ID: 1104550045

View in Genome Browser
Species Human (GRCh38)
Location 12:129748347-129748369
Sequence ACGGAGAATGAGACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 403}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104550042_1104550045 -10 Left 1104550042 12:129748334-129748356 CCTAGCAATTTGGACGGAGAATG 0: 1
1: 0
2: 0
3: 12
4: 372
Right 1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG 0: 1
1: 0
2: 3
3: 36
4: 403
1104550039_1104550045 12 Left 1104550039 12:129748312-129748334 CCGACTGGCTTTGATCGACTGTC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG 0: 1
1: 0
2: 3
3: 36
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104550045 Original CRISPR ACGGAGAATGAGACTGAGGA GGG Intronic
900676360 1:3889036-3889058 TGGGAGCATGAGACTGAGGCAGG + Intergenic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
901056937 1:6452791-6452813 ACAGAGAAGGAAACTGAGGCTGG - Intronic
902477438 1:16695704-16695726 ACAGAGAAGGAAACTGAGGCTGG + Intergenic
902550825 1:17218710-17218732 AAGGAGAATGAGTTTGGGGATGG + Intronic
903775659 1:25791878-25791900 ACGGAGAATGACACAGCAGAAGG - Intergenic
904293046 1:29499930-29499952 AAGGACATTGAGACTGAGGGAGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
905513325 1:38541823-38541845 AGGGAGAGTGAGAGTGAGAATGG + Intergenic
906714258 1:47955291-47955313 AAGGAGAAAGGGACTGGGGAAGG - Intronic
906809299 1:48809881-48809903 ACCCAGAATAAAACTGAGGAAGG - Intronic
909038736 1:70625496-70625518 ACAGACACTGAGACTGAAGAGGG + Intergenic
909437305 1:75657246-75657268 ACAGAGAATGAAAGTGAAGAGGG + Intergenic
909842752 1:80349404-80349426 ACTGAGAATGAGCCTGAGGCTGG - Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912725717 1:112057431-112057453 AAGGAGGATGGGGCTGAGGAGGG - Intergenic
914355229 1:146879082-146879104 ACGGAGAATGGGCTTGAAGAGGG - Intergenic
914997384 1:152556938-152556960 CCTGAGAATGAGACTGGGAAAGG + Intronic
915802275 1:158807108-158807130 AGAGAGAATGAGGCTGAGGAGGG + Intergenic
916192087 1:162189755-162189777 ACGGAGAGTGATTCTGGGGAAGG + Intronic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
917219401 1:172711608-172711630 TGGGGGAATGAGAGTGAGGATGG + Intergenic
917695603 1:177520088-177520110 AAGCAGAATGAGCCTGGGGAAGG + Intergenic
918209090 1:182335021-182335043 AGAGAGAAAGAGACAGAGGAAGG + Intergenic
919157207 1:193781185-193781207 ACTTAGAATGAGACTTAGAATGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919682950 1:200454272-200454294 AGGAAGAATGAGGCTGAGGAGGG - Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920841809 1:209561700-209561722 AGGAACAATGAGACAGAGGATGG - Intergenic
921185819 1:212668584-212668606 AGGGAGAATGAGAGAGAGAATGG + Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921795415 1:219338067-219338089 ACGTAAAATGAGAATGAGGAAGG - Intergenic
923455711 1:234163386-234163408 ACACAGAATGGGACAGAGGAAGG + Intronic
923779062 1:237005780-237005802 ACGGAGATTGAGAGAGAGGGAGG + Intergenic
923894666 1:238256448-238256470 GCAGAGTATGACACTGAGGACGG - Intergenic
923964726 1:239124827-239124849 ACAGAGAAAGAGACTAGGGAAGG + Intergenic
924290353 1:242529852-242529874 AAGGAGAAAGAGAGAGAGGAAGG - Intergenic
924676126 1:246179817-246179839 ACTTAGAAAGAGACTGTGGATGG - Intronic
1062844465 10:693145-693167 GAGCAGAATGAGACCGAGGAAGG - Intergenic
1062985540 10:1765270-1765292 CAGGAGCATGAGACTGAGAATGG - Intergenic
1064504673 10:16015725-16015747 AGGGAGGAAGAGACAGAGGAAGG + Intergenic
1064697078 10:17978033-17978055 ATGGAAAAAGAGTCTGAGGATGG + Exonic
1064786961 10:18908592-18908614 ACAGAGAATGAGAGTGAAAAAGG - Intergenic
1065817286 10:29493686-29493708 ACGTAGAATGAGGCTGAGGCTGG - Intronic
1065955567 10:30690791-30690813 ATGTAGAATGAGGCTGAGGCTGG + Intergenic
1068148724 10:53104779-53104801 AGAGAGAAAGAGACAGAGGAGGG + Intergenic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069426064 10:68289633-68289655 AAGGAGAAAGAGACTTAGAAAGG + Intronic
1069803538 10:71100711-71100733 AGGGAGAGTGAGACGGAGGGAGG - Intergenic
1070148254 10:73789930-73789952 AGGGAGAAAGAGACGGAGGCAGG - Intronic
1072188209 10:93061529-93061551 ATGGGCATTGAGACTGAGGAGGG - Intronic
1073095788 10:100978932-100978954 ACGGAGCGTGCCACTGAGGAGGG + Exonic
1074769872 10:116726337-116726359 AGGGAGACAGAGACAGAGGAAGG - Intronic
1075055512 10:119215510-119215532 AGTGAGGAAGAGACTGAGGAAGG + Intronic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1076107095 10:127832261-127832283 AGGGAAAATGAGACACAGGAGGG + Intergenic
1076365371 10:129918299-129918321 ATGGAGAATGAGACAGAAGTGGG - Intronic
1078678257 11:13448047-13448069 ACTGAGAATGGCACAGAGGATGG - Intronic
1078807891 11:14725047-14725069 AAGGATTATGTGACTGAGGAAGG + Intronic
1078995986 11:16700482-16700504 GTGGAGAATGAGTCTGGGGATGG - Intronic
1079360321 11:19765464-19765486 AAGGAGAAGGAGACAGAGGGAGG - Intronic
1079570378 11:21935623-21935645 AGGGAGACTGAGACTGAAAATGG + Intergenic
1080928660 11:36784798-36784820 AGGGAGAAAGAGACAGAGGGAGG - Intergenic
1081473734 11:43403372-43403394 AATGAGAATGGGACTGGGGATGG - Intronic
1081761718 11:45581245-45581267 AAGGAGATTGAGACTTAGGGAGG - Intergenic
1083463877 11:62832680-62832702 AAGGAGGAAGAGTCTGAGGACGG - Intronic
1083775153 11:64891026-64891048 ACGGGGAATGAGACAGAGGGAGG + Intergenic
1084525331 11:69694349-69694371 AGGGAGTATGAGACTAAGGCAGG + Intergenic
1085719841 11:78903232-78903254 AGGGAGGGTGAGGCTGAGGAGGG - Intronic
1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG + Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087784422 11:102338863-102338885 AGGGAGAATGAGGCTGAGACAGG + Intronic
1087823337 11:102736310-102736332 ACAGTGATTGACACTGAGGAGGG - Intergenic
1088765261 11:112969295-112969317 ATGGAAACTGAGACTGAGAAAGG + Intronic
1088883693 11:113991007-113991029 GTGGAGGATGAGACTAAGGAGGG + Intergenic
1089447366 11:118564224-118564246 AAGGAGAATAACAGTGAGGAAGG - Intronic
1089684019 11:120135383-120135405 TGGGAGAATGAGACTGAGCGTGG + Intronic
1090908205 11:131095842-131095864 ACGAGGAAGGAGAGTGAGGAGGG - Intergenic
1090990397 11:131812225-131812247 GGGGAGAATGAGAGGGAGGAAGG - Intronic
1091167378 11:133491637-133491659 AGGCAGAATGTGACTGAGGCAGG + Intronic
1092333902 12:7611262-7611284 ACTGAGTAGGAGACTGAGGCAGG + Intergenic
1092648153 12:10602351-10602373 AGGCAGAATGAAACTGACGACGG + Intergenic
1092690823 12:11108510-11108532 ACGGAGGATGAGCCGAAGGAGGG + Intronic
1094205350 12:27833878-27833900 ACGGAGAGGGAGAGAGAGGAAGG - Intergenic
1095562221 12:43579061-43579083 ACAGAGAACGAGACTGATGTAGG + Intergenic
1095960162 12:47829214-47829236 AAGGAGAATGAGACAGAGAAGGG + Intronic
1096212690 12:49778548-49778570 AGAGAGAATGACACTGAGGTAGG - Intergenic
1096847092 12:54413309-54413331 ACGGAAGAGGAGAGTGAGGAGGG + Intronic
1096871569 12:54595832-54595854 ACAGAGAAAGAGCCTGAGGGTGG - Intergenic
1098080758 12:66782849-66782871 ACAGAGAAGGAAACTGAAGATGG + Intronic
1099390339 12:82071473-82071495 AAGGAGAATGAAACAGAGAAGGG + Intergenic
1099720497 12:86356494-86356516 ACGGAGCATGAGACAAAGCAGGG + Intronic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1100722513 12:97373860-97373882 CCGGGCAAAGAGACTGAGGAGGG + Intergenic
1101530891 12:105572819-105572841 ACAGAGAATGAGACAGTGAATGG + Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102490449 12:113287121-113287143 AGGGAGAAAGAGAGGGAGGACGG + Intronic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1103147171 12:118604888-118604910 ACAGACAAGGAGACTGAGGCTGG - Intergenic
1103332228 12:120162280-120162302 ACGGAGATTGAGAATTGGGAAGG - Intronic
1104192703 12:126498643-126498665 ACATAGACTGAGAGTGAGGAAGG - Intergenic
1104462784 12:128969131-128969153 ACAGAGACTGAGAGGGAGGAAGG - Intronic
1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG + Intronic
1106243837 13:27930029-27930051 AGAGAGAATGAGACAGAGAATGG - Intergenic
1108223646 13:48265222-48265244 TTGGGGAATGGGACTGAGGAAGG - Exonic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1110623925 13:77630136-77630158 GGGGAGAATGAGACTGAGACAGG + Intronic
1110633366 13:77736283-77736305 ACAGAGAATGAGGGAGAGGAAGG - Intronic
1110875419 13:80503765-80503787 AAGGAGAATGAAACTGAGCCAGG + Intergenic
1111166373 13:84462942-84462964 AAGGAGAAGGAGACTGATCAAGG - Intergenic
1111411096 13:87877676-87877698 ACTGAAAATGAGACTGTGCATGG - Intergenic
1111522254 13:89421087-89421109 ACAGAGAAAGAGAGTGAGAAAGG + Intergenic
1112020066 13:95363771-95363793 ACAGATAATGAAACTGAGAAAGG - Intergenic
1112191075 13:97178214-97178236 ATGGAGGATGACACTGAGAATGG + Intergenic
1112722881 13:102265141-102265163 ATGGAGGATGAGAATGAGAAAGG - Intronic
1114186220 14:20404423-20404445 ATGGAGAATGTGATTGAGAAGGG - Intronic
1114479806 14:23025670-23025692 ACGGAGAAGGAGAGAGAGGCAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117270575 14:54139297-54139319 AGGGAGAGTGGGACTGAGTAGGG - Intergenic
1117580334 14:57145097-57145119 AGGGATAATGGGACTGGGGAAGG - Intergenic
1117872474 14:60215740-60215762 ATGGAGAATGTGAATGAGGTTGG - Intergenic
1119768425 14:77205404-77205426 ACCTAGAATGAGCTTGAGGAGGG + Intronic
1120431698 14:84426312-84426334 ACAGAGAGAGAGACGGAGGAAGG - Intergenic
1122200248 14:100118240-100118262 ACGGAGAATGAGCCAGATGCAGG - Intronic
1122248717 14:100423301-100423323 GTGGAGAATGCCACTGAGGATGG + Intronic
1122879588 14:104684216-104684238 ACCGAGAAGGAGGCTGGGGAGGG + Intergenic
1123934114 15:25185925-25185947 GAGGAGAATGCGACTCAGGAAGG - Intergenic
1127428590 15:58880498-58880520 ACAGAGAAAGAAACTGAGGGTGG + Intronic
1127447582 15:59081000-59081022 GCGGAGGCTGAGTCTGAGGAGGG - Exonic
1127531474 15:59847408-59847430 AAGGAAAATGAGACTCAGGGTGG - Intergenic
1127601136 15:60538036-60538058 ACGGAAAATGAGCCTCAGGAGGG + Intronic
1128044032 15:64601223-64601245 ATGGACGATGAGGCTGAGGAAGG + Intronic
1129652765 15:77503321-77503343 ACAGATGATGAAACTGAGGAAGG - Intergenic
1129837218 15:78717193-78717215 AAGGAGAATAAGACTGTGAATGG + Intronic
1130018096 15:80202672-80202694 ACAGAGGAATAGACTGAGGAGGG + Intergenic
1130267948 15:82425939-82425961 AAGGAGAATAAGACTGTGAATGG + Intergenic
1130504076 15:84520895-84520917 AAGGAGAATAAGACTGTGAATGG - Intergenic
1130928733 15:88404945-88404967 AGGGAAAAAGAGACTGAGGCAGG + Intergenic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1132183959 15:99787482-99787504 AAGGAGAATAAGACTGTGAATGG + Intergenic
1132434421 15:101785663-101785685 AAGGAGAATAAGACTGTGAATGG - Intergenic
1133254559 16:4508709-4508731 TGGGAGAATGAGACTGTGGCAGG - Intronic
1133735370 16:8610994-8611016 CCACAGAATCAGACTGAGGATGG + Intergenic
1134316808 16:13126536-13126558 AGAGAGAAAGAGACTGAGGGAGG + Intronic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1135530280 16:23247122-23247144 ACGGAGCAAGAGAGTGAGGGAGG - Intergenic
1135912476 16:26573992-26574014 AGGGAGATTGAGATTGAAGATGG + Intergenic
1136227092 16:28866494-28866516 GAGGAGGAAGAGACTGAGGAAGG - Exonic
1138483217 16:57317924-57317946 ACAGAGAAGGAAACTGAGGCTGG - Intergenic
1139089587 16:63629164-63629186 AGGGACAATGAGGCTGAGCAGGG + Intergenic
1139215848 16:65123368-65123390 ACGGGGAAGGAGGCTGCGGAGGG + Intronic
1139329687 16:66177672-66177694 AGGGAGAATGAGAGTAAGGATGG + Intergenic
1139978786 16:70836448-70836470 ACGGAGAATGGGCTTGAAGAGGG + Intronic
1140109803 16:71994302-71994324 CCTAAGAATGAGACTGAGGGAGG - Intronic
1140110119 16:71997005-71997027 CCTAAGAATGAGACTGAGGGAGG + Intronic
1141113718 16:81290952-81290974 AAAGAGAAAGAGACAGAGGAAGG - Exonic
1141302691 16:82832446-82832468 AAGGAGGATGAGAAGGAGGAAGG - Intronic
1141579457 16:84987184-84987206 ACTGTAAATGAAACTGAGGAAGG - Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142359682 16:89620190-89620212 ACAGATAAAGAAACTGAGGACGG + Intronic
1143276953 17:5718807-5718829 AGTGAGAAAGAGATTGAGGATGG + Intergenic
1143341969 17:6218673-6218695 ACAGAGACTGAGACTGAGACCGG - Intergenic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1146475202 17:33157136-33157158 AGGGAGAGGGACACTGAGGAGGG - Intronic
1146889656 17:36498174-36498196 AGCGGGAATGAGACTGAGGCTGG - Intronic
1146936369 17:36814869-36814891 AGAGAGAATGAGAAAGAGGAAGG - Intergenic
1147228231 17:38997662-38997684 AGGGAGAAAGAGAGAGAGGAAGG - Intergenic
1147305822 17:39563774-39563796 AGGGAGAGTGAGAGTGAGGAAGG + Intronic
1148495458 17:48051002-48051024 ACGGGGTTTGACACTGAGGAGGG + Exonic
1149368698 17:55971166-55971188 AATGAGAATGAGAATGAGAATGG + Intergenic
1149381643 17:56100261-56100283 ATGGAAAATGAGATTGTGGAAGG + Intergenic
1149465907 17:56879012-56879034 ATGGAGAGTGAGAGTGAGGCTGG + Intergenic
1150647620 17:66989353-66989375 ACGGAGAAGGACACAGAAGATGG + Intronic
1150973363 17:70056100-70056122 AAACAGAATCAGACTGAGGAAGG + Intronic
1151769043 17:76147695-76147717 TGTGAGAATGAGGCTGAGGAGGG - Intronic
1154205612 18:12334333-12334355 ACAGACACTGAGACTGTGGATGG + Intronic
1154957757 18:21276065-21276087 AAACAGAATGAGAATGAGGAAGG - Intronic
1155813770 18:30276298-30276320 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
1156480539 18:37433721-37433743 TCTGAGAGTGAGTCTGAGGATGG + Intronic
1157028055 18:43870837-43870859 ACGAACAATGTGACTGAGTATGG - Intergenic
1157210804 18:45740385-45740407 ACGCTGAATCAGACTGAGGAGGG - Intronic
1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG + Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1159556319 18:69949080-69949102 ACCGAAAATGAGACTGAGTCTGG + Intronic
1161054032 19:2181002-2181024 ACTGACAAGGAGACAGAGGAAGG - Intronic
1161111363 19:2472487-2472509 ACAGAGAAAGAAACTGAGGCTGG + Intergenic
1161434863 19:4257165-4257187 ACGGAAACTGAGGCTGAGGGAGG - Intronic
1161803313 19:6427587-6427609 AAGGAAAATGAGGCTCAGGAAGG + Intronic
1162403902 19:10462076-10462098 TGGGAGAAAGAGGCTGAGGAAGG - Intronic
1162550943 19:11357792-11357814 ACAGATAAGGAGACTGAGGTTGG - Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163848650 19:19651365-19651387 AATGAGGATGACACTGAGGATGG + Intronic
1164456336 19:28410410-28410432 AAGGAAACTGAGGCTGAGGATGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1165840841 19:38788502-38788524 ACAGAGAAGGAGGCTGAGGCTGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166142776 19:40813894-40813916 ACAGAGACTGAGAGTGAGGGAGG - Intronic
1166670634 19:44707728-44707750 GCTGGGAAGGAGACTGAGGAAGG - Intronic
1167084597 19:47300660-47300682 ACAGAGAAAGAGAGAGAGGAGGG - Intronic
1167262118 19:48464676-48464698 GAGGACGATGAGACTGAGGAAGG + Exonic
1168191690 19:54742924-54742946 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168193964 19:54759556-54759578 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168196009 19:54774281-54774303 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168197906 19:54789144-54789166 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168204374 19:54838527-54838549 ACAGAGAAAGAGCCAGAGGAAGG + Intronic
1168206600 19:54854700-54854722 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168659687 19:58155884-58155906 AGGGAGAAAGAGAGAGAGGAAGG + Intergenic
1202711457 1_KI270714v1_random:21530-21552 ACAGAGAAGGAAACTGAGGCTGG + Intergenic
925044903 2:765795-765817 AAGGAGACTGAGGCAGAGGAAGG + Intergenic
925069855 2:957717-957739 ACTGAGACTGAGACTGAGACGGG + Intronic
926562601 2:14434473-14434495 ATAAAGCATGAGACTGAGGAGGG + Intergenic
928663941 2:33531633-33531655 CAGGAGACTGAGACTCAGGAAGG + Intronic
928816412 2:35300156-35300178 AGGGACAATGAGAGTGAGGAGGG - Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
931217522 2:60260598-60260620 TCCAAGAATGAGACTGAGAATGG - Intergenic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
932377616 2:71251491-71251513 AGCGAGAATGACACAGAGGACGG - Intergenic
932495910 2:72145595-72145617 ACGGAGAGTGAGACGGAGCGAGG - Intronic
933043588 2:77503318-77503340 ATGGAGTATGAGGGTGAGGATGG + Intronic
933793144 2:85899624-85899646 TCTGAGAATGAGACTGGGGGAGG - Intergenic
937680720 2:124641260-124641282 ACAGAGGAGGAGACTGAGGCTGG + Intronic
938665025 2:133526150-133526172 ACAGAGAAAGGGAATGAGGAAGG + Intronic
939370053 2:141287234-141287256 GAGGAGAATGAGAATGAGAATGG - Intronic
939974020 2:148695557-148695579 AAGGATAATGAGACTGAAGTTGG - Intronic
940175145 2:150870418-150870440 GCGGAGAATGGGACTGAGACAGG + Intergenic
941198745 2:162483010-162483032 AAGGAGAATGGGAATGAAGAAGG + Intronic
941739838 2:169023806-169023828 AAGTGGAATGAGACTGGGGAGGG + Intronic
943458183 2:188134692-188134714 AAGGAGAAAGAGACTGAGAGAGG + Intergenic
943629155 2:190231710-190231732 AGGGGGTATGAGACGGAGGAAGG + Intronic
943784232 2:191859467-191859489 AGGGAGAGAAAGACTGAGGATGG - Intergenic
943912880 2:193591410-193591432 ACGGAGAATGAAAATGGAGAAGG + Intergenic
945410581 2:209501530-209501552 GAGGAGAAAGAGACAGAGGATGG + Intronic
947158441 2:227187285-227187307 AGGGAGGATGAGGGTGAGGATGG + Intronic
947279088 2:228428224-228428246 ACTGAGGATGCCACTGAGGAGGG - Intergenic
947385098 2:229583121-229583143 ACTGACATTGAGATTGAGGATGG - Intronic
947447380 2:230174449-230174471 ACAGTGAATGAGACTCAGGAGGG - Intronic
947591383 2:231388132-231388154 ACAGAGAAGGAAACTGAGGCAGG - Intergenic
947755140 2:232557354-232557376 AAGGTGAATGAGACTGTGGAAGG + Intronic
948477007 2:238226811-238226833 TTGGAGGATGAGACAGAGGAGGG - Intronic
948524558 2:238563022-238563044 ACGGACGATTAGACTGAGGATGG - Intergenic
949073892 2:242042894-242042916 ACGGAGAAAGAAACCCAGGACGG + Intergenic
1168758177 20:330220-330242 ACAGACAATGAGACTGAGTTTGG - Exonic
1168915525 20:1482554-1482576 AAGGAGAAAGAGAGAGAGGAAGG - Intronic
1170530130 20:17282840-17282862 GGGGAGAATGAGTCTGAGGGAGG + Intronic
1171193725 20:23180607-23180629 TCGGAGCAATAGACTGAGGAAGG - Intergenic
1174607190 20:51769168-51769190 ATAGAGAATGAGGGTGAGGATGG - Intergenic
1175329236 20:58151227-58151249 AGGGAGAAGGAGACGGAGAAAGG - Intronic
1175440983 20:58991186-58991208 GCAGAGAGTGTGACTGAGGAAGG - Intronic
1176208873 20:63907320-63907342 AAGAAGACTGAGACTCAGGAAGG - Intronic
1177633799 21:23759939-23759961 AAAGAGACTGAGACTTAGGAAGG - Intergenic
1178822859 21:35991336-35991358 ACAGAGCAGGAGAGTGAGGAGGG + Intronic
1179177774 21:39021483-39021505 AGGCAGATTGGGACTGAGGAAGG + Intergenic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1180012622 21:45060934-45060956 ACAGACAGTGAAACTGAGGATGG - Intergenic
1180727632 22:17958485-17958507 ACGGGGGATGAGGGTGAGGATGG - Intronic
1181140019 22:20797484-20797506 GCAGAGAATGGGACAGAGGAAGG + Intronic
1182679282 22:32066139-32066161 AAGGAGAATAAGACTGTGAATGG - Intronic
1184541980 22:45132183-45132205 AGGGAGACTGAGGGTGAGGATGG - Intergenic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
950177861 3:10888390-10888412 AGGAAGAATCTGACTGAGGATGG + Intronic
950265875 3:11572522-11572544 GAGGGGAATGGGACTGAGGAGGG - Intronic
950453146 3:13076852-13076874 ACGGGGAATAAGATTTAGGAGGG - Intergenic
950611532 3:14130224-14130246 ACGGAGACTGATTCAGAGGACGG - Intronic
953092866 3:39746992-39747014 ACAGAGAATGAGATGGAGCAGGG - Intergenic
953827402 3:46265769-46265791 AGGGAGAACGAGACAGAAGATGG - Exonic
954288858 3:49638402-49638424 ATGGAGGAAGAGACTGAGGTTGG + Intronic
955266820 3:57452065-57452087 AGGCAGAAAGAGACTGAGGCAGG - Intronic
955595136 3:60581523-60581545 ACCGAGATTGAGACAGTGGAAGG - Intronic
955808148 3:62758172-62758194 AAGGAGAGTGAGACTGATGGAGG - Intronic
956458678 3:69449991-69450013 AGGGAAACTGAGGCTGAGGAAGG - Intronic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957593784 3:82233937-82233959 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
958781843 3:98552196-98552218 AAGGAGAGTGACACTGACGAAGG + Intronic
958783462 3:98570815-98570837 ATGGAGAATGGAACTGAGGCAGG - Intronic
959755732 3:109896608-109896630 ACAGAGAATTAGTCTAAGGAAGG - Intergenic
961047694 3:123720798-123720820 ATGGAGAATGTGACTGACGCTGG - Intronic
961488250 3:127232546-127232568 ATGCAGGATGAGATTGAGGAGGG - Intergenic
962184566 3:133244405-133244427 TCAGAGAATGAGACTTAGGACGG - Intronic
962285216 3:134079334-134079356 ACGAGGACTGGGACTGAGGAGGG + Intronic
962410175 3:135134332-135134354 AAGCAGAATGAGTCTGAGGGTGG - Intronic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
963060563 3:141221533-141221555 AAGGGGAATGAGACTGAGAAGGG + Intergenic
964936759 3:162098617-162098639 ATGGAGACCGAGTCTGAGGAGGG + Intergenic
965264904 3:166531061-166531083 AAGGAGAATTAGAGTGAAGAGGG + Intergenic
966218731 3:177529372-177529394 ACAGATAAAGAAACTGAGGAGGG - Intergenic
969316168 4:6382529-6382551 GCAGAGGATGAGGCTGAGGAGGG - Intronic
971484540 4:27145961-27145983 AGGGAAAAAGAGACTGAGGCTGG - Intergenic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
974608340 4:64183026-64183048 AGAGAGAAAGATACTGAGGAGGG + Intergenic
975141191 4:70920276-70920298 GCGGAGAGTGAGACTGTTGAAGG - Intronic
975293616 4:72706620-72706642 AAGGAGAATGAGAGGGAAGAAGG + Intergenic
975470687 4:74762624-74762646 AAGGAGAATGAGAAAGAGGGTGG + Intronic
976454467 4:85229451-85229473 ACAGACACTGAGACTGAAGAAGG - Intergenic
977142459 4:93390338-93390360 CCGAAAAATGAGACTGAGCAAGG + Intronic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977798089 4:101192492-101192514 TGGGAGGATGAGACTGAGGCTGG - Intronic
978696201 4:111583594-111583616 AGAGAGAAAGAGAGTGAGGAGGG + Intergenic
979622189 4:122811132-122811154 AGGGAGACTGAGACTGAGACTGG - Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
980487168 4:133473733-133473755 ATGGAGAATGAACTTGAGGAGGG - Intergenic
981036571 4:140175897-140175919 CCAGAGAATGAGAATGAGAATGG - Intergenic
981384328 4:144110115-144110137 ATAGAGAATGAGACTAAGAAGGG - Exonic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
984202916 4:176748268-176748290 ACATAGAATGACACAGAGGAGGG + Intronic
984228146 4:177060748-177060770 AGGGAGAATGATAGTGAGGAGGG - Intergenic
984924356 4:184793659-184793681 AGGGAGAGTGAGAGAGAGGAGGG + Intronic
985361501 4:189180049-189180071 GGGGAGAATGAGACTGAGATAGG + Intergenic
986995780 5:13605526-13605548 AAGAAGAATGAGAGTAAGGAGGG + Intergenic
988018304 5:25590027-25590049 AAGGACTATGAGACTGAGGAAGG + Intergenic
989016934 5:36947387-36947409 GGGGAGAAAGAGACAGAGGATGG - Intronic
989668773 5:43889370-43889392 AGGGAGAATGTGACTTATGAAGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990352843 5:54936087-54936109 AGGGAGAATGAGACTCAGGAAGG - Intergenic
991312880 5:65264284-65264306 AGAGAGAATGGGGCTGAGGAAGG - Intronic
991933159 5:71775227-71775249 ACAGAGAAAGAGAATAAGGAGGG - Intergenic
992441451 5:76800980-76801002 AGAGAGAATGAGGCTGGGGAGGG + Intergenic
994736890 5:103566681-103566703 CAGGAGAATGAGGCTGAGGCAGG + Intergenic
995319981 5:110823610-110823632 GCTGACAATGAGAGTGAGGAGGG - Intergenic
995748405 5:115428118-115428140 AGGAAGGGTGAGACTGAGGAGGG + Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996668826 5:126092394-126092416 ACGGAGAAAGAGACTGTGGGGGG + Intergenic
997695205 5:135856178-135856200 AAGGAGCATGAGCCTCAGGAAGG - Intronic
998219237 5:140262719-140262741 AATGGGAATGAGACTGGGGAAGG + Intronic
998358734 5:141565639-141565661 ACTGAGAATGAGGATGAGGGAGG + Intronic
998775239 5:145592316-145592338 AAGGAGAATGACACTGAGGAAGG + Intronic
1000601147 5:163276180-163276202 ACAGAGAATGAGACCCAGAAGGG + Intergenic
1000913472 5:167050590-167050612 ACCGTGAATGAGAGTGAGGCAGG + Intergenic
1002189060 5:177469462-177469484 GCGGAGATTGAGGCTGAGGGCGG - Intronic
1002792784 6:447889-447911 AGGGAGAACGAGCCAGAGGAAGG + Intergenic
1002958668 6:1893525-1893547 ACTGAGAATGAAAAAGAGGATGG - Intronic
1004184370 6:13409350-13409372 AGAGAGAAAGAGACAGAGGAAGG + Intronic
1006089496 6:31620239-31620261 AGGGAGAAAGAGAGAGAGGACGG - Intergenic
1006245221 6:32728033-32728055 AGGGAGAAAGAGAGGGAGGATGG - Intergenic
1007181357 6:39931650-39931672 AGGGAGAATGAGGGGGAGGAGGG - Intronic
1007273679 6:40657850-40657872 CCAGAGAGTGAGACTCAGGATGG - Intergenic
1007352086 6:41281277-41281299 ACGGTAAATGAAGCTGAGGAGGG + Intronic
1007380655 6:41488303-41488325 AGCCAGAAGGAGACTGAGGAGGG - Intergenic
1008326394 6:50187350-50187372 AGGCAGAATGACAATGAGGATGG - Intergenic
1008921738 6:56850098-56850120 ATGGAGACTGAGAGTGAGCAGGG - Intronic
1009625568 6:66136236-66136258 ACCGACAATGAGGCTGAAGAGGG + Intergenic
1011172620 6:84522724-84522746 AGGGAGAAAGAGCCTGAGAATGG - Intergenic
1011902389 6:92314925-92314947 AGAGAGAAAGAGAGTGAGGAGGG - Intergenic
1012146834 6:95694587-95694609 ACCGTGAAAGAGACTGAGTATGG - Intergenic
1012687419 6:102269272-102269294 ACTGAGAGTGGGACTGAGAAGGG + Intergenic
1013832467 6:114291008-114291030 ACCTAGAAAGAGACTGAGTAGGG - Intronic
1014008906 6:116454093-116454115 AGGGAGGAAGAGACAGAGGAAGG + Intergenic
1015162887 6:130173188-130173210 ACAGAAAATGAGATTGATGACGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015885201 6:137910686-137910708 AAGGAGGAAGGGACTGAGGATGG + Intergenic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1017075681 6:150615632-150615654 GAGAAGAATCAGACTGAGGAGGG + Intronic
1017644026 6:156522476-156522498 ACAGAGACAGAGACAGAGGAGGG - Intergenic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1021142845 7:17049007-17049029 ACGGAAAATGAGAGTAGGGAGGG + Intergenic
1021363639 7:19748565-19748587 ACGGAGCATGACACAGAGGAGGG - Intronic
1021510568 7:21428273-21428295 GCGGCGAAGGAGACTGAGGGGGG - Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021930832 7:25579746-25579768 TCGGGGAATCAGTCTGAGGATGG - Intergenic
1021943744 7:25704974-25704996 AAGGAAAATGACAGTGAGGAGGG + Intergenic
1022452731 7:30530302-30530324 AAGGAGAATAAGACTGTGAATGG - Intronic
1022697814 7:32727990-32728012 ACGAAGAATGAGAGGGAGGGAGG - Intergenic
1023868849 7:44252073-44252095 TCCGAGACTCAGACTGAGGAGGG + Intronic
1028281122 7:88929220-88929242 ACGGGGAGAGAGACTGGGGATGG + Intronic
1028538868 7:91920551-91920573 AAGGAGAATCAGACTGGGAATGG + Intergenic
1029184727 7:98730397-98730419 CAGGAGAAAGAGACAGAGGAAGG + Intergenic
1029815211 7:103086890-103086912 ATGGAGAATAAGACAGAAGAGGG + Intronic
1030607812 7:111656896-111656918 AAGGAGAATGAAAATGAGCAGGG + Intergenic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1031769669 7:125828325-125828347 ACAGAGAATGGCACTGAGTAAGG + Intergenic
1032197191 7:129796285-129796307 ACGCAGAGGGAGGCTGAGGAGGG - Intergenic
1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG + Intronic
1032902785 7:136329708-136329730 ACGGAGAATAGGAGTGAGAAAGG + Intergenic
1034193589 7:149229144-149229166 TAGGAGAATGAGATTGAGGATGG + Intergenic
1034339958 7:150346539-150346561 AGGGAGAGAGAGACTCAGGAGGG + Intergenic
1034837282 7:154364282-154364304 ATGGACAATGAGTCTGAGGGCGG - Intronic
1035060539 7:156066256-156066278 ACGTGGAATGAGGATGAGGATGG - Intergenic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1035971872 8:4258294-4258316 AGGGAGAAAGAGAGTGAGGGAGG + Intronic
1036582332 8:10086920-10086942 AATGAGAATGAGAATGAGAATGG + Intronic
1037888582 8:22608695-22608717 AGGGAGAGTGAGACTGAGGAAGG - Intronic
1037908331 8:22728409-22728431 AAGGAGCAGGAGACTGTGGAAGG + Intronic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038212650 8:25533858-25533880 ATGCAGAATGGGACTGAGGGAGG - Intergenic
1038761929 8:30392414-30392436 AGGAAGAATGAAACTGGGGAGGG + Intronic
1038888390 8:31691027-31691049 CTTGAGAATGAGACTGAGGTTGG + Intronic
1039350491 8:36758845-36758867 ACTGAGAATAAGACTGAGGGAGG - Intergenic
1039412691 8:37368535-37368557 AGGAAGAATGAGAGGGAGGAAGG + Intergenic
1039635430 8:39159560-39159582 AGGAAGAAAGAGGCTGAGGAAGG - Intronic
1040399681 8:47036296-47036318 ATGAAGAATGAGAGTGAGGTGGG + Intergenic
1041264610 8:56052169-56052191 ACACAGAATGAGCCTGGGGATGG + Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1045723779 8:105146228-105146250 AAGGAGAATGGGAGTGATGAAGG - Intronic
1046595988 8:116261729-116261751 ACTGCAAAGGAGACTGAGGAAGG + Intergenic
1047222094 8:122926883-122926905 TCTTAGAATGACACTGAGGATGG + Intronic
1047612639 8:126536133-126536155 TGGGAGACTGAGACTGAGGCGGG - Intergenic
1047612721 8:126536950-126536972 TAGGAGACTGAGACTGAGGTGGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048320182 8:133393545-133393567 AAGGAGCATGGGTCTGAGGATGG + Intergenic
1048574617 8:135680960-135680982 AGAAAGAATGAGACTGAGAAAGG + Intergenic
1049028219 8:140012425-140012447 ACTGAGAATGAGAGGGAAGAAGG + Intronic
1050148941 9:2599916-2599938 AAGGATGATGAGACTGAGGGAGG + Intergenic
1050350797 9:4739979-4740001 CCGAAGAATGGGACTGAGGTAGG + Intronic
1051160025 9:14197266-14197288 CAGGAGAGTGAGACTGAGAAAGG - Intronic
1051228751 9:14931211-14931233 ACTGCAAATGAGACTCAGGAAGG - Intergenic
1053509319 9:38673807-38673829 ACGGAGGAGGACACTGAGGCCGG - Intergenic
1055811603 9:80155323-80155345 ACAAAGAATGAAAGTGAGGAGGG - Intergenic
1056041345 9:82670476-82670498 AGAGAGAAAGAGACAGAGGAAGG + Intergenic
1056755365 9:89378698-89378720 ACGCAGATGGAGACTGAGGCCGG - Exonic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057867773 9:98694739-98694761 TCGGAGAAAGAGAGAGAGGAAGG - Intronic
1058816129 9:108684353-108684375 ATGGAGAATGAGACTCAGAGAGG + Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059624147 9:116043108-116043130 AGGGAAACTGAGACTGAGTAAGG - Intergenic
1059760244 9:117330613-117330635 ATGTAGAATGACACAGAGGAAGG - Intronic
1059770169 9:117416324-117416346 AAGGGGAATGAGACAGAAGAGGG - Intergenic
1061943973 9:133898168-133898190 ACAGAGAAGGAAACTGAGGCCGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1186196724 X:7116535-7116557 ATGGTGAATGAGGCTGAGCAGGG - Intronic
1186389490 X:9144340-9144362 TCAGAGAATGAGCCTGAGGTAGG - Intronic
1188337034 X:28948985-28949007 ACGGAAAATGAAGCTGTGGATGG + Intronic
1189191832 X:39115951-39115973 ACAGAAAATGAGAGAGAGGATGG - Intergenic
1190381640 X:49844863-49844885 AAGTATAATGAGACTGAGGCTGG + Intergenic
1194199611 X:90938610-90938632 AAGGAGCATGAGATTTAGGAAGG - Intergenic
1194877842 X:99211195-99211217 ACTGAGAATGAGAATATGGAAGG - Intergenic
1194961133 X:100236778-100236800 ACGGAGAATGAGCCGAAGCAGGG - Intergenic
1196661218 X:118271180-118271202 AAGGAGAATGAAACCAAGGAAGG + Intergenic
1196760751 X:119198486-119198508 AAGAAGAATGAGAATGAGCAAGG + Intergenic
1198230449 X:134684099-134684121 TGGGAGAAGGAGACTGAGAATGG + Intronic
1199394492 X:147318818-147318840 TAGGAGAATGGGATTGAGGAAGG - Intergenic
1199661336 X:150053710-150053732 AAGGAGAATGAGAGGGATGATGG - Intergenic
1200205432 X:154312181-154312203 AGGGAGAATGAGAATAAGGCTGG - Intronic
1200545602 Y:4515027-4515049 AAGGAGCATGAGATTTAGGAAGG - Intergenic
1201316889 Y:12656227-12656249 AGGGAGATTGGGACAGAGGAAGG - Intergenic
1202365829 Y:24163701-24163723 AAGGAGAATAAGACTGTGAATGG + Intergenic
1202504953 Y:25506421-25506443 AAGGAGAATAAGACTGTGAATGG - Intergenic