ID: 1104559054

View in Genome Browser
Species Human (GRCh38)
Location 12:129827428-129827450
Sequence GCTTATATGAGGACCATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104559054_1104559058 6 Left 1104559054 12:129827428-129827450 CCTTCCATGGTCCTCATATAAGC 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1104559058 12:129827457-129827479 TAGAATTTGCAAAATACTAATGG 0: 1
1: 0
2: 2
3: 37
4: 453
1104559054_1104559059 7 Left 1104559054 12:129827428-129827450 CCTTCCATGGTCCTCATATAAGC 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1104559059 12:129827458-129827480 AGAATTTGCAAAATACTAATGGG 0: 1
1: 1
2: 4
3: 40
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104559054 Original CRISPR GCTTATATGAGGACCATGGA AGG (reversed) Intronic
901498373 1:9635937-9635959 GCTCATACCAGGACCTTGGATGG - Intergenic
903254174 1:22081586-22081608 GGTTATATAAGGATGATGGATGG + Intronic
904452856 1:30627482-30627504 GTTTTTGAGAGGACCATGGAGGG + Intergenic
909234863 1:73139878-73139900 GTTTATACTAGTACCATGGATGG + Intergenic
911334100 1:96560588-96560610 ACTTTTAAGAGGACCATGGTGGG - Intergenic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913400705 1:118429625-118429647 GCTTAGATGAGGATCATGAGTGG + Intergenic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
919942451 1:202297669-202297691 TCTTTTATAAGGACCATGGGAGG - Intronic
921602826 1:217124761-217124783 ACTTTTATGAGGACCATTGGTGG - Intronic
922580518 1:226694360-226694382 GCTTTTATTAGGACCCTAGAAGG + Intronic
923294517 1:232580714-232580736 GCCTAGATGAGGACAAAGGAGGG + Intergenic
924076383 1:240342034-240342056 GCTTATGTGAGGACTGGGGATGG - Intronic
1063929176 10:11012001-11012023 TCTTATCTGAGGATCATGGTAGG + Intronic
1063963741 10:11328547-11328569 GCTTGTATGAGTAGCATGTATGG + Intronic
1068038167 10:51787432-51787454 ACTTAAAGGAGGACCAGGGATGG + Intronic
1069307010 10:66983260-66983282 GCTGAGATGAGGAACATGGCTGG - Intronic
1071761768 10:88616333-88616355 ACTTTTATGAGGACCCTGAAGGG - Intergenic
1077482708 11:2823970-2823992 GCTGATAAGAGGACCAGTGATGG + Intronic
1084772829 11:71355165-71355187 GCTTATATGAGACCCATAAATGG - Intergenic
1085041146 11:73327085-73327107 GCTCATAGGAGCACCAAGGATGG - Intronic
1085954294 11:81372349-81372371 ATTTTTATGAGGACCATTGAGGG + Intergenic
1086849394 11:91791661-91791683 GCTCAGATGAGGACCATGTTAGG + Intergenic
1086977386 11:93150449-93150471 GGTTATATGAGGAACATGGTGGG - Intronic
1087371670 11:97292717-97292739 GCTTATTTGAGGACTAAAGAGGG + Intergenic
1087529596 11:99361700-99361722 ACTTATATGAGGAACCTAGAAGG - Intronic
1088825493 11:113490322-113490344 GCTTATGTCAGGGCCAAGGATGG - Intergenic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1092965440 12:13636954-13636976 CCTAAAATGAGGAACATGGAGGG + Intronic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1097824407 12:64159697-64159719 GCTTCTATGAGTGCCATGGCAGG - Exonic
1098090364 12:66894617-66894639 GGGCATATGAGGACCTTGGAAGG - Intergenic
1101475632 12:105044627-105044649 GCTAATATGACCCCCATGGATGG + Intronic
1104559054 12:129827428-129827450 GCTTATATGAGGACCATGGAAGG - Intronic
1105944175 13:25175658-25175680 GCTTCCATGAGGCCCATGGAGGG - Intergenic
1106804793 13:33295179-33295201 TCTTATATTAGGAATATGGAAGG - Intronic
1108140673 13:47417411-47417433 TCTTGTATGAAGACCATGGCTGG + Intergenic
1111142440 13:84137270-84137292 GCTTTCAAGAGTACCATGGATGG + Intergenic
1112425997 13:99301747-99301769 GAGTAAATTAGGACCATGGAAGG - Intronic
1114402600 14:22423526-22423548 GCCTATCTGAGCACCATGGGAGG - Intergenic
1120148886 14:81010538-81010560 GTATATATGAGCACTATGGATGG + Intronic
1120453797 14:84705260-84705282 GATTATATGAGGAAGGTGGAAGG + Intergenic
1124217253 15:27817607-27817629 GTTTCTAAGAGGATCATGGAGGG - Intronic
1124865616 15:33487631-33487653 GGTTCTATGGGGACCATGGTGGG + Intronic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1129009231 15:72399924-72399946 GCTTATGTGAGGAGAATAGATGG - Intronic
1132533712 16:466976-466998 GCACCTGTGAGGACCATGGATGG + Intronic
1134031373 16:10995226-10995248 GCTAATATGATGCCCATTGATGG + Intronic
1135121247 16:19768272-19768294 GATTATATGAGTATTATGGATGG + Intronic
1137935421 16:52630730-52630752 GTTGATATGAAGGCCATGGATGG - Intergenic
1138421435 16:56901816-56901838 GCTCATATGAGGAGCAGTGAAGG - Intronic
1141829480 16:86501745-86501767 GCTGACATGAGGACCAGGGAAGG - Intergenic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1147373995 17:40013414-40013436 GTTTTTAACAGGACCATGGAAGG - Intergenic
1148620647 17:49032082-49032104 GCTAATATCAGAACCCTGGATGG - Intronic
1149085626 17:52711815-52711837 ACTCATGTGAGGAGCATGGAAGG + Intergenic
1149865546 17:60149304-60149326 GTTTATGTGATGACCAGGGAGGG - Intergenic
1155373159 18:25125978-25126000 ACATTTATGAGGACCATTGAAGG - Intronic
1157324924 18:46662128-46662150 GCTTTTAAGGGGACCATGGAGGG - Intergenic
1161058888 19:2204528-2204550 GCGGGTACGAGGACCATGGAGGG - Intronic
1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG + Intergenic
928094465 2:28395071-28395093 GCTTATAGGAGCACCATGGGAGG - Intronic
928111920 2:28517392-28517414 GCTTTTGTGAATACCATGGAAGG - Intronic
928700713 2:33895967-33895989 CCTTATAAGAGGATAATGGAAGG + Intergenic
931876786 2:66522233-66522255 TCTTATGTGAGGATCATGGCAGG + Intronic
934133493 2:88971628-88971650 GAATATATTAGAACCATGGAAGG + Intergenic
935102104 2:100006786-100006808 GCGTATGTGAGGCCAATGGACGG - Exonic
937327562 2:121000500-121000522 GCTGATAACATGACCATGGAAGG + Intergenic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
938208332 2:129442670-129442692 GTTTCTATGGGGATCATGGAGGG - Intergenic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
943980636 2:194545275-194545297 TCTTATATGATGACAAAGGAGGG - Intergenic
944967441 2:204951146-204951168 GCTTATAAGAGGCCCATGCTTGG + Intronic
947322932 2:228942638-228942660 GCATAAACGAGGAACATGGAGGG + Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170105812 20:12753587-12753609 CCTTATATGAGGAGCAAGGAGGG - Intergenic
1177890805 21:26801729-26801751 GCTTTTATGAGAACCAGGAAAGG + Intergenic
1181322762 22:22021292-22021314 GCTGGTATGGAGACCATGGAAGG + Intergenic
952437755 3:33289015-33289037 GCTGAGATGAAGACCATGGAAGG + Intronic
953138621 3:40206114-40206136 GCTGATATGGAGTCCATGGATGG - Intronic
954576358 3:51678457-51678479 GCTTATATGGGGAGCCTGGCTGG + Intronic
958560331 3:95741328-95741350 GCTTATATTAGAAACATGAAAGG + Intergenic
959530207 3:107427734-107427756 AATTATATTAGGTCCATGGAAGG - Intergenic
961177324 3:124846509-124846531 GCTTACCTGAGGATCATGGTAGG - Intronic
964646499 3:158963678-158963700 GCTGAAATGGGGACCATTGAAGG + Intronic
966171943 3:177091470-177091492 GCTGATCTGAGGACCAATGAAGG + Intronic
966366146 3:179189625-179189647 CCTAATATGAGGCCCATGAATGG - Intronic
967755322 3:193162067-193162089 GCTTATAAGAAGACCCTGAATGG + Intergenic
976612840 4:87047430-87047452 GCTTATGTCCGGCCCATGGATGG + Exonic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
977252172 4:94701517-94701539 GCATATATGATAACCATGTAGGG - Intergenic
980102266 4:128553394-128553416 GCTTTGCTGAGGAACATGGAAGG - Intergenic
983844932 4:172506332-172506354 GTTTTTATGAGGATCATGGAGGG - Intronic
987024423 5:13909963-13909985 GCTTATATGTGGAATATAGATGG - Intronic
994383684 5:99102438-99102460 TGTTATATGAGGAACATGGGTGG + Intergenic
997315766 5:132934280-132934302 GCCTATGTGCGGCCCATGGACGG - Exonic
1002107055 5:176884842-176884864 GCTCAGAGGAGGAGCATGGAGGG + Intronic
1009480057 6:64145919-64145941 GCTCTTCTGAGGACCTTGGAAGG - Intronic
1010399058 6:75427675-75427697 GCATAGAAGAGGAGCATGGAAGG - Intronic
1013424751 6:110000966-110000988 TGTTAAATGAGGGCCATGGAAGG + Intergenic
1014725402 6:124965695-124965717 GCAGATAAGAGGGCCATGGAGGG - Intronic
1016177949 6:141103568-141103590 TCTTATTTGAGCCCCATGGATGG - Intergenic
1023954582 7:44874181-44874203 GCTGATTTGAGGACCATGCTTGG - Intergenic
1027444185 7:78253806-78253828 CCTTATATCAGGACCATGGGTGG - Intronic
1036657166 8:10684050-10684072 GCTTCCAGGAGGACCAGGGAAGG + Intronic
1037156215 8:15702479-15702501 GCTGATATGAGAACCTTGGAAGG - Intronic
1039399429 8:37256610-37256632 GTTAATGTGAGGACCATGTAAGG - Intergenic
1048084972 8:131167490-131167512 GATTGTCTGAGGACCATGGTGGG + Intergenic
1048893825 8:138970878-138970900 GTTTTTAAGGGGACCATGGAGGG + Intergenic
1051906846 9:22105212-22105234 GCACATATGAAGACTATGGAGGG + Intergenic
1056196608 9:84235256-84235278 GCTTTTCTCAGGACCTTGGAAGG + Intergenic
1056504447 9:87244691-87244713 GCTTATATGAGTTCCAAAGATGG - Intergenic
1057249432 9:93488306-93488328 GCTTTTGTCAAGACCATGGATGG + Intronic
1057734185 9:97638417-97638439 GCTTATAAGAGGGCCTAGGAGGG + Intronic
1061326191 9:129866173-129866195 CCTGAAATGAGCACCATGGACGG + Intronic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1186230090 X:7444412-7444434 ACTTCTATGAGGACCAGGGGAGG + Intergenic
1186409876 X:9337250-9337272 GCTTGGATGTGGACCAAGGAAGG + Intergenic
1187474745 X:19601085-19601107 CCATATATGAAGACTATGGAAGG - Intronic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1193468314 X:81872451-81872473 TTTTCGATGAGGACCATGGAAGG - Intergenic
1195731194 X:107969288-107969310 TCTTATTCGAGGTCCATGGATGG + Intergenic
1198934963 X:141895644-141895666 GCTGATATGAGGAGCAGGGTGGG - Intronic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic