ID: 1104556903

View in Genome Browser
Species Human (GRCh38)
Location 12:129808743-129808765
Sequence CAGAATGAACAAAGGCGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 393}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104556897_1104556903 11 Left 1104556897 12:129808709-129808731 CCTTTCAGCTCTGATAGGTCATA 0: 1
1: 0
2: 1
3: 11
4: 94
Right 1104556903 12:129808743-129808765 CAGAATGAACAAAGGCGGGAAGG 0: 1
1: 0
2: 4
3: 40
4: 393
1104556895_1104556903 29 Left 1104556895 12:129808691-129808713 CCAGATATTTAACAAACTCCTTT 0: 1
1: 1
2: 3
3: 31
4: 302
Right 1104556903 12:129808743-129808765 CAGAATGAACAAAGGCGGGAAGG 0: 1
1: 0
2: 4
3: 40
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104556903 Original CRISPR CAGAATGAACAAAGGCGGGA AGG Intronic
900274342 1:1814090-1814112 CAGAAAGAATAAAAGTGGGAAGG - Intronic
900587781 1:3441530-3441552 CAGGCTGAACAAAGATGGGAAGG - Intergenic
901882476 1:12202323-12202345 CAGCATGGGCAAAGGCGGGAGGG - Intronic
901938622 1:12645139-12645161 GAGAATGAAGGAAGGAGGGAAGG - Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902421871 1:16287131-16287153 CAGAGTGAACAAAGGAGAGGAGG - Intronic
903019697 1:20385465-20385487 ATGAATGAATAAAGGAGGGAAGG + Intergenic
903318934 1:22530069-22530091 CACATTGACCAAAGGAGGGAGGG + Exonic
905500099 1:38429449-38429471 CAGACTGTATAAAGGTGGGAAGG - Intergenic
905749064 1:40445844-40445866 CACACTGAACAAAGGAGGGAAGG - Intergenic
906732908 1:48098579-48098601 CAGTATGAGCAAAGGCGTGCAGG - Intergenic
906856282 1:49308723-49308745 CAGAATGAGAAAAGGCAGGGTGG + Intronic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907119885 1:51999126-51999148 CAGCATGAACAAAGGCCCAAAGG + Intergenic
907584561 1:55605603-55605625 CAGCATGAACAAAGGCTTCAAGG - Intergenic
907665543 1:56431189-56431211 AAGAAAGAAGAAAGGAGGGAGGG + Intergenic
908394798 1:63715743-63715765 GAGAATGAACAAAGGCTGCAAGG + Intergenic
908528876 1:65014357-65014379 GAAAAAGAACAAAGGAGGGAAGG + Intergenic
909374393 1:74923686-74923708 CAGAATGAAGAAAAGCAGGGTGG + Intergenic
910165868 1:84326746-84326768 GAGAATGAACAATGGCTGAAGGG - Intronic
910253301 1:85220794-85220816 CAGCATGAACAAAGGCAGAGAGG + Intergenic
911054164 1:93696567-93696589 CAGAATGGAGAAGGGCAGGATGG - Intronic
911362986 1:96902102-96902124 CACACGGAACAAAGGAGGGAAGG - Intergenic
912735598 1:112147020-112147042 AAGAAGGAAGAAAGGAGGGAAGG - Intergenic
913373174 1:118123187-118123209 CAGAAAGAATGAAGGAGGGAAGG - Intronic
914096301 1:144546901-144546923 CGGAAAGGACAAGGGCGGGAGGG - Intergenic
914302215 1:146387062-146387084 CGGAAAGGACAAGGGCGGGAGGG + Intergenic
915949569 1:160179654-160179676 CTGAATGAACAAATGAGTGAGGG - Intronic
917099265 1:171429319-171429341 CACACTGAACAAAGGAGGGAAGG - Intergenic
917327650 1:173849829-173849851 CATAATGAAAAAAAGGGGGAGGG - Intronic
918232378 1:182548050-182548072 CAGAATGGGTAAAGGAGGGAAGG + Intronic
920750871 1:208675546-208675568 AAGAATAAACAAAGGTGGGCAGG + Intergenic
920901198 1:210112050-210112072 CAGACTGTACAGAGGTGGGAAGG + Intronic
922297285 1:224262012-224262034 CAGAATAACCAAAGGTGGAATGG + Intronic
922395137 1:225191403-225191425 CAGAAAGCACAAAGGCCAGAAGG - Intronic
922438130 1:225626490-225626512 TAGAAGGCACAAAGGCAGGAGGG - Intronic
922710755 1:227829066-227829088 GAGAATGAAGAAAGGCAGGGTGG - Intronic
922964718 1:229679188-229679210 AAGAAAGAAGAAAGGAGGGAGGG - Intergenic
923247141 1:232143502-232143524 AAAAATCATCAAAGGCGGGAGGG + Intergenic
923312593 1:232749231-232749253 CACACGGAACAAAGGAGGGAAGG - Intergenic
923324250 1:232866929-232866951 AGGAATGAAAAAAGGAGGGAAGG - Intergenic
923896390 1:238275141-238275163 CACACGGAACAAAGGAGGGAAGG + Intergenic
924133456 1:240937228-240937250 CACACCGAACAAAGGAGGGAAGG - Intronic
1063084211 10:2800392-2800414 AAGAAGGAACAATGGCAGGAGGG + Intergenic
1064458968 10:15514874-15514896 CAGAATGAAGCAAGGCATGAGGG - Exonic
1064520635 10:16197205-16197227 GACACTGAACAAAGGAGGGAAGG - Intergenic
1064812895 10:19221862-19221884 AAGAAAGAAGAAAGGCAGGAAGG + Intronic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1067147035 10:43701505-43701527 CAGGAAGAACAAGGGCTGGACGG - Intergenic
1067232011 10:44418521-44418543 CAAAAAGAAGAAAGGAGGGAAGG + Intergenic
1067458608 10:46441074-46441096 CAGGATGAACACAGGAGGGCTGG + Intergenic
1067628588 10:47943562-47943584 CAGGATGAACACAGGAGGGCTGG - Intergenic
1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG + Intergenic
1068406605 10:56598211-56598233 CAGAAAGAAAAAAGGGGGGCGGG - Intergenic
1070627759 10:78063316-78063338 CAGCAAGAACAAAGGCGTGGAGG + Intergenic
1070858652 10:79630148-79630170 CAGCCTGGACAAAGGCTGGAAGG + Intergenic
1071710403 10:88043798-88043820 CAGAATGAACATAGATAGGAAGG - Intergenic
1072086326 10:92082960-92082982 CAGAATGTACAAAGGGTGAAGGG + Intronic
1072794880 10:98347095-98347117 CACACCGAACAAAGGAGGGAAGG + Intergenic
1073130522 10:101186000-101186022 CAGACTGTACAGAGGTGGGAAGG + Intergenic
1073422097 10:103432911-103432933 CAGCATGAATAAAGACAGGAAGG - Intronic
1074165891 10:110872762-110872784 CAGAGAAAACAAAGCCGGGAAGG + Intronic
1076619381 10:131777400-131777422 TACAATGAACAAAGGAGAGAAGG + Intergenic
1076669653 10:132112451-132112473 CCGAAAGAACAGAGGCGGGATGG - Intronic
1077231284 11:1459161-1459183 CAGAATGGAGAGAGGAGGGAGGG - Intronic
1078715544 11:13835959-13835981 CAGAATGAACAAAGCTGGTTAGG - Intergenic
1079117497 11:17649621-17649643 CAGAAGGAACACAGGCTGGCTGG + Intergenic
1079325334 11:19486329-19486351 CAGAAAGACCAAAGGCCTGAAGG - Intronic
1080719747 11:34837544-34837566 GAGAATGGAGAAAGGTGGGAAGG - Intergenic
1082906735 11:58315879-58315901 CAGATTAAACAAAGGCAGAAAGG + Intergenic
1082983028 11:59141709-59141731 AAGAAGGAAGAAAGGAGGGAGGG + Intergenic
1083254831 11:61489666-61489688 CAGCATGAGCAAAGGTGGGGAGG + Intronic
1085996940 11:81929239-81929261 AAAAATGAACAAAGGCGTCAAGG + Intergenic
1086089753 11:82993528-82993550 CAGAAGCCACAAAGGCTGGAGGG + Intronic
1086401393 11:86463558-86463580 CAGAATGGAGAAAGGCTGGCAGG + Intronic
1087166100 11:95004802-95004824 CAGAATGAATAAAGGAAGGAAGG - Intergenic
1088840649 11:113624794-113624816 CAACATGGACAAAGGCTGGAGGG - Intergenic
1090812977 11:130263535-130263557 CTGCATGAACAAAGGTGTGAAGG + Intronic
1091142804 11:133250481-133250503 AAGAATGAAGAAAGGGAGGAAGG + Intronic
1092895725 12:13008408-13008430 CAGACTGCACAAAGGAGAGAGGG - Intergenic
1095392634 12:41727082-41727104 CAAAAGGAACAAAAGTGGGATGG + Intergenic
1095638024 12:44454719-44454741 CAGACTGTACAGAGGTGGGAAGG - Intergenic
1096148214 12:49293581-49293603 CAGGACGCACAAAGGGGGGAGGG + Intronic
1096224312 12:49855396-49855418 AAGGATGAAAAAAGGAGGGAAGG - Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097037920 12:56136291-56136313 CAGAATGAACAAAGGTGGAAGGG + Intronic
1097592755 12:61591795-61591817 CAGACTGTACAGAGGTGGGAAGG - Intergenic
1097895031 12:64816809-64816831 AAGAAAGAAGAAAGGCAGGAAGG - Intronic
1099274516 12:80558090-80558112 AAGAAAGAAGAAAGGAGGGAGGG - Intronic
1100174291 12:92011904-92011926 AAGAATGAAAGAAGGCAGGAAGG + Intronic
1100273015 12:93044161-93044183 CAGAAGGGACAAAGGAGCGAGGG - Intergenic
1100609649 12:96180744-96180766 CAGAATGAAAAATGGGGGGTGGG + Intergenic
1101022373 12:100566251-100566273 CGGAATGAACTAAGACAGGATGG - Intergenic
1101200231 12:102427809-102427831 CAGATTGAACACAGGAGAGAGGG + Intronic
1101383482 12:104235152-104235174 CACACTGAACAAAGGAGGGAAGG + Intronic
1101414794 12:104499693-104499715 AAGAAGGAAAAAAGGCAGGAAGG + Intronic
1101575304 12:105991695-105991717 CAGCATGAACAAAGGCCAGGGGG + Intergenic
1102144986 12:110648330-110648352 CAAAAGGAAAAAAGGCAGGAAGG - Intronic
1102513308 12:113429993-113430015 AAGAATGAAGAAAGGAAGGAGGG - Intronic
1104464870 12:128982201-128982223 CAGCATGAAGAAGGGAGGGAGGG - Intronic
1104556903 12:129808743-129808765 CAGAATGAACAAAGGCGGGAAGG + Intronic
1107414271 13:40186917-40186939 AACAATGAATAAAGACGGGAGGG + Intergenic
1108729510 13:53219975-53219997 CAGAAAGAAGAAAGGGGTGATGG + Intergenic
1109175538 13:59150828-59150850 CAGCATGAACAAAGTCAAGAAGG + Intergenic
1109575266 13:64248528-64248550 CAGAATGAACAAAGGAATGAAGG - Intergenic
1113026400 13:105945829-105945851 CAGAGTGAACTAAGGTGGAAAGG - Intergenic
1115666318 14:35552798-35552820 CAAAAGGAAAAAAGGGGGGAAGG + Intronic
1116576368 14:46581314-46581336 CAAAATGCACAAAGGAAGGAAGG + Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1117047570 14:51828461-51828483 CAGGAGGAAAAAAGGAGGGAAGG + Intronic
1118535459 14:66758578-66758600 CAAAATGAAAAAAGGGGGTAAGG + Intronic
1119485025 14:74981451-74981473 CAGCATGAACCCAGGCGGGGAGG - Intergenic
1120750949 14:88197837-88197859 CAGAAGGAAGGAAGGAGGGAAGG + Intronic
1121174224 14:91878652-91878674 CAGCATGTGCAAAGGCGAGAAGG - Intronic
1121819719 14:96956590-96956612 GGGAAGGAACAAAGGAGGGAAGG - Intergenic
1121865808 14:97361446-97361468 CACAAGGCACAAAGGCGGCATGG + Intergenic
1121882073 14:97509702-97509724 GAGAAAGAACAGAGGCTGGAAGG - Intergenic
1122611884 14:102990136-102990158 CTCAATCAACAAAGGCGGAAGGG + Intronic
1122651277 14:103228495-103228517 CAGAAGGAACAAAGGAGGGGAGG + Intergenic
1123144017 14:106110561-106110583 TAAAATGAACAAAGGCAGCAAGG + Intergenic
1123970485 15:25503959-25503981 AAAAATGAAAAAAGGAGGGAAGG - Intergenic
1124167689 15:27342749-27342771 CAGTGTGAACCAAGGCGGGGAGG + Intronic
1125249597 15:37684627-37684649 AAGAATGAAAAAAGGTGGGGAGG + Intergenic
1125750255 15:42023036-42023058 CAGCATGAACACAGGCAGGGAGG + Intronic
1126851456 15:52799392-52799414 AAGAAAGAAAAAAGGAGGGAGGG - Intergenic
1127165935 15:56244540-56244562 CAGCATGAGCAAAGGCACGAAGG - Intronic
1128398374 15:67252668-67252690 AAGAAGGAAGAAAGGAGGGAAGG + Intronic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129673495 15:77620108-77620130 CAGAATGAACAGTGCCAGGATGG - Intronic
1129933094 15:79428404-79428426 AAGAATGAAGGAAGGAGGGAGGG - Intergenic
1130119290 15:81033366-81033388 AAGAAAGAACAAAAGAGGGAGGG + Intronic
1130193614 15:81759376-81759398 CAGAAAGGACAAAGTCAGGATGG + Intergenic
1130779141 15:87016684-87016706 GAGAATGAAGAAAAGCAGGATGG + Intronic
1131423509 15:92326710-92326732 AAGAATGAACAAAGGGGAAATGG - Intergenic
1131753831 15:95538977-95538999 CAGAAAGAAGAAAGGAAGGAAGG + Intergenic
1132400890 15:101504542-101504564 CAGGAAGAGCAAAGGCGAGAAGG + Intronic
1133666173 16:7970370-7970392 CAGAGGGAAGAAAGGAGGGAGGG - Intergenic
1133777298 16:8907028-8907050 CAAAATTAACAGAGGCAGGAAGG + Intronic
1134125780 16:11615072-11615094 ATGAATGAACAAAGGAAGGAAGG + Intronic
1134637052 16:15800433-15800455 AAGAAAGAAGAAAGGAGGGAAGG + Intronic
1134691126 16:16191660-16191682 GAGAAGGAAGAAAGGGGGGAGGG - Intronic
1137646401 16:50078607-50078629 AATAATGAACAAAGGCAGTAGGG + Intronic
1138195829 16:55051496-55051518 AAAAATGAAGAAAGGAGGGAAGG + Intergenic
1138442115 16:57041430-57041452 CCCACTGAACAGAGGCGGGAAGG - Intronic
1138832594 16:60393236-60393258 AGGAATAAACAAAGGCAGGATGG - Intergenic
1138901143 16:61272454-61272476 CAGGATGAACAAATGAGAGATGG + Intergenic
1139210050 16:65068085-65068107 GAGAAGAAAGAAAGGCGGGAAGG + Intronic
1140172912 16:72625964-72625986 CAGAAAGAAGAAAGGAAGGAAGG + Intergenic
1140186797 16:72780906-72780928 AAGAATGAAACAAGGAGGGAAGG + Intergenic
1141932487 16:87215383-87215405 AAGAAGGAAGAAAGGAGGGAAGG + Intronic
1142280963 16:89147315-89147337 CAGAGTGAGCAAGGGGGGGAGGG + Intronic
1142614006 17:1124702-1124724 CAGAGTGAACAGAGGAGGGCTGG + Intronic
1143259671 17:5588715-5588737 CACACTGAACAAAGGAGGGAAGG + Intronic
1144072670 17:11688742-11688764 CAGAGTGATCAATGGAGGGAGGG + Intronic
1144213002 17:13031168-13031190 CAGAAGGAAGGAAGGAGGGAAGG - Intergenic
1144562202 17:16330038-16330060 CAGAAGGAGCAAAAGCAGGAAGG + Intronic
1144670532 17:17130334-17130356 GAAAATGAAGAAAGGAGGGAAGG - Intronic
1144959130 17:19034960-19034982 CAGAATGAACCAAGGTGGTCAGG - Intronic
1144976029 17:19139564-19139586 CAGAATGAACCAAGGTGGTCAGG + Intronic
1146411720 17:32591575-32591597 CCCAGTGAAGAAAGGCGGGATGG - Intronic
1146645367 17:34573684-34573706 CAGCAGGAACAAAGGTGGGGAGG + Intergenic
1146994903 17:37311321-37311343 GAGGATGACCAAAGGAGGGAGGG - Intronic
1147507669 17:41035659-41035681 AAGAAAGAAGAAAGGAGGGAAGG - Intergenic
1147553995 17:41464750-41464772 CAGGATGAACACAGGTGGGGAGG - Intronic
1148099144 17:45077031-45077053 TAGGAAGAACAAAGGCAGGAAGG + Intronic
1148402826 17:47382451-47382473 CTGAATGGACAAAAGCTGGAAGG - Intronic
1150710529 17:67527407-67527429 TAGAATGAACATAGGCGGCCGGG + Intronic
1151184024 17:72350403-72350425 CAGAAAGAATAAAGCCAGGATGG - Intergenic
1151277978 17:73050358-73050380 CAGAATGACCAAAGCAGGAAGGG + Intronic
1151923424 17:77174856-77174878 CACACTGAACAAAGGAGGGAAGG + Intronic
1153460186 18:5324841-5324863 GAGAATGAAGAAAGGCGGGGTGG + Intergenic
1156701916 18:39835967-39835989 CGGAAAGAAGAAAGGAGGGAGGG - Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158986980 18:62827792-62827814 CAGACTGGACAAAGGCCAGAAGG - Intronic
1160013698 18:75125428-75125450 CAGAATGACCAAAGCAGGGCGGG - Intergenic
1160201057 18:76795733-76795755 CAGAAGGAAGGAAGGAGGGAGGG + Intronic
1160498624 18:79390438-79390460 TAGAATGTATAAAAGCGGGAAGG + Intergenic
1162246977 19:9409367-9409389 CACGATGAACAAAGAAGGGAAGG - Intergenic
1163240269 19:16058416-16058438 AAGAAAGAACAAAGGAAGGAAGG + Intergenic
1163878874 19:19900490-19900512 CACCCTGAACAAAGGAGGGAAGG - Intergenic
1163907492 19:20159912-20159934 CAGACTGTATAGAGGCGGGAAGG - Intergenic
1164916743 19:32058168-32058190 CAGAAGAAAGAAAGGAGGGAAGG - Intergenic
1165708902 19:37995673-37995695 CAGAATGAACAAAAGCGGGTTGG + Intronic
1166556422 19:43703081-43703103 GAGAAAGAGCAAAGGAGGGAGGG - Intergenic
1166810078 19:45509164-45509186 CAGAAGGAACAAACGCGGGAGGG - Intronic
1167381369 19:49140108-49140130 AGGAAGGAACAAAGGAGGGAAGG - Intronic
1167768113 19:51497556-51497578 CAGAAAGAACAAGGACGGAAGGG + Intronic
1168009060 19:53515457-53515479 CACAATGAACGAAGGATGGAGGG - Intergenic
1168588773 19:57615590-57615612 CACACTGAACAAAGGAGGGAAGG + Intronic
926164023 2:10506984-10507006 AAGAATGAACAAAGCTGGAAGGG + Intergenic
926824057 2:16884689-16884711 AAGAATGAAAAAAGGAAGGAAGG - Intergenic
927096507 2:19751327-19751349 CAGCATGAGCAAAGGCGAGGTGG + Intergenic
927675539 2:25103431-25103453 CAGAATGAATTAGGGCTGGAAGG - Intronic
928412355 2:31064890-31064912 CAGAATAAACAAAGATGAGAAGG + Intronic
928827311 2:35438221-35438243 CAGACTGTACAGAGGTGGGAAGG + Intergenic
932476273 2:72008298-72008320 CTGGATGAACACAGGCGAGAGGG + Intergenic
933250553 2:80024453-80024475 CAGCATGAGCAAAGGCATGAAGG + Intronic
933834415 2:86233778-86233800 CAGAAAGAAGAAAGCCTGGAGGG + Intronic
933971315 2:87472135-87472157 CAGAGGGAATAAAGGAGGGAGGG - Intergenic
934034340 2:88076591-88076613 CAGAATGAAGCAGGGAGGGAAGG + Intronic
934111724 2:88749714-88749736 CAGCATGAACAAAGGCCTCAGGG + Intronic
935431484 2:102980611-102980633 AAGAAAGAACAAAGGAGAGAGGG - Intergenic
935623425 2:105148140-105148162 AAGAAGGAACAAAGGAGAGATGG + Intergenic
936017605 2:108971571-108971593 CAGAATGAATGAAGGTGTGAGGG + Intronic
936322415 2:111478064-111478086 CAGAGGGAATAAAGGAGGGAGGG + Intergenic
936474011 2:112824051-112824073 CAGCATGAACAATGGGTGGAGGG - Intergenic
936521695 2:113215701-113215723 CGCAATGAAGAAAGGTGGGATGG - Intergenic
937169610 2:119852358-119852380 CACACTGAACAAAGGAAGGAAGG - Intronic
937683889 2:124674375-124674397 AAGAAAGAACAAAGGAGGGAGGG - Intronic
937750531 2:125471848-125471870 AAGAATGTAGAAAGGAGGGAGGG - Intergenic
939179111 2:138783365-138783387 CAGAATGAGCAAAGGCAGAGTGG + Intergenic
939289012 2:140169127-140169149 AAGAAAGAAAAAAGGAGGGAGGG + Intergenic
941539011 2:166759002-166759024 CAGAAGGAAGGAAGGAGGGAGGG + Intergenic
941628821 2:167861673-167861695 GAGACTAAACAAAGGTGGGATGG - Intergenic
944387833 2:199184307-199184329 CAGACTGTACAGAGGTGGGAAGG - Intergenic
944673074 2:202012257-202012279 CAGAAGGAAGAAAGGAAGGAAGG + Intergenic
944930121 2:204508743-204508765 CAGACTGAAAAAAGGAGGGGAGG + Intergenic
947391144 2:229640901-229640923 CAGAATGTCCAAAGGGGTGAGGG + Intronic
948435578 2:237951437-237951459 CAGAAAGAAGGAAGGAGGGAGGG + Intergenic
1169038045 20:2469892-2469914 CTGAAGGAACAAAGGCTGAAGGG - Intronic
1170606263 20:17877050-17877072 AAGAAAGAAGAAAGGAGGGAAGG + Intergenic
1170640769 20:18150689-18150711 CAGAGCGAACAAAGGACGGACGG - Intronic
1171851730 20:30313558-30313580 CAGCATGAGCAAAGGCTGCAAGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172974504 20:38895947-38895969 AAGAAAGAAGAAAGGAGGGAGGG - Intronic
1172983608 20:38964231-38964253 CAGCATGAACAAAGGCAGAATGG + Intronic
1173530651 20:43766869-43766891 CAGTATGAACAAAGACAGGGAGG - Intergenic
1173846499 20:46191930-46191952 CAGAGTGAAAGAAGGAGGGAGGG - Intronic
1174179126 20:48664015-48664037 CAGAATGAACAAAGACAGAAAGG + Intronic
1174941471 20:54933725-54933747 AAGAAGGAAGAAAGGAGGGAAGG + Intergenic
1175495145 20:59409205-59409227 CAGAATGAATCAAGGGAGGAAGG + Intergenic
1175605780 20:60311259-60311281 CTGAATGAAAGAAGGAGGGAGGG - Intergenic
1179239603 21:39578343-39578365 CACACTGAACAAAGGAGGAAAGG + Intronic
1179406974 21:41134476-41134498 CAGAATGAATATAAGGGGGATGG + Intergenic
1179656206 21:42846549-42846571 CAAAATGAAGAAAGACGGGCTGG + Intronic
1181304864 22:21909997-21910019 CAGCATCAACAAAGGCAGGATGG - Intergenic
1181793924 22:25290038-25290060 CAGTAGGAACAGAGGTGGGAGGG + Intergenic
1181833920 22:25586581-25586603 CAGTAGGAACAGAGGTGGGAGGG + Intronic
1181901718 22:26161493-26161515 CAGCATGAACAAATGTGGGTTGG + Intergenic
1182020510 22:27077580-27077602 GTGAATGAACTAAGGCTGGATGG + Intergenic
1182376252 22:29850539-29850561 CAGAAGGAAGAAGGGCAGGAGGG + Intergenic
1182797151 22:32999328-32999350 CAGAATGTACTAAGGCGGAAAGG + Intronic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1183123319 22:35749774-35749796 CAAAAAGAACAAGGGTGGGAAGG + Intronic
1183337024 22:37255649-37255671 AAGAAGGAAGAAAGGAGGGAAGG + Intergenic
1183337030 22:37255736-37255758 GAGAAGGAAGAAAGGAGGGAAGG + Intergenic
1184303779 22:43580364-43580386 GAGAATGAACAGAGGTGGGAGGG + Intronic
1184910022 22:47525559-47525581 CAGACTGAACACAGTGGGGATGG + Intergenic
949131572 3:508233-508255 CTGAATGCACAAAAGCTGGAAGG - Intergenic
949161404 3:887231-887253 AGGAAGGAAGAAAGGCGGGAAGG - Intergenic
949643245 3:6063916-6063938 CAGGAAGAACAAAGGTGGGATGG + Intergenic
949681435 3:6519106-6519128 CACACTGAACAAAGGAGGGAAGG - Intergenic
949736429 3:7177504-7177526 AAGAAGGAATAAAGGAGGGAAGG + Intronic
950261120 3:11544008-11544030 CAGACTGCACAAAGCAGGGAAGG - Intronic
952283616 3:31947018-31947040 CAGAAGAGACAAAGGCAGGAGGG + Intronic
953223262 3:40993185-40993207 AAGAATGAAGAAAGGAAGGAAGG - Intergenic
953647678 3:44770030-44770052 CAGAAGGAACAAAGGGGGATGGG - Intronic
955406803 3:58630793-58630815 CAGCATGAACAAGGCCTGGAAGG - Intergenic
956072200 3:65465566-65465588 CAGAAACAACAAAGGCCGAAAGG - Intronic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
956737725 3:72251220-72251242 CACAAGGAACAAAGGAAGGATGG + Intergenic
957603182 3:82365348-82365370 CAGAAAGAAAGAAGGAGGGAAGG + Intergenic
957732323 3:84155024-84155046 CAGAATGAACAACTGAGGGATGG + Intergenic
957979822 3:87494419-87494441 AAGAAGGAAGAAAGGAGGGAGGG + Intergenic
957988963 3:87607240-87607262 CACACCGAACAAAGGAGGGAAGG + Intergenic
958144877 3:89612052-89612074 AGGAATGAAGGAAGGCGGGAAGG - Intergenic
960706747 3:120489714-120489736 CCCACTGAACAAAGGAGGGAAGG - Intergenic
961386480 3:126525888-126525910 CAGAAGGAACAAAGCCCAGAAGG - Intronic
961721372 3:128898869-128898891 AGAAATGAAAAAAGGCGGGAGGG - Intronic
962205909 3:133433661-133433683 CAGAATGTATAGAGGTGGGAAGG - Intronic
962250041 3:133830490-133830512 CAGCATGAACAAAGGAAAGAAGG - Intronic
962895531 3:139710557-139710579 AGGAAAGAACAAAGGAGGGAAGG - Intergenic
964969497 3:162542217-162542239 AAGAATGAAGTAAGGAGGGAGGG - Intergenic
965351321 3:167614994-167615016 CAGAAGGAGGAAAGGCAGGATGG - Intronic
965700370 3:171454332-171454354 CAGAAAGAAGAAAGGCCGAACGG + Intronic
965834981 3:172841224-172841246 CAGAATTCAGAAAGGAGGGAAGG - Intergenic
966067254 3:175832887-175832909 CAGACTGTATAAAGGTGGGAAGG - Intergenic
966589785 3:181669500-181669522 AAGAAGGAAGAAAGGAGGGAGGG + Intergenic
967962312 3:194935579-194935601 CAGAATGAACAAGGACGGCCTGG + Intergenic
969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG + Intronic
969166407 4:5319608-5319630 CAGCATGAACAAAGGCTGAGAGG - Intronic
970564389 4:17317334-17317356 AAGAAGGAAGAAAGGAGGGAAGG + Intergenic
970989287 4:22193789-22193811 CAGAATGGGCAAAAGCTGGAAGG - Intergenic
972698164 4:41468250-41468272 CAGAAGGAAGAAAGGAGGGAGGG - Intronic
972765471 4:42149923-42149945 GACAATCAACAAAGGCTGGAAGG + Intronic
973213262 4:47639556-47639578 CTGAATGTACAAAGGCAGGCTGG + Intronic
973720560 4:53719698-53719720 CAACATGAACAAAGGCAGGGAGG - Intronic
973779079 4:54271678-54271700 AAGAGAGAACAAAGGAGGGAGGG - Intronic
974340175 4:60604198-60604220 GAGAATGAAGAAAAGCAGGATGG - Intergenic
974368816 4:60987557-60987579 TAGAATGAAGGAAGACGGGAAGG - Intergenic
974923183 4:68267446-68267468 AAGAATGAACAAAGGCAGCTTGG - Intergenic
975979362 4:80139201-80139223 CATAATGAAGAAAGGTGGGGTGG - Intergenic
977084588 4:92576844-92576866 CAGAATGAAAAAAAGCAGGGTGG - Intronic
977475284 4:97499716-97499738 GCAAATGAACAAAGGCTGGAAGG + Intronic
980159419 4:129141376-129141398 CAGAATGAACAAAGGCACAGAGG + Intergenic
980861789 4:138507785-138507807 CAGAAAGAGCAAAGGCATGAGGG + Intergenic
982018421 4:151178937-151178959 CACAATGAATAAAGCCTGGATGG - Intronic
982285479 4:153729227-153729249 CAGAATGAACATAAGGGGAACGG + Intronic
982464141 4:155709328-155709350 AAGAATTAACAAAGGAGGGTGGG - Intronic
984400509 4:179257809-179257831 CAAAATGAAACAAGGGGGGAAGG + Intergenic
984844542 4:184098471-184098493 CAGAAGGAAGAAAGGCAGGGTGG - Intronic
985844559 5:2334692-2334714 CAGAAAGAACAATGGAGGGGAGG - Intergenic
986368533 5:7058716-7058738 CAGACTGTATAGAGGCGGGAAGG + Intergenic
987282313 5:16424096-16424118 CAGACTGTACAGAGGTGGGAAGG - Intergenic
987379002 5:17266392-17266414 GAGAATGAAATAAGGAGGGAGGG - Intronic
987416197 5:17663995-17664017 GAGAATGAAGAAAAGCAGGATGG - Intergenic
987487802 5:18542689-18542711 CAGACTGTACAGAGGTGGGAAGG - Intergenic
987898246 5:23977547-23977569 CATACCGAACAAAGGAGGGAAGG - Intronic
988199521 5:28050793-28050815 CAGACTGTATAAAGGTGGGAAGG - Intergenic
989465747 5:41753446-41753468 CAGCATGAACAAAAGCTGAAAGG - Intronic
989605160 5:43237218-43237240 CAGAGAGAACAAAGGTGAGATGG + Intronic
990513462 5:56510578-56510600 CAGAATGAGCAAGGGGGGCAGGG - Intergenic
990822435 5:59857863-59857885 CAGAAGGAAGGAAGGTGGGAAGG + Intronic
992970525 5:82052106-82052128 CAGAATGATCAACTGCAGGAAGG - Intronic
993055623 5:82976037-82976059 CAGAATGAGCCAAGGCAGGCAGG + Intergenic
993256807 5:85601799-85601821 AAGAAGGAACAAAGGAAGGAAGG - Intergenic
994519576 5:100815440-100815462 AAGAAGGAAGAAAGGAGGGAAGG - Intronic
996202946 5:120698922-120698944 CAGACTGTACAGAGGTGGGAAGG + Intergenic
996510212 5:124308156-124308178 CAGACTGTACAAAGGTGGGAAGG - Intergenic
996759636 5:126974226-126974248 CAGAATGAAGAAAAGATGGATGG + Intronic
996785584 5:127233339-127233361 CAGAAGTAACAAAGGAGAGAAGG - Intergenic
997872178 5:137516060-137516082 CAGAATGAACAAAACAGGGAAGG + Intronic
998615929 5:143740564-143740586 GTGAAAGAAGAAAGGCGGGATGG - Intergenic
998804542 5:145905782-145905804 CTAAATGAACAAAGGCTGGGAGG + Intergenic
1000576574 5:162982411-162982433 CAGAAAGAACAAAGGAAGAAAGG + Intergenic
1001074327 5:168614392-168614414 CAGAATGAATAGGGGAGGGAAGG + Intergenic
1001183481 5:169543638-169543660 CATAATGAACAAAGAGGAGAAGG + Intergenic
1001919474 5:175588872-175588894 AAGAAAGAAGAAAGGCAGGAAGG + Intergenic
1002292062 5:178206741-178206763 CAGAAGGAGCACAGGCTGGATGG + Exonic
1004161919 6:13221740-13221762 TAGAATGAACAAAGGTGGCCGGG + Intronic
1005575586 6:27186398-27186420 CACAACGAACAAAAGCGGGAAGG - Intergenic
1005618856 6:27601700-27601722 TGGAAAGAAGAAAGGCGGGAGGG + Intergenic
1005752112 6:28893393-28893415 CAGAAGGAAGAAAGGAGAGAAGG + Intergenic
1005756395 6:28928306-28928328 AAGAATGATCCAAGGAGGGAGGG - Intergenic
1005871567 6:29977421-29977443 GAGAATGGAGAAAGGAGGGAAGG + Intergenic
1006033846 6:31197038-31197060 CAGAGTGGAGAAAGGAGGGAAGG - Intergenic
1006308804 6:33242600-33242622 AAGAAAGAAGAAAGGAGGGAGGG + Intergenic
1007428366 6:41761583-41761605 CTGAATGAACAACTGAGGGAAGG - Intergenic
1007438964 6:41841174-41841196 TAGTATGAACAAAGGTGAGAAGG - Intronic
1008884054 6:56412089-56412111 CAAAATGAAAAAAGGTGGGGGGG + Intergenic
1009395078 6:63190290-63190312 CAGAAGGAAGAAAGGGGAGATGG + Intergenic
1009486122 6:64224538-64224560 CAGAATGAACAAATACTTGAAGG - Intronic
1009628019 6:66161766-66161788 CACACTGAACAAAGGAGGGAAGG + Intergenic
1009629051 6:66170840-66170862 CTGAATGAGCAAAAGCTGGAAGG + Intergenic
1009745738 6:67812942-67812964 CACACTGAACAAAGGAGGGAAGG + Intergenic
1009854250 6:69240547-69240569 CAGAATGACTAAAGGTGAGAGGG + Intronic
1010804686 6:80221315-80221337 CAAAAACAACAAAGTCGGGAAGG - Intronic
1010939779 6:81902878-81902900 CAGAATGTACAAAGGTGTGGAGG + Intergenic
1012184515 6:96196415-96196437 AATAATAAACAAAGGAGGGACGG + Intronic
1012292092 6:97469256-97469278 AAGAAAGAAAAAAGGAGGGAAGG - Intergenic
1012802369 6:103847211-103847233 AAGAAGGAATAAAGGCAGGAGGG + Intergenic
1013978824 6:116105865-116105887 CAGAATGGACCAAGGATGGATGG + Intronic
1014197182 6:118574375-118574397 CACATTGAACAAAGGAGAGAAGG - Intronic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1014646681 6:123982470-123982492 CAGAATGAAGAAAGGTGACAAGG + Intronic
1014758363 6:125327052-125327074 CAGAAGGACCAGAGGGGGGAAGG - Intergenic
1015731968 6:136358171-136358193 AAGAATGAACAAAGGCAAGAGGG - Intronic
1017245692 6:152222187-152222209 CACACTGAACAAAGGAGAGAAGG - Intronic
1018080055 6:160251514-160251536 CAGAAGGAAAAAAGGAAGGAAGG - Intronic
1018451521 6:163912454-163912476 CAGAACTAACAAAGGTGAGAGGG + Intergenic
1019127938 6:169853701-169853723 CAGAATGCAAAAAGGGGAGAAGG - Intergenic
1020391721 7:7665671-7665693 CAGAGGGAACAAAGGAAGGAGGG - Intronic
1020434247 7:8145373-8145395 CAGAATGAACAAAGACAGGAAGG - Intronic
1021559682 7:21957460-21957482 CAGAAGGAAGAAAGACGGGGAGG + Intergenic
1022340728 7:29465052-29465074 CAGAAGGAAAAAAGGCAAGAAGG - Intronic
1023896708 7:44439767-44439789 TATAATGAACAAATGAGGGAAGG + Intronic
1023993837 7:45146639-45146661 CAGTATGAACGAAGGCAGGCCGG + Intergenic
1024019307 7:45350953-45350975 CAGTATCAACAAAGGCTGAATGG - Intergenic
1025215709 7:57054293-57054315 AAGAATGAACAAAGGCAGCTTGG - Intergenic
1025626454 7:63226717-63226739 CAGAATGAACAAAGGCAGCTTGG - Intergenic
1025655669 7:63516409-63516431 AAGAATGAACAAAGGCAGATTGG + Intergenic
1026296598 7:69058275-69058297 TAGAATGAATAAAGGAAGGAAGG + Intergenic
1026766098 7:73160801-73160823 CAGAAAGAACAAAGGCCTGAAGG - Intergenic
1026890877 7:73981501-73981523 AGGAAGGAACAAAGGAGGGAGGG + Intergenic
1027042573 7:74970497-74970519 CAGAAAGAACAAAGGCCTGAAGG - Intronic
1027081070 7:75231860-75231882 CAGAAAGAACAAAGGCCTGAAGG + Intergenic
1028017847 7:85737706-85737728 CACACTGAACAAAGGAGGGAAGG + Intergenic
1029084951 7:98004079-98004101 CAGAAGGAAGGAAGGGGGGAGGG - Intergenic
1029334816 7:99889616-99889638 CAGAAGGAAGAGAGGAGGGAAGG + Intronic
1030360221 7:108587815-108587837 CAGAATGAAGAAGGGTGTGATGG - Intergenic
1030495272 7:110290879-110290901 CAGAAAGAATAAAGGAGGGAAGG - Intergenic
1031526877 7:122833101-122833123 CAGACAGAACAAAGGCTGGAAGG - Intronic
1033360583 7:140636362-140636384 CAGAAGGAACAGAGGAGGGCTGG + Intronic
1033883710 7:145918161-145918183 AAGAAGGAACAAAGGAAGGAAGG + Intergenic
1037754927 8:21704468-21704490 CAGAATAAATAATGGAGGGAAGG + Intronic
1038899863 8:31830381-31830403 CAGAAGGAAAGAAGGAGGGAAGG - Intronic
1039061968 8:33579221-33579243 AAGAATGAAGAAAGGAAGGAAGG - Intergenic
1040629290 8:49191107-49191129 AAGAAAGAACAAAGGAAGGAAGG - Intergenic
1041155747 8:54985245-54985267 CAGAAGGAAGAAAGGAAGGAAGG + Intergenic
1041174905 8:55185842-55185864 CAGAATGATCAAAAGTGGTAGGG - Intronic
1042470616 8:69183381-69183403 CAGAATGAACAAAGGCCCACAGG + Intergenic
1042489277 8:69380196-69380218 AAGAATGAAGAAAGGCAGGGTGG + Intergenic
1043331133 8:79120174-79120196 CACACCGAACAAAGGAGGGAAGG - Intergenic
1043331703 8:79124513-79124535 CACACCGAACAAAGGAGGGAAGG - Intergenic
1043363281 8:79500163-79500185 GAGAATGAAGAAAAGCGGGGGGG - Intergenic
1043835777 8:85044123-85044145 GGGAATGAACTAAGGTGGGAAGG - Intergenic
1045320774 8:101080238-101080260 CAGAAGGGGCAAACGCGGGATGG + Intergenic
1045512454 8:102822841-102822863 GAGAATGAACAAATGAGAGAGGG - Intergenic
1046588409 8:116176076-116176098 AAGAAAGAAAAAAGGAGGGAAGG + Intergenic
1046885130 8:119358501-119358523 CAGAAGGAAGGAAGGAGGGAAGG - Intergenic
1047828538 8:128606053-128606075 AAGAAGGAAGAAAGGAGGGAAGG - Intergenic
1048176273 8:132155300-132155322 TAGAATGAAGAAAGGATGGATGG + Intronic
1048770580 8:137890552-137890574 CAGAGTGAACGCAGGTGGGATGG + Intergenic
1050681166 9:8113411-8113433 CAGGATGAGCAAAGGCAGAATGG + Intergenic
1050701327 9:8342941-8342963 TAGTATGAACAAAGGACGGATGG + Intronic
1050862422 9:10450724-10450746 CAGAAAGAACAAAGGCCAGCAGG - Intronic
1051624356 9:19084521-19084543 CAGAATTTACAAAAGAGGGAGGG + Intronic
1053366778 9:37528434-37528456 CAGCATGAGCAAAGGCAGCAGGG - Intronic
1054814609 9:69463050-69463072 CAGAATGAACACATTAGGGAGGG + Intronic
1057051924 9:91930473-91930495 CACACTGAACAAAGGAGAGAAGG - Intronic
1057752364 9:97803279-97803301 CAGAGAGAAGGAAGGCGGGAGGG + Intergenic
1058160239 9:101562662-101562684 CAAAATAAACAAAGCTGGGAGGG - Exonic
1059137822 9:111823831-111823853 AAGAAGGAAGAAAGGAGGGAGGG + Intergenic
1061236340 9:129344766-129344788 CAGAAAGAACAAGGGCTGGTGGG + Intergenic
1061829020 9:133278822-133278844 CACACTGAACAAAGGAGGGAAGG + Intergenic
1062006181 9:134239622-134239644 CAGTGGGAACACAGGCGGGATGG - Intergenic
1062312297 9:135945386-135945408 CTGAATGAACACAGGTGCGACGG + Intronic
1186707910 X:12162004-12162026 CAAAATGTACAAAGGCCGTATGG - Intronic
1187260365 X:17679847-17679869 CAGAATGAAGAAAGGGGGGGGGG + Intronic
1187747795 X:22428694-22428716 AAGGATGAAAAAAGGCAGGAAGG - Intergenic
1188522555 X:31055027-31055049 AAGAATGAAAAAAGCCAGGAAGG - Intergenic
1188560632 X:31464930-31464952 CAGAAGTTTCAAAGGCGGGATGG + Intronic
1190620288 X:52280785-52280807 CACACTGAACAAAGGAGGGAAGG + Intergenic
1191233682 X:58117361-58117383 CACACCGAACAAAGGAGGGAAGG - Intergenic
1191832576 X:65430853-65430875 GAGAATGAAGAAAAGCAGGATGG - Intronic
1192033479 X:67539873-67539895 CAGAATATGCAAAGGCAGGAAGG + Intergenic
1192292666 X:69814693-69814715 GAGAATGAAGAAAAGCAGGATGG + Intronic
1192744305 X:73923628-73923650 CAGAGTGCACAAAGAAGGGAGGG - Intergenic
1193209696 X:78791916-78791938 CTGAATGGGCAAAGGCTGGAAGG + Intergenic
1193245449 X:79223376-79223398 GAGAAGGAAGAAAGGAGGGAAGG + Intergenic
1194629366 X:96264766-96264788 CAGAAAGAACAAAGAAGTGATGG + Intergenic
1195001580 X:100647987-100648009 ATGAATGAACAAAGGCATGAAGG - Intronic
1195726424 X:107922158-107922180 CAGAATGGAGAAAGGCAGGAAGG - Intronic
1196235903 X:113279281-113279303 CAGAATAAAGAAAGGAAGGAAGG + Intergenic
1198332232 X:135632412-135632434 GAAAATGAACAAAGTCTGGAGGG + Intergenic
1198775038 X:140170618-140170640 GAGCATGAACAAAGACAGGAGGG + Intergenic
1199202672 X:145111252-145111274 CAGATGGAAAAAAGGCTGGATGG - Intergenic
1201586719 Y:15569208-15569230 CAGGCTGAACAAATGGGGGAAGG + Intergenic