ID: 1104557923

View in Genome Browser
Species Human (GRCh38)
Location 12:129818789-129818811
Sequence CTTTGGAAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104557909_1104557923 30 Left 1104557909 12:129818736-129818758 CCACTTAAAGTAGAACGTGCCGG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1104557923 12:129818789-129818811 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1104557917_1104557923 -8 Left 1104557917 12:129818774-129818796 CCTGTAATCCCAGCACTTTGGAA 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
Right 1104557923 12:129818789-129818811 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1104557915_1104557923 11 Left 1104557915 12:129818755-129818777 CCGGGGGTGGTAGCTCACACCTG 0: 8
1: 522
2: 11723
3: 50072
4: 131792
Right 1104557923 12:129818789-129818811 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104557923 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG Intronic
Too many off-targets to display for this crispr