ID: 1104556107

View in Genome Browser
Species Human (GRCh38)
Location 12:129801065-129801087
Sequence GGCCCACAGAGTCTCCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 1, 2: 5, 3: 28, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104556103_1104556107 0 Left 1104556103 12:129801042-129801064 CCGCACCTGGCTCGGAGGGTCCT 0: 1030
1: 1401
2: 846
3: 660
4: 758
Right 1104556107 12:129801065-129801087 GGCCCACAGAGTCTCCCTGATGG 0: 1
1: 1
2: 5
3: 28
4: 206
1104556097_1104556107 15 Left 1104556097 12:129801027-129801049 CCAGGAGATTATATCCCGCACCT 0: 376
1: 1581
2: 1840
3: 1658
4: 604
Right 1104556107 12:129801065-129801087 GGCCCACAGAGTCTCCCTGATGG 0: 1
1: 1
2: 5
3: 28
4: 206
1104556105_1104556107 -5 Left 1104556105 12:129801047-129801069 CCTGGCTCGGAGGGTCCTGGCCC 0: 1
1: 5
2: 102
3: 1420
4: 2089
Right 1104556107 12:129801065-129801087 GGCCCACAGAGTCTCCCTGATGG 0: 1
1: 1
2: 5
3: 28
4: 206
1104556102_1104556107 1 Left 1104556102 12:129801041-129801063 CCCGCACCTGGCTCGGAGGGTCC 0: 760
1: 1656
2: 1623
3: 1147
4: 935
Right 1104556107 12:129801065-129801087 GGCCCACAGAGTCTCCCTGATGG 0: 1
1: 1
2: 5
3: 28
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104556107 Original CRISPR GGCCCACAGAGTCTCCCTGA TGG Intronic
900555770 1:3279652-3279674 GCAGCACAGACTCTCCCTGACGG - Intronic
904418073 1:30374883-30374905 CGCCCACCCAGTCTCCCTGTTGG - Intergenic
908432436 1:64072324-64072346 GGCCCTCAGAGCCTCTTTGAGGG + Intronic
909200725 1:72687452-72687474 GACCCACAGAGAGTCCCTGTTGG - Intergenic
911185656 1:94901816-94901838 GGCCAACAGAGTTTCACAGAAGG + Intronic
911394385 1:97287695-97287717 CACCCACAGATTCTCACTGATGG - Intronic
911853986 1:102854077-102854099 CGCCCACCGAGCCTCCCCGATGG + Intergenic
916789734 1:168114930-168114952 GGGCTAGAGAGTCTCACTGATGG + Intronic
918113447 1:181477914-181477936 GAACCAGAGAGTCTCCCAGAGGG - Intronic
921264936 1:213414573-213414595 GTCCCACAGAGCCTCCAGGAGGG + Intergenic
922734106 1:227970446-227970468 GGCCCACAGAGGCTCCCGAGAGG - Intergenic
924162402 1:241246241-241246263 AGGCCACAGAGTCTGCTTGAGGG + Intronic
1062858252 10:790300-790322 GGGCCAGTGAGTCTCCCTGCCGG + Intergenic
1062858263 10:790344-790366 GGGCCAGTGAGTCTCCCTGCCGG + Intergenic
1064829503 10:19446048-19446070 CGCCCACAGAGCCTCACTCATGG - Intronic
1065233200 10:23620582-23620604 AGCTCACACAGTCTCCCTGTGGG + Intergenic
1069854762 10:71433986-71434008 GGCCTACAAAGTGTCCATGATGG + Intronic
1070777479 10:79118306-79118328 GGACCACAGAGATTCCTTGATGG - Intronic
1071508362 10:86246305-86246327 GGCCCACCTGGGCTCCCTGAGGG + Intronic
1072029364 10:91503627-91503649 ACCCCACGGAGTCTCGCTGATGG + Intronic
1073576488 10:104630551-104630573 GGCCAAGGGAGGCTCCCTGAAGG + Intergenic
1074112748 10:110434009-110434031 CGCCCGCAGAGCCTCCCTGCAGG + Intergenic
1074130184 10:110567377-110567399 GGCCCTCGGAGTCTCCCTCTTGG + Intergenic
1074187153 10:111107177-111107199 GTCCCACAGAGTCTCCCCCAGGG + Intergenic
1074454879 10:113588198-113588220 GGCCTCCAGAGTCACCCTAAGGG - Exonic
1074875427 10:117609813-117609835 GACCCACAGCCACTCCCTGAGGG + Intergenic
1077173905 11:1180210-1180232 GGGCCACAGAGGCTCCTCGAGGG - Intronic
1078908708 11:15711329-15711351 GGTCCAAAGAGGCTCCCAGAAGG - Intergenic
1080603677 11:33845650-33845672 GGCCTAGAAAGTGTCCCTGAGGG + Intergenic
1080623218 11:34004979-34005001 GCCCCACAGAGAGGCCCTGAAGG + Intergenic
1083638890 11:64134904-64134926 GGCCCTCAGAGTCTCCCTCCAGG + Intronic
1084309437 11:68308184-68308206 GAGCCACAGAATCTTCCTGAGGG - Intergenic
1085448115 11:76614796-76614818 GTCCCACAGAGGCTCCCAGTGGG + Intergenic
1085732749 11:79013338-79013360 GGCACACAGAGCTTCCCAGAGGG - Intronic
1088206276 11:107396774-107396796 GACCCACAGACCCTCTCTGAAGG + Intronic
1090865584 11:130697950-130697972 TCCCCACAGAGCCTCCCTGCAGG - Intronic
1096180405 12:49547593-49547615 GCCCCACAGGAGCTCCCTGAGGG - Intronic
1096268461 12:50143776-50143798 GGCCCAAAGGTTTTCCCTGAGGG + Intronic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1101723899 12:107374032-107374054 AGCCCACTGAGTCTCCATGGTGG + Intronic
1102241639 12:111328219-111328241 GTCCCACAGAGTCTGGCTGTGGG + Intronic
1103238896 12:119397773-119397795 GCCCCACCCAGCCTCCCTGACGG - Intronic
1103322554 12:120100495-120100517 GGACCACAGATTGTCCTTGAAGG - Intronic
1103714328 12:122935220-122935242 GGCCCACAGGGTCACCCTCAGGG - Intronic
1103937472 12:124484177-124484199 GGCTCACAGCGTTTCCCGGATGG - Intronic
1104159632 12:126165788-126165810 ATCCCACAGAGTTGCCCTGAGGG - Intergenic
1104556107 12:129801065-129801087 GGCCCACAGAGTCTCCCTGATGG + Intronic
1105042640 12:132972545-132972567 TGCCCAAAGAGTTTCCATGAGGG + Intergenic
1107727951 13:43318950-43318972 GCCCCACAGAGTCAACCTGGAGG + Intronic
1110841798 13:80152265-80152287 TGCCCACGGAGTCTCACTGATGG + Intergenic
1113456654 13:110454315-110454337 GGCACACAGTGGCTCTCTGAGGG - Intronic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1117016955 14:51527878-51527900 GCCCCACTGAGCCTCACTGAAGG - Intronic
1117231344 14:53722354-53722376 GCCCCTCAAAGTCTCCATGAGGG - Intergenic
1118955250 14:70475567-70475589 TGCCCACGGAGTCTCGCTGATGG + Intergenic
1119111803 14:71981927-71981949 CGCCCACGGAGTCTCGCTGATGG - Intronic
1119332455 14:73805004-73805026 AGCCCACAGAGTCTCTGGGAAGG - Intergenic
1121152175 14:91645849-91645871 CGCCCACGGAATCTCGCTGATGG - Intronic
1121936855 14:98027815-98027837 GACCCTCAGAATCACCCTGATGG - Intergenic
1122852525 14:104544476-104544498 GGGCCAGAGAGTCTCTCTGGTGG + Intronic
1126142286 15:45448419-45448441 GCCCCACAGAGCCTGCCTGCTGG + Intronic
1128779287 15:70348110-70348132 GGTCCACAGAGATGCCCTGAAGG - Intergenic
1129656601 15:77528955-77528977 GGCCCCCAGGGCCTCCTTGATGG + Intergenic
1129685680 15:77684960-77684982 TGCGCACAGGGTCTCCATGAAGG + Intronic
1129837483 15:78720195-78720217 CGCCCATGGAGTCTCGCTGATGG + Intronic
1129889721 15:79063907-79063929 GGCCCAGGGAGTCTCCCTACAGG + Intronic
1131840603 15:96432716-96432738 GTCCCATAGAATCTCCCTGGTGG - Intergenic
1132498249 16:273878-273900 TGCCCACACAGTCTCACTGGGGG - Intronic
1133130632 16:3674291-3674313 GGACAACAGAGTCACCCTGAGGG + Intronic
1133857636 16:9564691-9564713 GGCACACAGAATTTCCATGAGGG - Intergenic
1134090693 16:11390300-11390322 GGCCCCCAGGGCCGCCCTGATGG + Exonic
1135078111 16:19411344-19411366 GGCTCACAGAATCTCTGTGAGGG - Intronic
1135231381 16:20711420-20711442 CGTCCACAGAGTCTCACTTAAGG + Intronic
1136597566 16:31262051-31262073 CACACACAGAGTCTCCCCGAAGG - Intronic
1139195366 16:64912120-64912142 GAACCTCATAGTCTCCCTGAGGG + Intergenic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1140472813 16:75224698-75224720 GGCCGCCAGAGTCGCCCTGTGGG - Exonic
1142273758 16:89105019-89105041 TAGCCACAGAGCCTCCCTGAGGG + Intronic
1142920073 17:3176894-3176916 CGCCCACGGAGTCTCGCTGATGG + Intergenic
1143315019 17:6026033-6026055 CGCCCATAGACACTCCCTGAAGG - Intronic
1143545336 17:7591910-7591932 TGCTGACAGAGTCACCCTGAGGG + Exonic
1144726421 17:17504766-17504788 GGCTCACAGAGAGACCCTGAGGG + Intergenic
1147137707 17:38443717-38443739 GGCTGACAGCCTCTCCCTGAAGG + Intronic
1147980555 17:44271411-44271433 TGCCCACAGAGTCTCCCTCTGGG - Intergenic
1148104953 17:45114159-45114181 GGCCCACACAGCCTTCCAGACGG - Intronic
1148150667 17:45395040-45395062 GGCCCACAGGGTCTCTGTGAAGG + Exonic
1148351117 17:46942897-46942919 GGCTCACAGAGGCTCCATGGTGG - Intronic
1151365540 17:73614058-73614080 GGCCCACTGGGCCTCCCTGCCGG + Intronic
1151517940 17:74608690-74608712 GGCCCACACAGCATCCCTGCAGG + Intergenic
1152611136 17:81315489-81315511 GGCCGACAGAGGGTCCCTGAGGG + Intronic
1152934311 17:83127332-83127354 GGACGACAGAGTCGGCCTGAAGG + Intergenic
1155656643 18:28200873-28200895 GGCCAACACAGTTTCCCTAAAGG - Intergenic
1156833378 18:41522665-41522687 GGCTAACAGAGTCTCCCTATTGG + Intergenic
1158296033 18:55997764-55997786 AGTCCACAGAGTATGCCTGAAGG - Intergenic
1160550995 18:79693845-79693867 GCCCCTCCGAGTCTCCCTGAAGG + Intronic
1160774214 19:847743-847765 GGCCACCTGAGTCTCCCTGGAGG - Intronic
1160774229 19:847792-847814 GGCCACCTGAGTCTCCCTGGAGG - Exonic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1161052485 19:2171752-2171774 CGCCCACTGTGTCCCCCTGAGGG + Intronic
1161288474 19:3480446-3480468 GGCCCCCAGGGTCTCCATGACGG + Exonic
1163468207 19:17481915-17481937 GGCCCACCAGGTCTCCCTGCAGG - Intronic
1164521555 19:28983787-28983809 GGCCCACAGAGGCCCTCTGAGGG + Intergenic
1164604021 19:29583087-29583109 GGAGCACAGAGTTTCCATGACGG - Intergenic
1165011007 19:32846397-32846419 CGCCCACAGAGTCTCACTGATGG + Intronic
1165073301 19:33267872-33267894 CACCCCCAGAGTCTTCCTGAAGG + Intergenic
1166147889 19:40849882-40849904 GTCCACCAGAGCCTCCCTGACGG + Exonic
1166152022 19:40881653-40881675 GTCCACCAGAGCCTCCCTGACGG + Exonic
1166208954 19:41293032-41293054 GGCCCACCGAGTGTTCTTGAAGG + Intronic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
1168249881 19:55135862-55135884 GGCCCACAGCGCCCCCCAGAGGG + Intronic
926620101 2:15039768-15039790 GGCCCTCAGAGGCTGCCGGAAGG - Intergenic
926965146 2:18401765-18401787 CTCCCACTGACTCTCCCTGAAGG - Intergenic
931251428 2:60534185-60534207 GGCTCCCAGTGTCTCCCTCAAGG - Intronic
932343045 2:70978759-70978781 GGCGAACAAAGTCTCCTTGAAGG + Exonic
936587583 2:113771844-113771866 GGACCACAGAGTCTACCTCTTGG - Intergenic
938607606 2:132911952-132911974 CGCCCACAGTGTCTGCCTGGAGG + Intronic
942800058 2:179864156-179864178 GGAGAACAGAGTCTCACTGATGG - Intergenic
943564611 2:189503081-189503103 GCCCCACCAGGTCTCCCTGAAGG - Intergenic
946048395 2:216840353-216840375 TGCCCTCAGAGTCTTCCCGAAGG - Intergenic
946468290 2:219932182-219932204 CGCCCACGGAGTCTCGCTGATGG + Intergenic
946505317 2:220294196-220294218 GTCACTCAGAGTGTCCCTGAGGG - Intergenic
947542938 2:230991070-230991092 AGTGCACAGGGTCTCCCTGATGG + Intergenic
947893972 2:233651284-233651306 GGCTCACAGGGTCACCCAGAGGG + Intronic
948350972 2:237340632-237340654 GGCCCAGAGAGTCATCCTGCAGG - Exonic
948935009 2:241158164-241158186 AGCCCACAGCGTGTCTCTGATGG + Intronic
1170031576 20:11949509-11949531 GGCCCAGAGGGTCACACTGATGG + Intergenic
1170933523 20:20790868-20790890 GGCCCACGGAGACCCACTGATGG - Intergenic
1171382657 20:24745301-24745323 TGCCCACAGAGTCTGCTGGAGGG - Intergenic
1172364740 20:34340283-34340305 GGCTCACAGAATCTCCATGAGGG - Intergenic
1172554841 20:35831906-35831928 GGTCCACAAGGTCTCCATGAGGG - Intronic
1173161160 20:40653451-40653473 GGTCCACAGAAGATCCCTGAAGG - Intergenic
1173480827 20:43397992-43398014 GGCTCCCAGATTCTCCCTGACGG + Intergenic
1176642292 21:9317429-9317451 GGACCACACAGGGTCCCTGACGG - Intergenic
1176878836 21:14167087-14167109 CGCCCACGGAGTCTCACTGATGG + Intronic
1179896448 21:44366196-44366218 GGCCCACTGAGTCCCCAGGACGG + Intronic
1180351303 22:11806784-11806806 GGACCACACAGGGTCCCTGACGG - Intergenic
1180386899 22:12185293-12185315 GGACCACACAGGGTCCCTGACGG + Intergenic
1180883765 22:19225082-19225104 GGCCCAAAGAGCCTCCCTCCTGG + Intronic
1181048495 22:20227743-20227765 GGCACACAAAGACTTCCTGAGGG + Intergenic
1181427209 22:22851432-22851454 AGCCCATAGAGTGTCCATGATGG - Intronic
1181860260 22:25812732-25812754 GGCCCTAAGAGCATCCCTGATGG + Intronic
1182320633 22:29476708-29476730 GGGCCACAGAGACTCACAGATGG + Intergenic
1182416291 22:30223425-30223447 GGCCCACAGTGTCCACCGGAAGG + Intergenic
1182712711 22:32332551-32332573 GCCCCTCAGAGACTCCCAGAAGG - Intergenic
1184116766 22:42426875-42426897 GCCTCACAGACCCTCCCTGAGGG + Intronic
1184839435 22:47043889-47043911 GGCACACAGAGCCTCCCACATGG - Intronic
1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG + Intergenic
1185193714 22:49454922-49454944 GGCCCCCAGGGTAGCCCTGATGG - Intronic
1185369366 22:50453896-50453918 GTCCCACAGAGACTCCGGGATGG + Intronic
950664593 3:14487658-14487680 GGGCCACAGAGATTTCCTGACGG + Exonic
953855425 3:46496076-46496098 GGCCCACAGAGGGTGCCTGGGGG - Intergenic
954278453 3:49558059-49558081 TGCCCACAGTGTCTCTCTTAGGG - Intronic
954302219 3:49706070-49706092 GGCCCACATAGTCTTGGTGAGGG + Intronic
954637453 3:52078957-52078979 GGCCCAGACAGACTCCCTGCAGG - Intronic
954970401 3:54646927-54646949 GGCAGAGAGACTCTCCCTGATGG + Intronic
956374383 3:68598569-68598591 GGCTCCCAGAGTTTCCCAGAAGG - Intergenic
957992509 3:87645104-87645126 CTCCCACTGAGTCTGCCTGATGG + Intergenic
961145059 3:124586445-124586467 CGCCCAGAGAGTTACCCTGAAGG - Intronic
964690482 3:159444190-159444212 GTCCCACACAGTCTCCCTGAGGG - Intronic
1202744597 3_GL000221v1_random:87589-87611 GGACCACACAGGGTCCCTGACGG + Intergenic
968923597 4:3535453-3535475 GGGCCACAGAGTGATCCTGAGGG + Intergenic
969470525 4:7385006-7385028 TGCCCGCAGAGCATCCCTGAAGG - Intronic
972176352 4:36411482-36411504 AGCCCACAGAGAACCCCTGATGG + Intergenic
972762643 4:42122006-42122028 GGCCCACCCAGCCTCCCTGAGGG - Intronic
973362113 4:49175573-49175595 CGCACACGGAGTCTCGCTGATGG - Intergenic
973831914 4:54770023-54770045 GGCCCACAGATTCCCTATGAAGG + Intergenic
974780354 4:66545442-66545464 TGCCCACGGAGTCTCGCTCATGG + Intergenic
978318530 4:107466986-107467008 GGCCCCCACAGTCACCTTGAGGG + Intergenic
979644548 4:123053215-123053237 GGCTCAGAGAGTCTCTGTGATGG - Intronic
981781603 4:148436826-148436848 GGCTACCACAGTCTCCCTGAAGG - Exonic
985591809 5:769677-769699 GGCCAACAAAGTGCCCCTGACGG + Intergenic
985609724 5:880636-880658 GGCCAACAAAGTGCCCCTGACGG + Intronic
985929667 5:3047163-3047185 CACCCACAGTGACTCCCTGAAGG - Intergenic
990060121 5:51637123-51637145 CGCCCACAGAGTCTCACTCATGG + Intergenic
990695003 5:58406423-58406445 GGCCCACTTAGTCTCACTAAAGG + Intergenic
994236454 5:97368969-97368991 GGACCACAGAGCCTCATTGAGGG - Intergenic
994492451 5:100463913-100463935 CGCCCACAGAGTCTCCCTGATGG - Intergenic
997282311 5:132656651-132656673 CTCCCACAGGGTCTCCGTGATGG - Intronic
997665953 5:135629615-135629637 CGCCCACAGAGTCAGCCTGCTGG - Intergenic
998986724 5:147766157-147766179 GGCCTACAGTGTCTCTTTGAGGG - Intronic
999354437 5:150911419-150911441 GGTCTGCAGACTCTCCCTGAAGG + Intergenic
999771604 5:154780224-154780246 GGCCCACTAAGTCTTCCAGAGGG + Intronic
1002520784 5:179792431-179792453 GCCCCACAGGGCCTGCCTGAAGG - Intronic
1005802505 6:29441010-29441032 GGATCAAAGAGTCTCCCTTAAGG + Intronic
1006801020 6:36759694-36759716 GGTCCACGGAGCCTCCCTGTGGG - Intronic
1007071625 6:39042288-39042310 GGCAGGCAGAGTCTCCCTCATGG + Intergenic
1007318829 6:41011596-41011618 AGCCCACAAGGCCTCCCTGAGGG + Intergenic
1009995420 6:70890311-70890333 CTGCCACAGAGTCTCCCTGTGGG + Intronic
1011655967 6:89552355-89552377 GACCCTCAGGGCCTCCCTGATGG + Intronic
1013630849 6:111984433-111984455 GGTCCACTGAGCATCCCTGAAGG + Intergenic
1014422945 6:121267496-121267518 AGCCCACAGAGCCTCCCTCACGG + Intronic
1016296369 6:142577367-142577389 TGCCCATGGAGTCTCCCTGATGG + Intergenic
1016927021 6:149361146-149361168 GCCCCACAGAGTCTCCATGGGGG - Intronic
1017838815 6:158204823-158204845 GCCCCACAGTGGCTCCCTCATGG - Intergenic
1018288071 6:162262582-162262604 GCCCCACAGAGTCTCCTGGGAGG + Exonic
1019365923 7:632785-632807 GGCCCACGGAATCCTCCTGATGG - Intronic
1019494616 7:1332013-1332035 GGCCCACAGGGTCTGCAGGAGGG + Intergenic
1020277187 7:6631859-6631881 GGCACACAGAGGCTCCGTGGGGG + Intergenic
1020697834 7:11437310-11437332 AGCTCACACAGGCTCCCTGAGGG - Intronic
1022645585 7:32226220-32226242 GGCCCACAGAGGCTGAGTGAGGG - Intronic
1023812004 7:43919007-43919029 GGCCAGCAGATTCTCCCAGAGGG + Intronic
1024190659 7:47004555-47004577 TGCCGATAGAGTCTTCCTGAGGG + Intergenic
1027382374 7:77624735-77624757 GGCCCACAGAGTCTCTTTTAAGG + Intronic
1035219351 7:157396642-157396664 GGTCCACAGAGTACCCCAGAGGG - Intronic
1036434596 8:8722185-8722207 TTCCCACAGATTCTCCCAGAAGG + Intergenic
1036752090 8:11449784-11449806 GGCCCACAGCGGCTCCTTGGAGG + Intronic
1037888049 8:22605233-22605255 GGCCCACACAGTCTCCTCGCCGG + Intronic
1037927977 8:22859570-22859592 GGCCCACAGAGTACCTGTGACGG + Intronic
1038032005 8:23650834-23650856 TGCCCACGGAGTCTCCCTGATGG - Intergenic
1043800132 8:84598394-84598416 GGTCTACAGAGTTTCCCTGGAGG - Intronic
1046097188 8:109575742-109575764 GGCACACAGTGGCTCTCTGAGGG - Exonic
1047215074 8:122869557-122869579 GGCCAACACAGGCTCCCTCAGGG + Intronic
1048104183 8:131389297-131389319 GGGCCACAGCATCTCCATGAGGG + Intergenic
1049362586 8:142219434-142219456 GGGCGACAGCCTCTCCCTGAGGG - Intronic
1049654427 8:143791523-143791545 GGCCCACAGAGCCCGGCTGAAGG + Intronic
1052530171 9:29673079-29673101 GGGCCACAGAAATTCCCTGAAGG + Intergenic
1053799308 9:41754477-41754499 GGGCCACAGAGTGATCCTGAGGG + Intergenic
1054187717 9:61966536-61966558 GGGCCACAGAGTGATCCTGAGGG + Intergenic
1054650799 9:67622045-67622067 GGGCCACAGAGTGATCCTGAGGG - Intergenic
1056489164 9:87087934-87087956 GGTCCACAGAGTGTCACAGATGG - Intergenic
1056730978 9:89166532-89166554 GGCTCACAGCCTCTCCCTGGAGG - Intronic
1057965504 9:99499104-99499126 CGCCCACGGAATCTCGCTGATGG + Intergenic
1057969956 9:99545308-99545330 GCACCACAGAGTCTCCATTAGGG - Intergenic
1058128286 9:101221460-101221482 GGCTCACAGGGACTCCCTGAAGG + Intronic
1058767157 9:108192639-108192661 GGACCACAGAGTGCCTCTGAAGG - Intergenic
1061396081 9:130343874-130343896 GGCCCAGGGAGTCCCCATGAGGG - Intronic
1203688787 Un_GL000214v1:22714-22736 GGACCACACAGGGTCCCTGATGG - Intergenic
1203713226 Un_KI270742v1:117538-117560 GGACCACACAGGGTCCCTGACGG + Intergenic
1203647488 Un_KI270751v1:81339-81361 GGACCACACAGGGTCCCTGATGG + Intergenic
1185822061 X:3215117-3215139 GGAGCACAGAGACTCCCTGTTGG - Intergenic
1186652612 X:11577352-11577374 GTCTCGCAGAGTCTCCCTGCAGG - Intronic
1189612559 X:42752798-42752820 GCCCCACAGAGTACCCCAGATGG + Intergenic
1189997403 X:46652053-46652075 GGCCCTCACAGTCTCTTTGAAGG - Intronic
1192081674 X:68053719-68053741 GGCCCCCAGATCCTCCCTGCCGG - Exonic
1194962874 X:100255845-100255867 CGCCCACGGAGTCTCGCTGATGG + Intergenic
1200058163 X:153472327-153472349 GGCCAACAGGTTCTCCATGAGGG - Intronic
1200218784 X:154380472-154380494 GTCACACAGAGTCTCCCCGGAGG - Intronic
1200702892 Y:6417268-6417290 CGACCACAGAGGCTGCCTGAAGG - Intergenic
1201031218 Y:9747429-9747451 CGACCACAGAGGCTGCCTGAAGG + Intergenic