ID: 1104559870

View in Genome Browser
Species Human (GRCh38)
Location 12:129833984-129834006
Sequence AGTGATTCCCCCAACCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104559870_1104559877 19 Left 1104559870 12:129833984-129834006 CCAGCCTGGTTGGGGGAATCACT 0: 1
1: 0
2: 0
3: 13
4: 97
Right 1104559877 12:129834026-129834048 TCTTCCTCCCCAGGAACTTTCGG 0: 1
1: 0
2: 2
3: 29
4: 274
1104559870_1104559876 10 Left 1104559870 12:129833984-129834006 CCAGCCTGGTTGGGGGAATCACT 0: 1
1: 0
2: 0
3: 13
4: 97
Right 1104559876 12:129834017-129834039 CATCTCTGTTCTTCCTCCCCAGG 0: 1
1: 0
2: 3
3: 57
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104559870 Original CRISPR AGTGATTCCCCCAACCAGGC TGG (reversed) Intronic
907806156 1:57822389-57822411 AGTGATCCCCCTAACCAGTGTGG - Intronic
911245879 1:95516756-95516778 ACTGATTCCCCAAACAGGGCTGG - Intergenic
920399021 1:205665640-205665662 AGTGACTCCCCCAAGCTGACAGG + Intronic
1066714972 10:38277018-38277040 AGTGATTACCCCAACCACCAGGG + Intergenic
1066783108 10:38973681-38973703 AGTGATTACCCCAACCACCAGGG - Intergenic
1070439599 10:76430544-76430566 AGTGATTTCTCCAGGCAGGCAGG + Intronic
1070523759 10:77277137-77277159 AGAGCTTCCCCCAACCATGCTGG - Intronic
1075007492 10:118841241-118841263 AGTGATTCACACATTCAGGCCGG - Intergenic
1075601518 10:123772793-123772815 AGTGATAGCCACAACCAGGAAGG - Intronic
1075690598 10:124391458-124391480 TGTCATTCACCCAACCATGCTGG - Intergenic
1077032643 11:476506-476528 AGTGATGCCGCCACCCAGGAGGG - Intronic
1077356396 11:2120899-2120921 AGTGATGCTCCCAGCCAGGCGGG + Intergenic
1078761943 11:14258796-14258818 AGTCATTCCTACAAACAGGCGGG + Intronic
1090187236 11:124746517-124746539 AGAGACTCCCTCACCCAGGCAGG + Exonic
1091489594 12:921580-921602 AGTGATCCTCCCACGCAGGCTGG - Intronic
1095892471 12:47247594-47247616 AGTGACTGCACCAACCAGCCTGG - Intergenic
1096100603 12:48968715-48968737 AGAAATTCCCCCAACCCTGCAGG + Intronic
1102963155 12:117106807-117106829 AGTGATTCTGCCACCCAGGAAGG - Intergenic
1104559870 12:129833984-129834006 AGTGATTCCCCCAACCAGGCTGG - Intronic
1105051170 12:133052442-133052464 AGTGATCCCCCCAAGCAGCTGGG + Intronic
1105835852 13:24211600-24211622 GGTGATTCCCACCATCAGGCTGG - Intronic
1106077921 13:26476591-26476613 AGTCATCCCCACATCCAGGCGGG + Intergenic
1110247958 13:73348294-73348316 AGTGTTTCCACCAGCCAGACTGG + Intergenic
1111095905 13:83515491-83515513 ATTCATTCCTGCAACCAGGCTGG + Intergenic
1113057311 13:106282770-106282792 AGTGATTCCTCCGACGAAGCTGG + Intergenic
1114454983 14:22848450-22848472 ACTGATTCCTCCCTCCAGGCTGG - Intronic
1119140983 14:72266827-72266849 AGTGGTTCCCACAGCCAGGCTGG + Intronic
1119323332 14:73744320-73744342 ACTGATTGCCCCAAGCAGACTGG - Intronic
1119809891 14:77508129-77508151 AGTGATTCTCCCACACAGGTGGG + Exonic
1128389547 15:67173895-67173917 GGTGATGCCCCCATCGAGGCTGG + Intronic
1128501479 15:68229925-68229947 AGAGATTCCCGTACCCAGGCAGG - Intronic
1128751732 15:70154894-70154916 AGAGATTACCGCAGCCAGGCTGG - Intergenic
1129529884 15:76257166-76257188 AGAGGTTCCCCCACCAAGGCTGG + Intronic
1133303171 16:4795415-4795437 TCCAATTCCCCCAACCAGGCAGG - Intronic
1134635795 16:15790816-15790838 ACTTAATCCCCCAGCCAGGCTGG + Intronic
1135261617 16:20985748-20985770 AGTGAATGGCCCAGCCAGGCTGG + Intronic
1135391407 16:22096505-22096527 AGTGATCCTCCCACCTAGGCTGG - Intronic
1137359175 16:47797515-47797537 AATGATTCCACCACCCAGGGAGG + Intergenic
1137391994 16:48089101-48089123 AGCTATTCCCCCAACCTGGAGGG - Intronic
1138130043 16:54471822-54471844 AATGATGCCCCCCTCCAGGCAGG + Intergenic
1141982371 16:87558543-87558565 AGTGATTCCCCTAACCTTTCTGG + Intergenic
1144068661 17:11646956-11646978 AGTCATTGACCCAACCAGGCTGG - Intronic
1144495889 17:15744533-15744555 AGGGATGCCCCCATGCAGGCCGG + Intronic
1146796541 17:35785117-35785139 TGTGATTCCACCAAGCTGGCTGG - Intronic
1147361866 17:39935963-39935985 AGTTATCCCCCCATCCAGGCTGG + Intergenic
1150294332 17:63999623-63999645 GGTGTGTCCCCCATCCAGGCTGG + Intronic
1152537666 17:80959968-80959990 GGTGATCCCCACAGCCAGGCAGG + Intronic
1153872000 18:9330407-9330429 AGTAATTCCCCTAACAAGGCAGG + Intergenic
1156594583 18:38533153-38533175 AGTGATCCCTGGAACCAGGCCGG + Intergenic
1157155632 18:45262665-45262687 AGTGGCTCCCCCATCCAGGGTGG - Intronic
1160168099 18:76531128-76531150 AGTGATGTCCCCAAACGGGCAGG - Intergenic
1160839775 19:1140933-1140955 AGGGATTCCTCCATCCAGTCAGG + Intronic
1161372491 19:3920996-3921018 AGTGGTTCCCTTAACCAGTCAGG + Intronic
1163012614 19:14434778-14434800 TGTGATTCCTGCAACGAGGCTGG + Intronic
1163802523 19:19375192-19375214 AGTGACTTCCCTAACCAGGAAGG - Intergenic
1164921741 19:32093538-32093560 AGTGGTGCCCCCCACCAGGAAGG + Intergenic
1164958963 19:32410543-32410565 AGTGATTCACCCACCCAAGCTGG - Intronic
1165742183 19:38210971-38210993 GGTGATGCCCCAAACCAGACGGG + Intergenic
1165860025 19:38904299-38904321 AGTGTTCCCACCAGCCAGGCTGG - Intronic
927016715 2:18971014-18971036 AGTGAATCCCTCTATCAGGCAGG - Intergenic
934615000 2:95765143-95765165 TGTGATTTCCCCAGACAGGCAGG + Intergenic
935419160 2:102848739-102848761 AGTGATTTCTGCAGCCAGGCAGG - Intergenic
943826381 2:192398902-192398924 TGTGATTCCCTGAACCAGGAGGG + Intergenic
945208665 2:207359178-207359200 AGTGATCCCTCCAGCCTGGCTGG + Intergenic
1173255911 20:41394287-41394309 AGTGATGCCCCAGACCAGGCAGG + Intergenic
1175876816 20:62234200-62234222 AATGCTTCCCCCAGCAAGGCAGG + Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1179166198 21:38937110-38937132 TGTGCTTCCCCCCATCAGGCTGG + Intergenic
1179504671 21:41832698-41832720 AGTGAGCCCCCCTCCCAGGCAGG + Intronic
1184262833 22:43329167-43329189 AGTCATTCCCCGCTCCAGGCTGG - Intronic
951107170 3:18758299-18758321 AGTTATTCCACCAACCAGTAGGG - Intergenic
952450743 3:33430370-33430392 AGTGGTTCCCCGGACCAGGCTGG - Intronic
953138150 3:40201589-40201611 TGCAATTCCACCAACCAGGCAGG + Intronic
959573639 3:107911025-107911047 AGTGCTCACCCCAACAAGGCTGG - Intergenic
963267619 3:143254690-143254712 AGTGAGTCCTCCACCCAGTCTGG - Intergenic
965182613 3:165424086-165424108 TCTGATTCTGCCAACCAGGCTGG + Intergenic
967229099 3:187320741-187320763 ATTGATTCACCCAAACAAGCAGG + Intergenic
969256069 4:6002644-6002666 AGAGCTTCCCCCCACCAGGTGGG + Intergenic
975261222 4:72301978-72302000 AGTGATACCAGAAACCAGGCAGG + Intronic
979080945 4:116340252-116340274 AGTGATTCTCCCACCCTGACTGG + Intergenic
992250955 5:74875596-74875618 AGTGATCCACCCACCTAGGCCGG - Intergenic
995042848 5:107608785-107608807 AATGATGGCCCCAAGCAGGCTGG + Intronic
998002496 5:138636076-138636098 AGTGATTCTCCCAACGTGGTTGG - Intronic
1002172416 5:177382865-177382887 CGAGACACCCCCAACCAGGCAGG + Intronic
1002715813 5:181226422-181226444 AGTAATTCCAACAATCAGGCAGG - Intronic
1006591084 6:35158183-35158205 AGTGTTTCCACCAGCCAGACTGG - Intergenic
1007496452 6:42263216-42263238 AGGGATGTCCCCACCCAGGCAGG + Intronic
1010824656 6:80457495-80457517 AGTGACTCACCCAAACAGACAGG - Intergenic
1011964438 6:93136453-93136475 AGTGATTCCCGCAGCCACCCAGG + Intergenic
1012060408 6:94471569-94471591 AGTGATTCCTCAAATTAGGCTGG - Intergenic
1012228967 6:96737777-96737799 AGTGATCCCCCCACCCAAGCTGG + Intergenic
1013579089 6:111514923-111514945 AGTGATCCCCCCAACTTGGCTGG + Intergenic
1021463787 7:20918786-20918808 AGTGGTTTCCCCAACAAGGATGG + Intergenic
1022524743 7:31029661-31029683 AGGCATTCCCCCATCCAGGTTGG + Intergenic
1032435953 7:131900525-131900547 CGTGATTCTCAGAACCAGGCTGG + Intergenic
1036085525 8:5609061-5609083 AGTGGTCTCTCCAACCAGGCTGG - Intergenic
1037293503 8:17376075-17376097 AGTTATTCCCCCAACCACTCCGG + Intronic
1047059448 8:121207878-121207900 ACTTTCTCCCCCAACCAGGCTGG - Intergenic
1049198166 8:141326676-141326698 CTTGATTCACCCCACCAGGCTGG + Intergenic
1052217907 9:25989275-25989297 AGTGATTCCCTCTACAAGTCTGG - Intergenic
1055485638 9:76753944-76753966 AGTGATTCCACCATACAGGCAGG + Intronic
1058412508 9:104748439-104748461 GGTCGCTCCCCCAACCAGGCGGG + Intronic
1059749387 9:117233423-117233445 ATTGATTCTCCCAACCACCCTGG - Intronic
1060107921 9:120885844-120885866 AGGTATTCCTCCACCCAGGCAGG - Intronic
1061151967 9:128833897-128833919 AGAGGTTCCCACGACCAGGCGGG + Intronic
1061587243 9:131577061-131577083 ACTGATTCCCACAACCCGCCCGG + Exonic
1062706408 9:137946471-137946493 AGTCCTTCCCCCTTCCAGGCAGG + Intronic
1189463104 X:41258451-41258473 AGCAATGCCCCCCACCAGGCTGG - Intergenic
1195364730 X:104115039-104115061 ATTGATTCCCCCAACAATTCTGG + Exonic
1196029905 X:111085613-111085635 AGTCCTTCCCCCAACAAGGTTGG - Intronic
1199975404 X:152892297-152892319 AATGCATCCCCCAGCCAGGCTGG + Intergenic