ID: 1104558182

View in Genome Browser
Species Human (GRCh38)
Location 12:129821026-129821048
Sequence TTATATAGGAGAAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 1, 2: 0, 3: 49, 4: 482}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104558182_1104558187 -6 Left 1104558182 12:129821026-129821048 CCCTCCTCCTTTCTCCTATATAA 0: 1
1: 1
2: 0
3: 49
4: 482
Right 1104558187 12:129821043-129821065 ATATAAACCCATTTTAACAATGG 0: 1
1: 0
2: 3
3: 50
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104558182 Original CRISPR TTATATAGGAGAAAGGAGGA GGG (reversed) Intronic
900033298 1:386673-386695 TAATATACAAGAAAGAAGGAAGG - Intergenic
900054136 1:616562-616584 TAATATACAAGAAAGAAGGAAGG - Intergenic
903012547 1:20341936-20341958 TTATTTTGGAGTAAGGAGAAAGG - Intronic
904333145 1:29778907-29778929 TTGTGTAGGAGAAAGGATGGAGG + Intergenic
904357510 1:29950189-29950211 TTGTGAAGGAGAAAGAAGGAAGG - Intergenic
904972499 1:34430035-34430057 TTTAATAGGAGAAACCAGGAGGG + Intergenic
905800867 1:40841638-40841660 AAATATGGGAGAAAGGAGGAGGG + Intergenic
907575083 1:55519065-55519087 TTAGCTAAGAGAGAGGAGGAGGG + Intergenic
907675652 1:56515577-56515599 TTATGAATGAGAAAGGAGTAGGG + Intronic
907832419 1:58077709-58077731 TTTTCCAGGAGAAAGGAGAAAGG + Intronic
908288067 1:62630886-62630908 TTATATAAGAAAAAAGAGGCCGG + Intronic
908986448 1:70029364-70029386 TTAAAGAGGAAAAGGGAGGAGGG + Intronic
909733641 1:78929174-78929196 TTTTAGAAGAGTAAGGAGGAAGG - Intronic
910129443 1:83886265-83886287 TTAAGTAGCAGAAAGGAGAAAGG + Intronic
910452315 1:87359840-87359862 TTATATAGGAGGAAGTTGGAGGG + Intergenic
910924611 1:92385499-92385521 TTCTATATGAGAAATGAAGATGG + Intronic
911099105 1:94079967-94079989 TTCTATGGGGTAAAGGAGGATGG - Intronic
912827065 1:112915303-112915325 TTATCTAGGAGAAAGGAGATGGG + Intronic
913138128 1:115912511-115912533 TTAAATCGGAGGAGGGAGGAAGG - Intergenic
913363804 1:118013061-118013083 ACATATATGTGAAAGGAGGAGGG - Intronic
913389303 1:118292838-118292860 ATATATTGAAGAAAGGAAGAAGG - Intergenic
913462928 1:119107592-119107614 TTATATAGGAAACAGGTAGAAGG - Intronic
916315543 1:163444226-163444248 GAATATAGGAGCAAGGAGGAAGG - Intergenic
916912544 1:169366737-169366759 TTAGAAAGGAGAAATGAAGAGGG + Intronic
917625684 1:176843662-176843684 TGATATAGGGGAAAGGTGGGAGG + Exonic
917730549 1:177870674-177870696 TTCTATAGCAGAAAAGAAGAAGG + Intergenic
917745922 1:178007113-178007135 TTATATAGGAAGAAGAATGAAGG + Intergenic
917771946 1:178289013-178289035 TTATAAAGGAGAGAAGAGAAAGG - Intronic
918404730 1:184200497-184200519 TTATAGATGTGAATGGAGGATGG - Intergenic
918471511 1:184880486-184880508 TTAGAGAGGAGAGAGGAAGATGG - Intronic
918598625 1:186324794-186324816 ATAAATAGGAAAAAGAAGGAAGG + Intronic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919322787 1:196064508-196064530 ATGTATAGGAGAAAGCTGGAGGG - Intergenic
919605071 1:199671843-199671865 CTATACAAGAGAAAGGAAGAAGG + Intergenic
921148423 1:212380639-212380661 TAGTATAGGATAAAGGAGGGAGG - Intronic
921247909 1:213265105-213265127 TTCTTCAGGAGAAAGGAGGTTGG + Intronic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
922023953 1:221733299-221733321 GTGTATAGGAGAAAGGAGAAGGG - Intronic
922255657 1:223890827-223890849 TAATATACAAGAAAGAAGGAAGG - Intergenic
922447257 1:225707911-225707933 TGAAATAGGAAACAGGAGGAAGG + Intergenic
922710081 1:227822016-227822038 TTAGAAAGGAAAAAAGAGGAAGG - Intronic
924021128 1:239784539-239784561 TGATATAGGGGACAGGAGGGAGG - Intronic
924336853 1:242993692-242993714 TAATATACAAGAAAGAAGGAAGG - Intergenic
924531678 1:244899103-244899125 TTATAAGGGAGAAAGAAGGCTGG - Intergenic
924921180 1:248630918-248630940 TTACATGGGAGAGAGGAGGAAGG + Intergenic
1063006007 10:1971262-1971284 TTTTATAGTGGAGAGGAGGAGGG - Intergenic
1063796061 10:9515565-9515587 TTTTAAAGAAGAAAGAAGGAAGG + Intergenic
1064268726 10:13846858-13846880 TCATATAGGACAAACGGGGATGG + Intronic
1065172380 10:23044461-23044483 TCATAGAGCACAAAGGAGGAAGG + Intergenic
1066604262 10:37143838-37143860 TCATATAGAAGAAAGATGGAGGG + Intronic
1067093773 10:43285314-43285336 TTCTAGAAGAGAGAGGAGGAGGG - Intergenic
1067897417 10:50199274-50199296 TTATGTATGACAAAAGAGGATGG + Intronic
1067951555 10:50742765-50742787 TTATGTATGACAAAAGAGGATGG - Intronic
1068041243 10:51826731-51826753 GAACAAAGGAGAAAGGAGGAGGG + Intronic
1068392714 10:56419334-56419356 CTTTAAAGGAGAAAAGAGGAGGG - Intergenic
1068414684 10:56704275-56704297 TTAAATAGGACAAAGTAGTATGG - Intergenic
1068612274 10:59073356-59073378 TGATGTAGGAGACAGGGGGAAGG - Intergenic
1068736234 10:60416076-60416098 TTACATGGTAGAAAGGATGAGGG - Intronic
1069377843 10:67812189-67812211 TTATAAAGCAGGAAGGAGCACGG + Intronic
1070532527 10:77349593-77349615 TTATAGGGGAGAAAAGATGATGG - Intronic
1070858481 10:79629055-79629077 TTCTAAATGAGAAAAGAGGAAGG + Intergenic
1071012961 10:80960084-80960106 TTTTATGGGAGATAGAAGGAAGG + Intergenic
1072333592 10:94377387-94377409 TTAAAGAGGAGAAAGCAGGCTGG + Intergenic
1072960820 10:99927314-99927336 TTATAAAGGGGAAGGGAGGTGGG + Intronic
1073370193 10:102981376-102981398 TAATATAGGAAAAAAGAGGAAGG - Intronic
1073520601 10:104125368-104125390 CTATCTAGGAAAAAGTAGGATGG - Intronic
1073638300 10:105221897-105221919 TTAAAGAAGAGAAAGAAGGAGGG + Intronic
1073860572 10:107733384-107733406 CTATAGAGGACATAGGAGGAAGG + Intergenic
1074572661 10:114638508-114638530 TTATATGTGAGAAAAGAGGTTGG + Intronic
1074852489 10:117449847-117449869 CTAAACAGGAAAAAGGAGGAAGG + Intergenic
1074911971 10:117919714-117919736 ATATATAGGACAGAGGAAGATGG - Intergenic
1075125309 10:119694598-119694620 TTAAAAAGGAGGAAGGAGGCAGG - Intergenic
1077790721 11:5437035-5437057 TGGTATTGGGGAAAGGAGGAGGG + Intronic
1077816476 11:5690760-5690782 TTCTTCGGGAGAAAGGAGGAAGG - Intronic
1078447122 11:11412778-11412800 TGAGATAGGAGTAAGGAGGATGG - Intronic
1078483237 11:11698483-11698505 ATATAGAGGACAAAGGAGCATGG + Intergenic
1078769468 11:14334925-14334947 TGATGGAGGAGAAAGAAGGAAGG - Intronic
1079156658 11:17954300-17954322 TTAAATATAGGAAAGGAGGAAGG + Intronic
1080173791 11:29338163-29338185 TACTAAAGGAGAAAGGAAGAGGG + Intergenic
1080225817 11:29958925-29958947 AGATATAGGTGAAAGGAGGGAGG - Intergenic
1080858440 11:36132210-36132232 TTATAAAGGAGAGCGGAAGACGG + Intronic
1080951171 11:37034684-37034706 TTATAAAGAGGAAAGAAGGAGGG - Intergenic
1081487351 11:43541845-43541867 GTAAAAAGGAGAAAGGAGAAAGG + Intergenic
1083174704 11:60942286-60942308 CTACCTAGGAGAAAGGAGGGTGG - Intronic
1084694288 11:70744537-70744559 TTGGAAAGGAGCAAGGAGGAGGG - Intronic
1085825354 11:79841126-79841148 TCATTAAGGAGAACGGAGGAAGG - Intergenic
1086253122 11:84841239-84841261 TTTTATATAAGAAAGGAGAAGGG + Intronic
1087696628 11:101385040-101385062 TGATATAGGAGAATGAGGGAAGG - Intergenic
1088952995 11:114589374-114589396 TTATAGAGGAGAAAAGAGGCTGG - Intronic
1089008188 11:115110545-115110567 TTAGATAGGAGAAAGAAGCTGGG + Intergenic
1089638491 11:119831956-119831978 TCATATAGGATAAAGAAGCAAGG - Intergenic
1090957950 11:131530479-131530501 TTACAAAAGAGAAAGGAGGGTGG + Intronic
1091182637 11:133620581-133620603 CAGTAAAGGAGAAAGGAGGAAGG + Intergenic
1093028024 12:14262114-14262136 TGATATGGGAGAAAAGAGGAGGG + Intergenic
1093517978 12:20013449-20013471 TTATATTTGGGAGAGGAGGAAGG - Intergenic
1093679602 12:21986641-21986663 TTAAATAGGTGGAAGGAGGTTGG - Intergenic
1093887327 12:24477087-24477109 TTATATATGAGATATGAGTATGG - Intergenic
1094680103 12:32660245-32660267 TTATAAAGGAGAAAGGAAATTGG + Intergenic
1095266542 12:40165617-40165639 TAAAATAGAAGAAAAGAGGAGGG - Intergenic
1096077241 12:48813584-48813606 TTCCATAGGAGAAGGGAGGTGGG - Intergenic
1096427332 12:51515255-51515277 GAATATAGGAGAAAGGAAGGAGG - Exonic
1096759955 12:53832959-53832981 TTCAATGGGAGAAATGAGGAAGG - Intergenic
1098340449 12:69445365-69445387 TTATGCAGGAGAGAGGAGAAGGG - Intergenic
1098351615 12:69568016-69568038 CAATATATGAAAAAGGAGGAGGG - Intronic
1098367133 12:69715893-69715915 TTAAATAGTACAAAGGAGGATGG + Intergenic
1098427657 12:70383754-70383776 TTTTATAAGAGAAAGAAGAAAGG - Intronic
1098802303 12:74976465-74976487 GGAGAAAGGAGAAAGGAGGAAGG + Intergenic
1099744602 12:86686374-86686396 TTGAATAGGAGTAAGGAAGAGGG + Intronic
1099943311 12:89216292-89216314 ATATATAGGAGCACAGAGGATGG - Intergenic
1100043336 12:90346890-90346912 TTATATAGGAGAAAGGAAAGTGG + Intergenic
1100431618 12:94535997-94536019 CTCTCTAAGAGAAAGGAGGATGG + Intergenic
1103186866 12:118965834-118965856 TTATAAATAAGAAAGGAAGATGG - Intergenic
1103941431 12:124503374-124503396 GGATGGAGGAGAAAGGAGGAAGG + Intronic
1104558182 12:129821026-129821048 TTATATAGGAGAAAGGAGGAGGG - Intronic
1105655034 13:22427387-22427409 ATATATGGGAGAAAGGATAATGG + Intergenic
1108304028 13:49113060-49113082 AGAAATAGGAGAAAGGGGGAGGG - Intronic
1109010186 13:56930629-56930651 AAATATAGGAGAAGGGAGGAGGG + Intergenic
1109287549 13:60428173-60428195 TTTTATAGGAGAGAGGCAGAGGG - Intronic
1109365628 13:61352493-61352515 TTATGTAAGAAAAAGAAGGAAGG - Intergenic
1109877537 13:68426147-68426169 TTATATATGACAAATAAGGAAGG + Intergenic
1110017947 13:70432703-70432725 TTTTACAGGAGAAAGGAGTGGGG - Intergenic
1110465947 13:75801983-75802005 TTATAATAGAGAAAGGAGGGAGG - Intronic
1110486614 13:76051955-76051977 GTGTAGAGGAGAAAAGAGGATGG - Intergenic
1110579498 13:77104412-77104434 ATATTTAGGAGAAAGGAGAGAGG + Intronic
1110642068 13:77836567-77836589 ATATGTAGATGAAAGGAGGAGGG + Intergenic
1110944550 13:81396310-81396332 TTAGATATGGGCAAGGAGGAGGG + Intergenic
1111382068 13:87469515-87469537 TAACATGGGAGACAGGAGGAAGG + Intergenic
1111739871 13:92190561-92190583 TGATACAAGAGATAGGAGGAAGG + Intronic
1112142169 13:96656667-96656689 TTCTGTAGTAGAATGGAGGAAGG + Intronic
1112486924 13:99828195-99828217 CTATAGAGGGGAAAGGAGGCAGG + Intronic
1112895049 13:104288574-104288596 CTATCTAGGATAAGGGAGGATGG + Intergenic
1113360512 13:109626772-109626794 TTCTTGAGGGGAAAGGAGGACGG - Intergenic
1114741524 14:25103278-25103300 ATATATATAAGGAAGGAGGAAGG + Intergenic
1115129726 14:30040756-30040778 TAATAAAGGAAAAAGGTGGAAGG - Intronic
1115259160 14:31435685-31435707 TTATCTTGGAGAGAGGATGATGG - Intronic
1115460511 14:33654921-33654943 TAAAATGGGAGAAAGGAGGAAGG + Intronic
1115507918 14:34110436-34110458 TTCTGGAAGAGAAAGGAGGAGGG - Intronic
1116258603 14:42590309-42590331 TTGTGTGGGAGAAAGGTGGAAGG - Intergenic
1116662569 14:47730144-47730166 TTATAAAGGAAAAAGAAGGAAGG - Intergenic
1117334016 14:54741428-54741450 TTATATGGGAGGAAAGAGCAGGG + Intronic
1117470119 14:56036149-56036171 TTATAAATGAGAAAGCAAGAAGG + Intergenic
1117685183 14:58245502-58245524 TTGTATAGGAAAAACGAGAAAGG - Intronic
1118406987 14:65434602-65434624 TTACATAGGAGAGAGAAGCAGGG + Intronic
1118609754 14:67531073-67531095 TGACAAAGGAGAATGGAGGATGG - Intronic
1119578798 14:75755485-75755507 TAATCTAGGATAGAGGAGGAAGG - Intronic
1120017622 14:79492004-79492026 TCATCTACGAGAAAGCAGGAAGG - Intronic
1120293989 14:82615436-82615458 TTAAATAGGAGAAAATAGTATGG - Intergenic
1120673052 14:87386599-87386621 TTATCTAGGAGGAAAGAGGAAGG + Intergenic
1120974021 14:90233255-90233277 TGATAAAGGAAAAAGGAGGTAGG - Intergenic
1120999991 14:90444662-90444684 ACAGAAAGGAGAAAGGAGGAGGG - Intergenic
1121780459 14:96618840-96618862 ATAGACAGGAGGAAGGAGGAGGG - Intergenic
1121880494 14:97496454-97496476 AAAAATGGGAGAAAGGAGGAAGG + Intergenic
1122096750 14:99378013-99378035 TTAAAGAGGAGAGAGGACGATGG + Intergenic
1122206024 14:100148440-100148462 TTCTGAATGAGAAAGGAGGAAGG - Intronic
1122384360 14:101333844-101333866 TTAAATTGAAAAAAGGAGGAGGG + Intergenic
1122667444 14:103341875-103341897 TTATTTGGGAGAAACAAGGAAGG + Exonic
1126484860 15:49169090-49169112 GTATACAGGAGGAAGGGGGAAGG - Intronic
1126548717 15:49903519-49903541 CTATAAAGAAGAAAAGAGGATGG + Intronic
1127145234 15:56016449-56016471 TTATATAGGAGCAATTGGGAAGG + Intergenic
1127203640 15:56687993-56688015 TTATATAAGGAAAAGAAGGAAGG - Intronic
1127264592 15:57351294-57351316 GTATATAGATCAAAGGAGGAAGG + Intergenic
1127965804 15:63922019-63922041 GTATATGGGAGAAAGTAGTAAGG - Intronic
1128327981 15:66737520-66737542 TTGAATTGGAGGAAGGAGGAAGG + Intronic
1128351951 15:66896844-66896866 CTAGGTAGGAGAAAGGAGGAGGG + Intergenic
1130101551 15:80898455-80898477 TTAAAGATGGGAAAGGAGGAAGG + Intronic
1130345434 15:83040223-83040245 TTAAAAAGGGGAAAAGAGGAAGG + Intronic
1130540079 15:84816242-84816264 GAAAATAGGAGAAAGAAGGATGG + Intergenic
1131571018 15:93536109-93536131 AGATAAAGGAGAAAGCAGGAAGG - Intergenic
1133619220 16:7510278-7510300 TTATGGAGGAGAAAGGAAGCAGG + Intronic
1134230016 16:12421713-12421735 TGATTGAGGAGGAAGGAGGAGGG - Intronic
1134419620 16:14073111-14073133 TAATGTAGGAGAAAGTAGCAAGG - Intronic
1134637389 16:15802852-15802874 ATTTATAAGAGAAAGGAGGCCGG + Intronic
1134781215 16:16897245-16897267 TTAGATAGGAGAAATGAGTCTGG - Intergenic
1135046148 16:19157573-19157595 TTCCATAAGAGAAAGGAAGATGG + Intronic
1135327470 16:21536075-21536097 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1136014676 16:27388462-27388484 TTAGGCAGGAGAAAGGAGGAAGG + Intergenic
1136337822 16:29622095-29622117 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1139308750 16:66010577-66010599 TTATCTAGGAGGAAGGTGGAGGG - Intergenic
1140608352 16:76567946-76567968 TTTTTTAGGAGAAAGAGGGAAGG - Intronic
1141787019 16:86207855-86207877 TTATAAAGGAAAATGCAGGAAGG - Intergenic
1142040574 16:87891169-87891191 TTAGATAAGAAAAAGGAGGCCGG + Intronic
1144038546 17:11388358-11388380 CTCTATAGGTGAAGGGAGGATGG + Intronic
1144721153 17:17470726-17470748 TTAAAGAAGGGAAAGGAGGAGGG + Intergenic
1146658748 17:34650628-34650650 TGATGCAGGAGAAAGGTGGAAGG + Intergenic
1147531552 17:41283258-41283280 TTATACAGTAGAAGTGAGGAAGG + Intergenic
1147592117 17:41690335-41690357 TTTTATAGGAAAAAGCAGAAGGG + Intronic
1149223341 17:54440196-54440218 TTTTATAGGAGAAACTAGAAGGG - Intergenic
1149628008 17:58093680-58093702 GTAGAGAGGAGTAAGGAGGAGGG - Exonic
1150918092 17:69456717-69456739 TTAACTAGGATGAAGGAGGAAGG - Intronic
1150965810 17:69967169-69967191 TTATATAGGAGCACAGAAGAGGG + Intergenic
1151057918 17:71055435-71055457 TTAGAGAAGAGAAAGGAAGAAGG - Intergenic
1151118898 17:71770303-71770325 TTTAGTAGGAGAAAGGAGGGAGG + Intergenic
1151516585 17:74600062-74600084 TTACATATAAGAAAGCAGGAAGG + Intergenic
1152260452 17:79263930-79263952 CTTTATAAGAGAAAGGAGGGAGG + Intronic
1153046740 18:862734-862756 TCCTTTAGGAGAAAAGAGGAAGG - Intergenic
1155755714 18:29493003-29493025 TTACATAGCAGAAGGCAGGAGGG + Intergenic
1156297842 18:35808916-35808938 TTAAATAGGGGAGAGGAGAAAGG + Intergenic
1156495906 18:37525007-37525029 TAACAAAGGAGAAGGGAGGAGGG - Intronic
1156724485 18:40111696-40111718 AAAGATAGGAAAAAGGAGGAGGG - Intergenic
1157019891 18:43768078-43768100 TTAAATAGGAGTAATGAGAAAGG + Intergenic
1157628995 18:49078455-49078477 GTATATAGGAGAGGAGAGGAGGG - Intronic
1157645902 18:49270901-49270923 TTCTATAGGAGAAGGGGGCAGGG - Intronic
1158641570 18:59208094-59208116 ATATGTTGGAGAAAGGAGGAAGG + Intergenic
1158785164 18:60702975-60702997 TTTTATAACAGAAAGAAGGATGG - Intergenic
1159068196 18:63592833-63592855 TTCTTTAGGAGAAACAAGGAAGG - Exonic
1161881185 19:6954206-6954228 TTAGAAACGAGAGAGGAGGAAGG + Intergenic
1162131358 19:8527921-8527943 TTATATAAGAAACAGAAGGAGGG + Intronic
1162655087 19:12122822-12122844 TGAGATAGGAGAAAGGGAGAAGG + Intronic
1163268303 19:16234394-16234416 TAATCTAGGAGACAGGAGGGAGG - Exonic
1165074035 19:33270810-33270832 TTATCCAGGAGGAAGGAGCAGGG - Intergenic
1165868543 19:38954023-38954045 TTGTCTAGAAGACAGGAGGAAGG + Intronic
1167932472 19:52877395-52877417 TTATATGTGAGCAGGGAGGAGGG + Exonic
1168542433 19:57224321-57224343 TTGGTTAGGAGACAGGAGGAAGG - Intergenic
1168673543 19:58259677-58259699 TCCTATAGGAGAAAGGCAGAGGG - Intronic
925224720 2:2173019-2173041 TTAAGTAAGAGAAGGGAGGAGGG + Intronic
925518506 2:4712134-4712156 TTATATAGTTGAAATGATGAAGG - Intergenic
926330590 2:11822128-11822150 TTATACAGGAGAAAGGATTTAGG + Intronic
926582458 2:14646083-14646105 TTCTATAAGAAAAAGGTGGAGGG - Intronic
926778739 2:16447756-16447778 TTATATTGAAGAAGGAAGGAAGG + Intergenic
926988203 2:18647236-18647258 TTATGTAGGAGGTAGGAGGAAGG - Intergenic
927641715 2:24849738-24849760 TGACAGAGGGGAAAGGAGGAGGG + Intronic
927985220 2:27405409-27405431 TTTTCATGGAGAAAGGAGGAAGG + Intronic
928029626 2:27767482-27767504 TTTTGAAGAAGAAAGGAGGAGGG - Intergenic
928478576 2:31656589-31656611 TCATATAGCAGAATGGTGGAAGG - Intergenic
928574244 2:32638676-32638698 TTCAATAGAAGAAAGAAGGAGGG - Intronic
928875058 2:36028406-36028428 TTCTTTGGGAGAAAGGATGATGG - Intergenic
931760694 2:65414261-65414283 CCAAATAGGGGAAAGGAGGAAGG + Intronic
932851684 2:75193763-75193785 TTCCATAGGAGACAAGAGGAGGG - Intronic
934122359 2:88852681-88852703 TTATTTTGGAGAAAAGAGAAAGG - Intergenic
934637460 2:96003537-96003559 TGATATAAGAGATAGGAGGCAGG - Intergenic
934796192 2:97101868-97101890 TGATATAAGAGATAGGAGGCAGG + Intergenic
935220827 2:101011091-101011113 CTATGTAGGAGAGAGGAGCAAGG + Intronic
935509067 2:103948797-103948819 ATATAGAGGAGATAGAAGGAAGG - Intergenic
937110584 2:119364064-119364086 AGAGATAGGAGAAAGGGGGAGGG + Intronic
937717916 2:125056054-125056076 TTATAATGGAGAATGAAGGAAGG - Intergenic
938125054 2:128665242-128665264 TCCTATAGGAGAAAGGAAGAGGG - Intergenic
938782146 2:134594188-134594210 TTATAAAACAGAAAGGAGGATGG + Intronic
939001208 2:136737430-136737452 ATTTTTAGGAGAAAAGAGGAAGG + Intergenic
939346626 2:140974595-140974617 TTAGAAGGGAGAAAGGAAGAAGG + Intronic
939569559 2:143824593-143824615 TTATAAATGAGCAAGGGGGAAGG + Intergenic
940500727 2:154490188-154490210 CTTTGTAGCAGAAAGGAGGAGGG - Intergenic
941238300 2:163003447-163003469 TCATAAAGGTTAAAGGAGGAAGG + Intergenic
941535774 2:166721134-166721156 TGGTGTAGGAAAAAGGAGGAGGG - Intergenic
942111661 2:172688602-172688624 CTATAAAGGATAAAGGAGGAGGG + Intergenic
944130600 2:196343938-196343960 TTATGTGGGAGAAAGAAGGCTGG + Intronic
944359178 2:198831786-198831808 TTAGGAAGGAGAAAGGAGAAGGG + Intergenic
944699481 2:202233943-202233965 TCAAATATCAGAAAGGAGGAAGG + Intronic
944827515 2:203500280-203500302 ATATGTAAGAGAAAGGAGAAGGG + Intronic
945335657 2:208589826-208589848 TTGGATAAGAGAAAAGAGGACGG + Intronic
945544040 2:211126773-211126795 AGAGAGAGGAGAAAGGAGGAAGG - Intergenic
945695591 2:213099207-213099229 CTTTATAAAAGAAAGGAGGATGG - Intronic
946100518 2:217316360-217316382 TTAGACATGAGAAAGCAGGAAGG + Intronic
946115162 2:217455076-217455098 TTTCATAGGAGACAGGAGGTGGG + Intronic
946336870 2:219043491-219043513 GGATGTAGGAGAAGGGAGGAAGG + Intergenic
946452865 2:219795887-219795909 TTAGATAGTACACAGGAGGAAGG + Intergenic
946906356 2:224420272-224420294 TTATGCAGGATAAAGGAGGGAGG - Intergenic
947044710 2:225968587-225968609 GTATAGTGGAGATAGGAGGAAGG - Intergenic
948740817 2:240044628-240044650 TTATTTAGGAAAAAGGCAGAGGG + Intergenic
1169515137 20:6308648-6308670 TTATAGAGTAGAAAGTAGAATGG - Intergenic
1169727900 20:8755815-8755837 TTGTAAAGGATAAATGAGGAGGG + Intronic
1170318182 20:15065357-15065379 TTATATTAGAGAAAGTAGGCAGG + Intronic
1171173922 20:23037069-23037091 TTGTACAGGAGAGAGGAGGAAGG + Intergenic
1171866445 20:30489644-30489666 TTGCCTAGGAGAAAGGAGGCTGG - Intergenic
1171908667 20:30921676-30921698 TTGCCTAGGAGAAAGGAGGCTGG + Intergenic
1173263113 20:41453824-41453846 ATTTATAGGAGAAAAGAGGGTGG + Intronic
1173655342 20:44696626-44696648 TTAGATGGGAGGAAGGAGGGAGG - Intergenic
1175499122 20:59437082-59437104 TTCTACAGGAGGAAGGAGGCAGG - Intergenic
1176175726 20:63723091-63723113 TGTCATAGGAGAAGGGAGGATGG - Intronic
1176175736 20:63723147-63723169 TGTCATAGGAGAAGGGAGGATGG - Intronic
1176175746 20:63723203-63723225 TGACACAGGAGAAGGGAGGATGG - Intronic
1176175762 20:63723287-63723309 TGTCATAGGAGAAGGGAGGATGG - Intronic
1176175767 20:63723315-63723337 TGTCATAGGAGAAGGGAGGATGG - Intronic
1176175772 20:63723343-63723365 TGTCATAGGAGAAGGGAGGATGG - Intronic
1176175777 20:63723371-63723393 TGTCATAGGAGAAGGGAGGATGG - Intronic
1176175782 20:63723399-63723421 TGTCATAGGAGAAGGGAGGATGG - Intronic
1176238272 20:64064196-64064218 TTATATAAGAGCCAGGAGGTCGG + Intronic
1176691949 21:9923470-9923492 TTATAAATGACAATGGAGGATGG - Intergenic
1178304263 21:31477788-31477810 TCATTTAGGAGGAAAGAGGAAGG + Intronic
1179327437 21:40361901-40361923 ATACATGGGAGAAAGGAGGAGGG - Intronic
1180342102 22:11627855-11627877 TTGTCTAGGAGAAAGGAGGCTGG + Intergenic
1181686297 22:24531282-24531304 TTTTATTGAGGAAAGGAGGAGGG + Intergenic
1181970699 22:26687583-26687605 TGAGAGAGGAGAAAGGATGAGGG + Intergenic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1183448910 22:37879647-37879669 TGAGATTGGAGAAAGGGGGATGG + Intronic
949310291 3:2689760-2689782 GTGTATAGGAGAGAGGAGGTGGG - Intronic
950009497 3:9712803-9712825 TTCTACAGGAGCAATGAGGATGG + Exonic
950170285 3:10834381-10834403 TTTCATAGGAAAAGGGAGGAAGG + Intronic
950755880 3:15172050-15172072 ATATATAGGAGAAAGGAGGAGGG - Intergenic
951114632 3:18845583-18845605 TAATATAAAGGAAAGGAGGAAGG - Intergenic
951375455 3:21909683-21909705 TTACAGAGGAGAAAGAAGAATGG + Intronic
951596652 3:24325964-24325986 TTAAAGAGGAGAAAGGGAGAGGG - Intronic
951927764 3:27927313-27927335 ACAGATTGGAGAAAGGAGGATGG - Intergenic
952136393 3:30426959-30426981 TTAAATATGAGAAAAGAGGCAGG - Intergenic
953483755 3:43275099-43275121 ATAGAAAGGAGAAAAGAGGAGGG - Intergenic
953503060 3:43456667-43456689 TTAAATAAGTGAAAGGTGGAAGG + Intronic
954508842 3:51104053-51104075 TTTGATAGGATAAATGAGGAGGG + Intronic
954967633 3:54625326-54625348 GTATATAGCAGAAAGAAGAAGGG + Intronic
955361026 3:58275087-58275109 TTTTATAGCAGAAATGAAGATGG + Intronic
957146122 3:76426004-76426026 TTTTATATAAGAAAGGATGAAGG + Intronic
957494358 3:80971799-80971821 TTATGTATGAGAAAAGAGTAAGG + Intergenic
958614598 3:96475561-96475583 TTGTATTTGAGAAAGGATGAAGG + Intergenic
958798900 3:98733570-98733592 CAGTTTAGGAGAAAGGAGGACGG + Intronic
959204851 3:103293384-103293406 TTATTAAGGAAAAAGGAGGAGGG - Intergenic
959702753 3:109313738-109313760 TTAAATAGGAGACAGGAGTGTGG - Intronic
959776562 3:110171392-110171414 CTATAAAGAATAAAGGAGGAAGG - Intergenic
959800576 3:110489888-110489910 TTTTCTAGGAGAAAGAAGAAAGG - Intergenic
960781506 3:121323480-121323502 TAATACAGGAGAAAAGAGCAGGG + Intronic
960817079 3:121684852-121684874 TAATATAGGAGAAAGGTAAAGGG + Intronic
960833001 3:121870361-121870383 TTATTTAGGAGTATGGATGAGGG + Intronic
961695580 3:128701823-128701845 ATATATAAGACAAAGGAGGTGGG + Intergenic
963100037 3:141592614-141592636 TTCTAGAGGAGAAAAGAGAATGG + Intronic
963121839 3:141783091-141783113 CCAGGTAGGAGAAAGGAGGAAGG + Intronic
963652467 3:147998762-147998784 TTATCTGGGGGAAAGGAGGAGGG - Intergenic
963985136 3:151584497-151584519 TTATAAAAGAGAAAGCAAGAGGG - Intergenic
964603064 3:158524696-158524718 TTATATAGAACAATGGAGCAGGG + Intronic
965834929 3:172840988-172841010 CAAAACAGGAGAAAGGAGGAAGG - Intergenic
966058882 3:175731832-175731854 TTAAAAAAGAAAAAGGAGGAGGG - Intronic
966178424 3:177165021-177165043 TTAGATACGAGAAAGAAGGAAGG - Intronic
966369650 3:179235547-179235569 TTATAAAAGAGAATGGAAGACGG - Exonic
966692680 3:182758021-182758043 TTATATGGAAGGAAGGAAGAAGG + Intergenic
967314237 3:188136274-188136296 ATATATAGGAAACTGGAGGAGGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967733641 3:192930262-192930284 TTATAAAGCAGAAATTAGGAGGG - Intergenic
968888064 4:3346600-3346622 TTCTATGGGAGAAAGTTGGATGG + Intronic
969071548 4:4543528-4543550 ATATTTACCAGAAAGGAGGAAGG + Intergenic
969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG + Intronic
969840473 4:9877989-9878011 TTCTATAGGAGGAAGGGGGCTGG - Intronic
970808206 4:20060880-20060902 TTAGATAAGACAGAGGAGGAAGG + Intergenic
971077130 4:23163070-23163092 TTATATAAGGGAAGGGTGGAAGG - Intergenic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
971779252 4:31009975-31009997 TTATATGCTAGAAAGGAAGAGGG + Intronic
972262887 4:37428433-37428455 TTATCTAGCAGAAATAAGGAGGG - Intronic
972646798 4:40975795-40975817 TTATATAGGGGAAAGTAGAGTGG - Intronic
972752332 4:42003782-42003804 GAATAGAGGAGAAAGGATGACGG - Intronic
973567528 4:52203195-52203217 GCATATAGGAAAAAGGAAGAAGG + Intergenic
973880159 4:55263291-55263313 TTATGAAGGACAAAGGAGAAAGG + Intergenic
974570306 4:63637771-63637793 TGATTTAGGAGTAAGGAAGAAGG - Intergenic
975241955 4:72070407-72070429 TTTTAAAGGAAAAATGAGGAGGG + Intronic
975318725 4:72984976-72984998 TTAGAGAGGAGAAAGGTGAAGGG - Intergenic
976456067 4:85247858-85247880 TTATATAGGAAGAAGAATGAAGG - Intergenic
976569941 4:86595495-86595517 ATATAATGGAGAGAGGAGGATGG + Intronic
976766541 4:88603827-88603849 TTCTACAACAGAAAGGAGGAGGG - Intronic
976951099 4:90831911-90831933 TTATATAGCAGAAATGATAATGG + Intronic
977259104 4:94776895-94776917 TAATTTAGGAGAAAGGATAAAGG - Intronic
977926725 4:102708869-102708891 ATATATATGAGAAATGAGAAAGG + Intronic
978093484 4:104746298-104746320 TTATATAGGTGATGAGAGGAGGG + Intergenic
978413069 4:108446358-108446380 TTATGTTGGGGAAATGAGGAAGG + Intergenic
978959662 4:114661043-114661065 TTCTAAAGGACAAAGAAGGAAGG - Intronic
979240271 4:118441612-118441634 TAATATACAAGAAAGAAGGAAGG + Intergenic
979946740 4:126842505-126842527 TGGTATAGAAGAAATGAGGAAGG - Intergenic
980268780 4:130556264-130556286 TTATATAAAATAGAGGAGGAGGG + Intergenic
980364544 4:131783661-131783683 TTATAAATGACAATGGAGGATGG - Intergenic
980729540 4:136809430-136809452 TTTCATAGGAGAAAGGGAGATGG + Intergenic
980770497 4:137365520-137365542 CAATATAAGAGAAAGGAGGGAGG + Intergenic
980941041 4:139274355-139274377 TTTAATAGGGGAAAGGAGGAGGG + Intronic
981182311 4:141760113-141760135 TTATGTAGGAGGATGGAGGCAGG + Intergenic
981836601 4:149062330-149062352 TTAGATAGGTGAAAGCAGGTGGG + Intergenic
982071581 4:151699958-151699980 TTACATAGGAGATGGGAGGAAGG - Intronic
982222732 4:153138824-153138846 TTATATAACAGAAAGCATGAGGG + Intergenic
983288563 4:165770986-165771008 ATATATAGGAAAAGGGTGGATGG + Intergenic
983427311 4:167602065-167602087 TTACATGGAAGAAAGGAAGAAGG - Intergenic
983492579 4:168405781-168405803 TGAGATAGAATAAAGGAGGAGGG - Intronic
983524386 4:168745851-168745873 ATATGCAGGAGAAAAGAGGAGGG + Intronic
983561650 4:169107457-169107479 ATATATAGCAGAAAGGGAGAAGG - Intronic
984277340 4:177626736-177626758 TTTTAAAGCAGCAAGGAGGACGG - Intergenic
984412951 4:179418643-179418665 GTATAAAGGAGAAAGGATTAGGG - Intergenic
984675561 4:182543323-182543345 TTCAATAGGAGAAAGAAGAAAGG + Intronic
984842508 4:184081194-184081216 ATATATATGAGAATGAAGGAAGG + Intergenic
985010073 4:185573357-185573379 TTTTATAGGAGAAAGGCCAAGGG + Intergenic
986288545 5:6378912-6378934 TTACATAGAAGAAAGGAGGCAGG - Intergenic
987154045 5:15070003-15070025 TTGTAAAGGAAAAATGAGGAGGG + Intergenic
987501745 5:18720267-18720289 TTACATAGAAGATAGGAGAAGGG - Intergenic
988017444 5:25577499-25577521 TTATATAGCAGTCAAGAGGAAGG - Intergenic
988177956 5:27751835-27751857 TTAGATAGTAGAAATGAAGATGG + Intergenic
988645155 5:33086823-33086845 CTATATAGGAAAGAGGTGGAGGG + Intergenic
988982819 5:36588468-36588490 TTATGGTGGAGAAAGGAAGAGGG - Intergenic
989377675 5:40781809-40781831 ATGTATAAGAGAAAGAAGGAAGG + Intronic
989507133 5:42239061-42239083 TTATACAGAAGAAAGGATGGTGG - Intergenic
990618934 5:57539047-57539069 TGAAAGAAGAGAAAGGAGGAAGG + Intergenic
990726397 5:58759626-58759648 TTACATATTAGAAAGGAGGATGG + Intronic
991076716 5:62547738-62547760 TTATTTAGCAGCAGGGAGGAGGG - Intronic
991558134 5:67919206-67919228 TTATGTGGGAGGTAGGAGGAGGG - Intergenic
993418887 5:87674881-87674903 CTGGATAGGAGAAAGGAGAAAGG - Intergenic
993432809 5:87852647-87852669 TTATTGAGGAGAAAGGAAGATGG + Intergenic
993737151 5:91491191-91491213 TTATATAGGAGACAGGAGACTGG + Intergenic
993814060 5:92518841-92518863 TTATATTGGAGATTGGAGGTAGG + Intergenic
993819751 5:92600255-92600277 CTATTTAGAAGAGAGGAGGATGG - Intergenic
994133887 5:96262962-96262984 GGACATAGGAGAAAGGAGAAGGG - Intergenic
994523961 5:100880418-100880440 TTATTTGGGGGAAAGGATGAGGG - Intronic
994721934 5:103390426-103390448 ATAGGTAGGAGAAAGGAGCAGGG - Intergenic
994831724 5:104792231-104792253 GCACATAGGAGAAAGAAGGAGGG + Intergenic
995956440 5:117782573-117782595 TGATACAGGAGAATGAAGGAAGG + Intergenic
996261623 5:121477820-121477842 TTATACAAGAGGAAGAAGGAAGG - Intergenic
996334923 5:122372819-122372841 TTATAAAGAAGGAAGGAAGAAGG - Intronic
996447436 5:123571970-123571992 TTTTAAAGGAAAAATGAGGAGGG + Intronic
996653046 5:125904713-125904735 CTATGAAGGAGAAAGGAGAATGG + Intergenic
996665117 5:126050007-126050029 TTATATATGAGCAAGGGGAAAGG - Intergenic
996914380 5:128694699-128694721 TTAAATAGGATTAAGGAGGTTGG - Intronic
997031026 5:130128473-130128495 TAATATAGGAGCAAGTAGAATGG + Intronic
997173176 5:131745914-131745936 TTTTCTAGGAGTAAGGTGGAGGG + Intronic
997848409 5:137309185-137309207 TTACAGAGGAGAAAGAAAGATGG - Intronic
998300127 5:141010008-141010030 GTAGATAGGAAAAAGGAGCAGGG - Exonic
998353478 5:141515876-141515898 TTATGGAGGGGAAAGGGGGAAGG + Exonic
999824602 5:155262097-155262119 CTAGATAGAAGAAAGGAGGGTGG + Intergenic
1000135478 5:158345502-158345524 TTATAATAAAGAAAGGAGGAAGG + Intergenic
1000444762 5:161305942-161305964 TTATAAAGGGGAAAGGAGTATGG - Intronic
1001104242 5:168839702-168839724 TTATTTAGGAGACTGGGGGAGGG - Intronic
1001186041 5:169573870-169573892 TTTTATAGGAACAAGAAGGAGGG - Intergenic
1001771754 5:174302168-174302190 TTACAAAGGAGAAAAGAGGCTGG + Intergenic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002740522 5:181432195-181432217 TAATATACAAGAAAGAAGGAAGG + Intergenic
1002794373 6:459609-459631 GCAAATAGAAGAAAGGAGGAAGG + Intergenic
1003679915 6:8242846-8242868 ACATATATGAGAGAGGAGGACGG - Intergenic
1003708844 6:8566456-8566478 AAATATAGGAGAAAGGAAAAAGG - Intergenic
1004060269 6:12189153-12189175 TTATTTTGGTGAAAGGAGTAAGG - Intergenic
1005204668 6:23388346-23388368 TTATATAGGTGGAATGAAGATGG - Intergenic
1005229258 6:23681342-23681364 TTATAGAAGAGGAAGGGGGATGG - Intergenic
1006050168 6:31336070-31336092 TTTTAGATGACAAAGGAGGATGG + Intronic
1007168117 6:39842746-39842768 TTATTTAGGAGAATGCAGGTAGG + Intronic
1007343615 6:41209737-41209759 TGAGGAAGGAGAAAGGAGGATGG + Intergenic
1010632695 6:78217688-78217710 TGATAAAGGAGAAAGAGGGAAGG - Intergenic
1010660366 6:78563421-78563443 TTATTTAGAAGACAGGAGAAGGG + Intergenic
1011366619 6:86589121-86589143 TGATATTGGAGTAAGGAAGAGGG + Intergenic
1011667228 6:89646264-89646286 ATTTATAAGAGAAAGGAGCAAGG - Intronic
1012452825 6:99371664-99371686 TTATTTGGAAGAAAGGAGGAGGG - Intronic
1012883446 6:104817590-104817612 ATATAGAGGAGAAAGAAAGATGG + Intronic
1013300911 6:108804216-108804238 TTGGATAGGTGAAAGGAGGCAGG + Intergenic
1014494868 6:122108714-122108736 GTATTTAGAAGAAAGGAGGATGG + Intergenic
1014676807 6:124377899-124377921 ATACATAAGAGAAAGGAGGCTGG - Intronic
1014728485 6:125002675-125002697 TCAGAAAGCAGAAAGGAGGAGGG - Intronic
1014884060 6:126757883-126757905 GTGACTAGGAGAAAGGAGGAGGG - Intergenic
1015077424 6:129176964-129176986 TCAGAAAGAAGAAAGGAGGAGGG - Intronic
1015158696 6:130126911-130126933 TTTCATAGAAGAAAGGAGAATGG + Intronic
1015313312 6:131789210-131789232 TTATAAATCAGAGAGGAGGAAGG - Intergenic
1015345092 6:132147127-132147149 TTATTGTTGAGAAAGGAGGAAGG + Intergenic
1015787352 6:136931450-136931472 GTACATAGGAGAATGGAGTAGGG + Intergenic
1015960323 6:138641846-138641868 AAATATAGGAGACAGGAGGTGGG - Intronic
1016012978 6:139157933-139157955 TTAATGTGGAGAAAGGAGGATGG + Intronic
1016358517 6:143243663-143243685 TGATATAGGACAGTGGAGGAAGG + Intronic
1016363353 6:143291114-143291136 TTAAATAGGAGATATAAGGAAGG - Intronic
1016381183 6:143482474-143482496 TTCTATTGGAGATTGGAGGATGG + Intronic
1016764116 6:147773387-147773409 GTACAGAGGAGAAAAGAGGATGG + Intergenic
1017075106 6:150610603-150610625 TTAAATAGGAAAGAAGAGGAAGG + Intronic
1017981728 6:159406695-159406717 TTAGACAAGAGTAAGGAGGAGGG + Intergenic
1018098270 6:160412441-160412463 TAATATAAGAGAGAGGAAGAAGG - Intronic
1018920673 6:168170353-168170375 TTTTAAAGGAAAAATGAGGATGG - Intergenic
1020782205 7:12531820-12531842 TTTAATAGAAGAAAGGAGAAAGG + Intergenic
1020995230 7:15255255-15255277 TCATATAGGTGAAAGGTTGATGG + Intronic
1023185087 7:37524646-37524668 TTAAATAGGAGGAAGGAAAATGG - Intergenic
1023628594 7:42140803-42140825 TTATACAAGAAAAAGGAGGAGGG + Intronic
1024318257 7:48041311-48041333 CTATAGAGGAGAGAGGCGGAGGG - Intronic
1024466794 7:49719881-49719903 TGATACAGGAGTAAGGAGAAGGG + Intergenic
1025019217 7:55467534-55467556 TGAAATAGGAGAAGGGAGGTGGG - Intronic
1025909828 7:65819411-65819433 CTTTATAAGAGAAAGGAGGTAGG + Intergenic
1026132194 7:67629936-67629958 TTGTATGGGAGGAGGGAGGAAGG - Intergenic
1027754641 7:82196827-82196849 TTATATATGTGAATAGAGGATGG + Intronic
1028278852 7:88895323-88895345 TTACATATAAGCAAGGAGGAAGG + Intronic
1029336946 7:99909233-99909255 ATATTTAGGAAAAAGTAGGAAGG + Intronic
1030371287 7:108702128-108702150 TTATATAGGATCAGGGAGAATGG - Intergenic
1030448959 7:109684754-109684776 TAATATTGGAGAAAGTATGAGGG + Intergenic
1030860423 7:114617947-114617969 TTTTCTAGGTGAAAGCAGGATGG - Intronic
1030860944 7:114627634-114627656 ATATAAAGGAGAAAGAAGGAAGG - Intronic
1034291840 7:149938809-149938831 TTATATGGGAGTATGGGGGAAGG + Intergenic
1034814242 7:154158086-154158108 TTATATGGGAGTATGGGGGAAGG - Intronic
1035502492 8:100406-100428 TAATATACAAGAAAGAAGGAAGG - Intergenic
1036436991 8:8743663-8743685 TTCTGTAGGGGAGAGGAGGAAGG - Intergenic
1037902807 8:22697468-22697490 TGATTAAGGACAAAGGAGGAAGG + Intergenic
1038299975 8:26335366-26335388 GTTTAAGGGAGAAAGGAGGAAGG + Intronic
1038923021 8:32106671-32106693 ATATATAGAAGAAAGCAGCAAGG + Intronic
1039261021 8:35772035-35772057 TTATATAACAGAAAAGAGCATGG - Intronic
1039720113 8:40154271-40154293 ATAGATAGGGGAAGGGAGGAGGG + Exonic
1040409788 8:47142689-47142711 ATATATAGGAGCAAAGAGGCTGG + Intergenic
1040887398 8:52280025-52280047 TAATACAGGAGACAGGAGGGTGG + Intronic
1041419810 8:57653882-57653904 TTACATAGGACAAAGGGGGAGGG - Intergenic
1042677464 8:71337785-71337807 CTCCACAGGAGAAAGGAGGAAGG - Intronic
1045348385 8:101315689-101315711 TTATGAAGGAGAAAGGAGATGGG - Intergenic
1045437576 8:102179584-102179606 TTATAGAGGAGAAGGGAGAAAGG - Intergenic
1046948002 8:119992624-119992646 TTATCTAGTTGGAAGGAGGAAGG - Intronic
1047699936 8:127438941-127438963 TTAAATGGGCAAAAGGAGGAAGG + Intergenic
1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG + Intergenic
1048613730 8:136051863-136051885 TTACATTGAAGAATGGAGGACGG - Intergenic
1049127592 8:140805792-140805814 TTATATAGTAGCATGGATGAAGG - Intronic
1049952465 9:658848-658870 TTAACTAGGGGAAAGGTGGAAGG - Intronic
1050119263 9:2291595-2291617 GTATTTAGGAGGAAGGAGGAGGG - Intergenic
1050238327 9:3606969-3606991 TTAAAAAGGAGAAAGCTGGAGGG - Intergenic
1051268136 9:15328412-15328434 TTATTTAGCAGCCAGGAGGAGGG - Intergenic
1051527789 9:18066368-18066390 TTATATAAGACATAGGAGGTAGG + Intergenic
1051544408 9:18258411-18258433 CCACATAGGAGAAAGGAGGATGG + Intergenic
1052195571 9:25709237-25709259 TTAGAAAGGAGAAAGAAGGAAGG + Intergenic
1052835569 9:33247519-33247541 TTAGCTAGGAAAAAGGAGCAAGG + Intronic
1053225535 9:36352552-36352574 TAACATAGGAGAAATGGGGAAGG - Intronic
1054364552 9:64321699-64321721 TTATAAATGACAATGGAGGATGG - Intergenic
1054932596 9:70651670-70651692 CTATGCAGGAGGAAGGAGGAAGG - Intronic
1055073066 9:72187412-72187434 TCATACAGCAGAAAGGTGGAAGG - Intronic
1056461629 9:86814643-86814665 TAGTGTAGGAGACAGGAGGAGGG + Intergenic
1057193189 9:93098551-93098573 TTTTACAGGACAAAGGAAGATGG - Intronic
1057836607 9:98450439-98450461 TGACAAAGGAGATAGGAGGAAGG + Intronic
1058049239 9:100390048-100390070 ATATAGAGGAGAGAAGAGGAAGG + Intergenic
1058369411 9:104247906-104247928 TTATCTAGCAGAGAGAAGGAAGG + Intergenic
1058792897 9:108469160-108469182 GGAGATAGGAGAGAGGAGGATGG + Intergenic
1060284154 9:122234145-122234167 TGCTATAGAAGCAAGGAGGAGGG + Intergenic
1060839068 9:126780177-126780199 TTGTCTATGAGACAGGAGGAGGG + Intergenic
1062038969 9:134395558-134395580 CTCTGGAGGAGAAAGGAGGATGG - Intronic
1203605831 Un_KI270748v1:57003-57025 TAATATACAAGAAAGAAGGAAGG + Intergenic
1185783191 X:2866943-2866965 CAATATTGCAGAAAGGAGGAGGG + Intronic
1186119466 X:6343759-6343781 TTTTATAAGAGATAGGATGATGG + Intergenic
1186340049 X:8635200-8635222 TTATCTAGTATAAAGGAGGGAGG - Intronic
1186405186 X:9295632-9295654 TTCTAAAGAAGAAAGGAGGTAGG - Intergenic
1186699205 X:12071238-12071260 ACATATAGGAGGAAGAAGGAAGG - Intergenic
1187215878 X:17275857-17275879 GGATATAGGAGGAAGGAGGCAGG - Intergenic
1188007391 X:25025017-25025039 TTAAATAGAAGAGAGGAGAAAGG + Intergenic
1188811690 X:34659226-34659248 TTAGATAGTATAAAGAAGGATGG - Intergenic
1188817392 X:34731867-34731889 TTTCCTAGGAGAAAGAAGGAGGG + Intergenic
1188929260 X:36086357-36086379 TTGTATAGGAGCATGGAAGAGGG - Intronic
1188937421 X:36193754-36193776 GTTAATAGGAGAAAGGAGGGTGG - Intergenic
1189049240 X:37627053-37627075 TTCTATAGAAAAAATGAGGATGG + Intronic
1189363718 X:40372043-40372065 TTATTTGGGAGACAGGAGGATGG + Intergenic
1193459185 X:81769984-81770006 TTATATATAAAAAAGGAGAAAGG + Intergenic
1193824161 X:86202219-86202241 TTATATGGGAGGATGGAGGAGGG + Intronic
1195412442 X:104582551-104582573 AGAAAGAGGAGAAAGGAGGAAGG - Intronic
1195762027 X:108256942-108256964 TCTAATAGCAGAAAGGAGGAAGG + Intronic
1196210442 X:112990173-112990195 ATTGATAGGAGAAAGGAGTAAGG - Intergenic
1196366868 X:114933325-114933347 GAATATAGGAGAAAGGAAGGAGG + Intergenic
1196683229 X:118489846-118489868 TTAGATAGGAGATGGTAGGAGGG + Intergenic
1197193040 X:123670236-123670258 GTATATAGGGGGAATGAGGATGG - Intronic
1197869028 X:131048483-131048505 TTATAGATGAGAGAAGAGGAGGG - Intergenic
1198466733 X:136910177-136910199 GCATCCAGGAGAAAGGAGGAGGG - Intergenic
1199135355 X:144243797-144243819 TTATCCAGGAGAAAGGAGAGTGG - Intergenic
1199151807 X:144496023-144496045 TGAGATAGGAGAAAGAAGGCAGG - Intergenic
1199541851 X:148966448-148966470 ATAGAGAGGAGAGAGGAGGAGGG - Intronic
1199907976 X:152254429-152254451 GTATATTGGAGAAATGAGAATGG - Intronic
1202388006 Y:24343441-24343463 TAATATACAAGAAAGAAGGAAGG + Intergenic
1202482781 Y:25326687-25326709 TAATATACAAGAAAGAAGGAAGG - Intergenic