergenic
1161544506 19:4872067-4872089 TGAGGCTGGAGTGCAGCGGTGGG + Intergenic
1163913913 19:20221852-20221874 TGACACTAGAGTGCTGCTGTGGG - Intergenic
1166328439 19:42065372-42065394 TCATCCAGGATTGCAGCTGAGGG + Exonic
1168203761 19:54834781-54834803 TGAGCCTGGATTGGAGATGTGGG + Intronic
1168635408 19:57992322-57992344 TCATACTGCATTGCATCAGTGGG - Intronic
925473547 2:4188407-4188429 TGGTACTGGCTGGCAGCTTTTGG + Intergenic
926315721 2:11708197-11708219 AGCTGCTGGATTCCAGCTGTCGG - Intronic
926637804 2:15202216-15202238 TGGTTCTGAATTGCAGTTGTTGG - Intronic
928036718 2:27831007-27831029 TGATGCTGGCTTTCAGCTGGGGG - Intronic
930901108 2:56508687-56508709 TGAAACTGGATTGTTGCTGCTGG - Intergenic
933006263 2:76999221-76999243 AGCTACTGTATGGCAGCTGTGGG + Intronic
935230687 2:101093460-101093482 TGGTATTGGATTGCAGTTGGAGG - Intronic
942997406 2:182279922-182279944 TGATACTGGATACCACCTATTGG + Intronic
943864129 2:192906988-192907010 TGCTACTGTAATGTAGCTGTTGG + Intergenic
945538316 2:211048994-211049016 TGATGCTGGCTTTCAGCTGGGGG - Intergenic
1170943462 20:20868381-20868403 TGATACTGAAATGCAGTTGGAGG + Intergenic
1177153290 21:17476345-17476367 TGATACTGCATTCAAGCTGTGGG - Intergenic
1177581057 21:23021969-23021991 TGAAAGTGGATTGCAGCTGTAGG - Intergenic
1179144544 21:38756102-38756124 TGAGGCTGGATTCCACCTGTGGG - Intergenic
1179436536 21:41366163-41366185 TGATACACGAAGGCAGCTGTTGG - Intronic
951379910 3:21969946-21969968 AGATACTGGATTGGAGGTCTTGG - Intronic
951793623 3:26514537-26514559 TGACACTAGAGTGCTGCTGTGGG - Intergenic
952402271 3:32974195-32974217 TGATTTTGGATTGCAACTCTAGG + Intergenic
953000010 3:38923894-38923916 TCAGACTGCAGTGCAGCTGTCGG + Intronic
958792590 3:98669304-98669326 TGATGCTGGAGTGCAGTGGTGGG + Intergenic
961250246 3:125497340-125497362 TGAAACTGGGTTTCAGCTGAAGG - Exonic
962018639 3:131472013-131472035 TGATGCTTGACTGCAGCTTTGGG + Intronic
962101807 3:132350692-132350714 TTATGCTGGATGGCAGCTGAAGG + Intronic
963522570 3:146373342-146373364 AGAAACTGGATTGCCACTGTAGG - Intergenic
963978249 3:151507115-151507137 TGATTCTGGCTTGCAGCTGCTGG - Intergenic
967943897 3:194787125-194787147 TGGTCCTGGATTGGACCTGTGGG + Intergenic
970699675 4:18720845-18720867 TCATACTGGATTGAAACTCTGGG - Intergenic
970919843 4:21381029-21381051 TGCTACTGAAAGGCAGCTGTGGG + Intronic
971220998 4:24705928-24705950 TGATAGTGGAGTGAAGCTGCAGG + Intergenic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
974363088 4:60908665-60908687 TGAGACTATGTTGCAGCTGTAGG - Intergenic
979020228 4:115488480-115488502 TGATAGTGGCTTGCTGCTGCAGG + Intergenic
980165308 4:129219217-129219239 TTCTACTGAATTGCAACTGTTGG + Intergenic
980175901 4:129344110-129344132 TGATACTGGATTCTACCTGCAGG - Intergenic
982124165 4:152169916-152169938 AAATCCTGGATGGCAGCTGTAGG + Intergenic
983751062 4:171271779-171271801 TGGTAGTGGTTTGCAGCTTTGGG - Intergenic
985443997 4:190009821-190009843 TGATTCTGGCTTGTAGCTGCTGG - Intergenic
986552170 5:8969378-8969400 TAATGCTGGATTACAGGTGTTGG + Intergenic
987092141 5:14517506-14517528 TGATACTGGATTTCTGCTTCTGG - Intronic
990762834 5:59149557-59149579 TGATACTGGAATGGAGATTTAGG + Intronic
992613638 5:78529320-78529342 TGCTACAGGATTCCAGGTGTTGG - Intronic
993844586 5:92924809-92924831 TGATACTAGAATGAAGCTATGGG + Intergenic
994447434 5:99896258-99896280 TGATATTGGATTGTAGCTCCTGG - Intergenic
994479247 5:100312006-100312028 TGATACTGGACAGCAGATGGGGG - Intergenic
994981917 5:106886124-106886146 TGAGACTGGAGTGCAGTGGTGGG - Intergenic
995527733 5:113064052-113064074 TGAAGCTGGACGGCAGCTGTGGG - Exonic
995738485 5:115328956-115328978 TGACACTAGAGTGCTGCTGTGGG + Intergenic
997759659 5:136433025-136433047 TGGGGCTGGATTGGAGCTGTAGG - Intergenic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1007787874 6:44291791-44291813 TGAGTCTGGAATGCAGATGTAGG - Intronic
1008561928 6:52732469-52732491 TGAATCTGGAGTGCAGCTATGGG + Intergenic
1009479623 6:64140607-64140629 TGATACAGGAATGAAGCTGGGGG - Intronic
1009883377 6:69596778-69596800 TGTTACTGGCTTGCAGGTGGAGG - Intergenic
1009897413 6:69770232-69770254 TGATACAGCAGTACAGCTGTAGG + Intronic
1012890367 6:104890535-104890557 TGACACAGGCTTGCAGTTGTAGG - Intergenic
1012934570 6:105352978-105353000 TGCCACTGGATTCCTGCTGTAGG + Exonic
1013680381 6:112518921-112518943 TGATTCTGGCTTGTAGCTGCTGG + Intergenic
1015134553 6:129852838-129852860 TGAGACTGGATTGCAAGTTTTGG - Intronic
1016842955 6:148542965-148542987 TGATACTAAACTGCTGCTGTTGG - Intronic
1021731075 7:23596445-23596467 TGATATTTGTTTGGAGCTGTTGG + Intergenic
1024918227 7:54527355-54527377 TGATAATGGATTACAGTTGGAGG - Intergenic
1028136032 7:87223827-87223849 TGAGACTCCCTTGCAGCTGTGGG + Intergenic
1029366638 7:100120553-100120575 TGATACTGGAATACAGTTGAGGG - Intronic
1029552671 7:101245744-101245766 CGATACTAGTTTGCTGCTGTTGG - Intronic
1031180352 7:118406593-118406615 TCATTTTGGATTTCAGCTGTAGG + Intergenic
1031447269 7:121870902-121870924 TGAGACTGAATGACAGCTGTGGG - Intergenic
1031871756 7:127095301-127095323 TGATGCTGGGTGGAAGCTGTTGG + Intronic
1032935647 7:136728916-136728938 AGAAACTGGATTGCCGCTGCAGG + Intergenic
1033051684 7:138010294-138010316 TGAGACTGGAGTGCAGTGGTGGG + Intronic
1034408438 7:150922260-150922282 TGATCCTGGATTGCAGCTAGTGG + Intergenic
1036949142 8:13124316-13124338 TGAAACTGGATTGCAGGAGAGGG + Intronic
1039222323 8:35346862-35346884 TGATTCTGTATTTCAGATGTTGG + Intronic
1042159046 8:65873726-65873748 TGATTCTGGCTTGTAGCTGCTGG - Intergenic
1043979092 8:86617530-86617552 TGATACTGATTGGTAGCTGTTGG + Intronic
1044192681 8:89338015-89338037 AGATACTGGCCTGCAGCTTTTGG + Intergenic
1047952647 8:129947917-129947939 TGATTCTGGAGTTCAGCTGAAGG + Intronic
1049993420 9:1011333-1011355 TGCTTCTAGAGTGCAGCTGTTGG + Intergenic
1050015869 9:1233700-1233722 TTAAACTGGATTGCATCTCTAGG + Intergenic
1052180005 9:25514227-25514249 TAATATTGAATTGCAGCTTTTGG - Intergenic
1058040958 9:100301382-100301404 TGATACTGTAATACGGCTGTTGG - Intergenic
1058157125 9:101528410-101528432 TAAAACTGGATTTCAGCTGAGGG - Intronic
1059764266 9:117368896-117368918 TGAACCTTGATTGCAGGTGTTGG + Intronic
1061152636 9:128837606-128837628 TGTTACTGAGTTGCTGCTGTGGG - Intronic
1188447463 X:30271063-30271085 TAATGCTGGTTTTCAGCTGTTGG - Intergenic
1191033543 X:56001081-56001103 TGATACTGGAATGCTGCAGTGGG + Intergenic
1192853049 X:74977846-74977868 AGAAACTGGATTGCCGCTGCAGG - Intergenic
1196548496 X:116994220-116994242 TCAGCCTGGTTTGCAGCTGTAGG + Intergenic
1196937559 X:120744791-120744813 TGATACTGGATTTCAGTTTATGG - Intergenic
1198077491 X:133207929-133207951 TGATAATGGGTTGCTGCTGATGG - Intergenic
1199454175 X:148009137-148009159 TGAGACTGGAGTGCAGTGGTGGG - Intronic