ID: 1104550505

View in Genome Browser
Species Human (GRCh38)
Location 12:129752627-129752649
Sequence CAAAGCTATGCCATTTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104550500_1104550505 3 Left 1104550500 12:129752601-129752623 CCGCATGCAAGAGCAGCAGTGCT 0: 1
1: 0
2: 1
3: 11
4: 134
Right 1104550505 12:129752627-129752649 CAAAGCTATGCCATTTAGGGAGG 0: 1
1: 0
2: 1
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104550505 Original CRISPR CAAAGCTATGCCATTTAGGG AGG Intronic
902289082 1:15425099-15425121 CAAGGTTCTGCCATCTAGGGTGG + Intronic
905307858 1:37031919-37031941 CAGAGCTGTGCCAGTTTGGGCGG - Intronic
919887508 1:201945647-201945669 CAAAGCTAAGCCATTTTTTGTGG - Intronic
920433154 1:205931787-205931809 CAAAGCTAAGGCTTTGAGGGAGG + Intronic
1062965855 10:1607329-1607351 TAATGCTAGGCCATTTAGGCTGG + Intronic
1067908922 10:50324188-50324210 CTCTGCTTTGCCATTTAGGGAGG + Intronic
1081199868 11:40202781-40202803 CAAAGCTTGGCCATTTAACGGGG + Intronic
1083635498 11:64118532-64118554 CCAAGTTATGCCAGTTGGGGAGG + Exonic
1085199165 11:74691326-74691348 CAAAGGAAAGTCATTTAGGGAGG + Intergenic
1090615998 11:128515681-128515703 CAAAGGTATCCCAGTTTGGGTGG + Intronic
1092971848 12:13703717-13703739 CAAAGATATGCCTATGAGGGTGG - Intronic
1096051432 12:48612329-48612351 AAAATCTATGCCATTTGGAGTGG - Intergenic
1097769182 12:63561135-63561157 CAATGCTTTCCCATTTTGGGTGG + Intronic
1098384212 12:69901666-69901688 CAAAGGTATGCCATATAAGATGG - Intronic
1102685273 12:114719651-114719673 CAAAGCTCTGACATATAGGGAGG + Intergenic
1104550505 12:129752627-129752649 CAAAGCTATGCCATTTAGGGAGG + Intronic
1111035943 13:82674680-82674702 CAAAGCTAGGCCATAGAGGAAGG + Intergenic
1111869213 13:93809514-93809536 CAAAGGTACCTCATTTAGGGAGG - Intronic
1114187580 14:20414419-20414441 CAATGCGATGGTATTTAGGGTGG + Intergenic
1117389412 14:55248788-55248810 CAAAGCATTGCCATTTAAGATGG - Intergenic
1117390657 14:55259209-55259231 CAAAGCTATGGCCTTTAGGGAGG + Intergenic
1120169046 14:81230946-81230968 GAGACCTATGCCATTTAGGGTGG - Intergenic
1121386295 14:93529875-93529897 CAAAGCTATGCCCTATAAGTTGG + Intronic
1127952178 15:63819754-63819776 CAAAACTATGTCATTGAGGCTGG + Intronic
1130145682 15:81272190-81272212 TCAAGCTATGCCCTCTAGGGCGG + Intronic
1131530939 15:93191147-93191169 CACAGCTATGCCATTGCTGGGGG - Intergenic
1132070927 15:98775898-98775920 CAAATCTTTGCAAATTAGGGAGG + Intronic
1139162622 16:64529530-64529552 CAATGCTATCCCTTTTAGAGAGG - Intergenic
1140041134 16:71408984-71409006 CAAAGCTTTGCAATTTTGGGGGG + Intergenic
1144080113 17:11756702-11756724 CAAAGCTACTCCACTTAGGGAGG + Intronic
1147943340 17:44066022-44066044 CAAAGGTATGGAATTTAGGAGGG - Intronic
1152629336 17:81403029-81403051 CAAAGCTGTGAAATCTAGGGGGG + Intronic
1153683734 18:7525275-7525297 CAAAGCTATGACAATTCAGGAGG - Intergenic
1156315276 18:35963624-35963646 CACAGGTATGTCATTTAGGAAGG - Intergenic
1157130272 18:45000630-45000652 AAAAGCTATGGAATTTTGGGAGG - Intronic
1160891263 19:1379874-1379896 CACAGCTGTGCCACTGAGGGGGG - Intergenic
927047406 2:19293848-19293870 CAAAGCTATACCATTTATAATGG + Intergenic
927359260 2:22213063-22213085 GAAAGCAATGCCATTTACAGTGG - Intergenic
929701258 2:44165280-44165302 CAAAGCTCAGTCATTTAGGTGGG - Intergenic
930340567 2:50109454-50109476 CAAAGCAATGCCATTTCTGTGGG - Intronic
931539390 2:63313472-63313494 CAAAGTTATTACATTTAGGAGGG + Intronic
932411321 2:71549620-71549642 CAAGCCTATCCCATTTAGGAAGG - Intronic
935070476 2:99689436-99689458 AAAAGCTGTGCCCTTTGGGGTGG - Intronic
936175594 2:110217612-110217634 CAAAGCTATACCTTTTATGGGGG - Intergenic
941055781 2:160786277-160786299 CAAAGCTATGCCATCTATAATGG + Intergenic
941236561 2:162982802-162982824 CAAAGCCATGCCATTCACAGTGG + Intergenic
941407028 2:165102621-165102643 CAATTCCATGCCATGTAGGGTGG - Intronic
941518942 2:166513468-166513490 CTAAGCTATGATATTGAGGGAGG - Intergenic
941834010 2:169996482-169996504 TCAAGCTATCCCATTTAGGAAGG + Intronic
945147218 2:206751243-206751265 CCAAACTATGACAGTTAGGGAGG - Intronic
945471683 2:210234388-210234410 CAAAGCCATACCATATTGGGTGG + Intergenic
946257139 2:218451407-218451429 CTTAGTTATCCCATTTAGGGTGG - Exonic
1176926089 21:14750845-14750867 TTAAGGTATGCCATTTAGTGAGG - Intergenic
1178610847 21:34078164-34078186 CAAGGCTAAGCTGTTTAGGGAGG - Intronic
1179238317 21:39566586-39566608 CAAAGCTGAGGCATTTAGAGAGG - Intronic
1179347011 21:40567800-40567822 CAAATCCATGCCATTTAACGAGG - Intronic
1183069280 22:35385042-35385064 CAAAGTTAAGACATTTAGGTTGG - Intronic
1184025595 22:41853618-41853640 CAAAGCTTTCACTTTTAGGGAGG - Intronic
1184787845 22:46680455-46680477 CGAAGCTGTGCCCCTTAGGGTGG - Intergenic
1185280531 22:49967946-49967968 CACAGCTATGCCCCTGAGGGTGG - Intergenic
951600664 3:24371217-24371239 CAAACCTATACCTTTTTGGGAGG - Intronic
958594180 3:96200971-96200993 CATAGCTCTGCCAATGAGGGAGG + Intergenic
962258926 3:133890933-133890955 CAAAGCTATGCCATGGTGTGTGG + Intronic
963330622 3:143910682-143910704 CAAAGCCCTTCCCTTTAGGGTGG - Intergenic
964285357 3:155111800-155111822 GAAGGCTATGCCATTTGGAGGGG - Intronic
964648114 3:158980624-158980646 CAAATATATGCCATTTGGGGTGG + Intronic
965938785 3:174149337-174149359 CAAAGGAATGCCATGGAGGGAGG - Intronic
969920648 4:10536455-10536477 CAAAGCCATGTCATTTATCGTGG + Intronic
970257195 4:14180771-14180793 AAAAGCTATGTCTATTAGGGAGG + Intergenic
972200622 4:36710280-36710302 CAAAGGGCTGCCATTTTGGGTGG + Intergenic
974516186 4:62914928-62914950 TAAAGCTATACCCTTTAGAGAGG + Intergenic
980964762 4:139510302-139510324 CAAAGCTATGGCATGTGGTGAGG + Exonic
986007720 5:3681999-3682021 CAAAGCCATCCCATTTGGAGGGG + Intergenic
986154914 5:5164917-5164939 CAAAGCTAGGCCAAGGAGGGTGG - Intronic
986207808 5:5642571-5642593 CAAAGGGATGTCTTTTAGGGAGG - Intergenic
988624160 5:32853025-32853047 CAAAGCTATCCCTTTTAGTTGGG + Intergenic
993341885 5:86734799-86734821 CAAAGCTATTACATTTAATGAGG - Intergenic
994010906 5:94901193-94901215 CAAAGTTATGCCTTCTAAGGTGG + Intronic
997650232 5:135511855-135511877 CAAAGCTATGCAATGTGGTGGGG - Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
999879126 5:155841546-155841568 TAAAACTCTGCCATTTTGGGGGG + Intergenic
1000919361 5:167120017-167120039 CAAAGCTAAACCAAATAGGGTGG + Intergenic
1001477031 5:172057824-172057846 CACAGCTATACCATGGAGGGAGG + Intronic
1002139006 5:177127218-177127240 CATAGCTATCCCATTTGGTGAGG + Intergenic
1003444625 6:6173366-6173388 CAAAGCTGTGTCATCTAGGAGGG - Intronic
1003820668 6:9893327-9893349 AAAAGGTATGCCAAATAGGGTGG + Intronic
1007660251 6:43480035-43480057 CAAAGCTATGCCATTAATAAAGG - Intronic
1009548404 6:65052993-65053015 GAAAGCTATGCTATTTTTGGAGG + Intronic
1010059453 6:71605876-71605898 CAAAGCAATGCCCTGGAGGGAGG - Intergenic
1010466722 6:76175983-76176005 CAAATCTGTGCCATTTAAGTGGG - Intergenic
1011764376 6:90604308-90604330 CAAAGAAATGCCATTTAAGCTGG - Intergenic
1011868218 6:91858952-91858974 CACTGCTATGACATTTAGAGTGG - Intergenic
1013714961 6:112948598-112948620 CAAAGCTATGTTATCCAGGGAGG + Intergenic
1015620961 6:135131336-135131358 AAAAGCTAAGCCATGTATGGTGG + Intergenic
1016321682 6:142853590-142853612 AGAAGCTATGCCATCTAAGGTGG - Intronic
1022928454 7:35082217-35082239 CAATGCTTTCCCATTTTGGGTGG + Intergenic
1026831540 7:73613183-73613205 CAAACCTTTGGCGTTTAGGGAGG + Intronic
1028990015 7:97038913-97038935 CAAATCAATTCCATTTAAGGTGG - Intergenic
1029824564 7:103175889-103175911 CAATGCTTTCCCATTTTGGGTGG + Intergenic
1037607154 8:20447690-20447712 CAGAGGTATGTCATTGAGGGTGG - Intergenic
1041636843 8:60154511-60154533 CATTGCAATGACATTTAGGGTGG - Intergenic
1047694387 8:127388605-127388627 CTAAGCTATGACATTTTGGGCGG - Intergenic
1051245354 9:15104880-15104902 CAAAGTTCTGGCATGTAGGGGGG + Intergenic
1051610027 9:18952248-18952270 CAATGCTATGCCATTCATGAAGG - Intronic
1052559232 9:30062420-30062442 CAAAGCCAAGACATGTAGGGTGG - Intergenic
1055033644 9:71795071-71795093 CAAGGCTATGCCATCTCTGGTGG - Intronic
1055693844 9:78861607-78861629 CAAAGATAAGTTATTTAGGGAGG + Intergenic
1061186947 9:129060408-129060430 CAGAGCTTTGCCATTGAGTGTGG + Intronic
1061938582 9:133872115-133872137 CACAGCTATGCCATCTCTGGGGG - Intronic
1185740618 X:2529204-2529226 CAAAGTTAAGCCATTTAGTTAGG + Intergenic
1186882682 X:13881816-13881838 CCAAGCTCTGCTATTTAGGTTGG - Intronic
1186882787 X:13882984-13883006 CCAAGCTCTGCTATTTAGGTTGG - Intronic
1188417988 X:29960144-29960166 CAAAGCCAGGCCATTTTGGAAGG - Intergenic
1191869276 X:65731820-65731842 CAACTCTGTGTCATTTAGGGAGG + Exonic
1192736689 X:73855921-73855943 CAGGGCTATGCCATTTAAAGAGG + Intergenic
1198832519 X:140765358-140765380 CAAAGCTTTGCAACTTGGGGCGG - Intergenic
1202025170 Y:20514142-20514164 CAAATCTATACCATATAGTGTGG + Intergenic