ID: 1104560622

View in Genome Browser
Species Human (GRCh38)
Location 12:129840614-129840636
Sequence AGGCTGCGCAGCCCCCGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 299}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104560622_1104560632 17 Left 1104560622 12:129840614-129840636 CCAGGGCGGGGGCTGCGCAGCCT 0: 1
1: 0
2: 1
3: 39
4: 299
Right 1104560632 12:129840654-129840676 CAGCAAGGAGGCTCCCAGTGCGG 0: 1
1: 0
2: 1
3: 30
4: 278
1104560622_1104560628 5 Left 1104560622 12:129840614-129840636 CCAGGGCGGGGGCTGCGCAGCCT 0: 1
1: 0
2: 1
3: 39
4: 299
Right 1104560628 12:129840642-129840664 CAGGCCTTCCTCCAGCAAGGAGG 0: 1
1: 0
2: 2
3: 33
4: 351
1104560622_1104560627 2 Left 1104560622 12:129840614-129840636 CCAGGGCGGGGGCTGCGCAGCCT 0: 1
1: 0
2: 1
3: 39
4: 299
Right 1104560627 12:129840639-129840661 CCTCAGGCCTTCCTCCAGCAAGG 0: 1
1: 0
2: 4
3: 26
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104560622 Original CRISPR AGGCTGCGCAGCCCCCGCCC TGG (reversed) Intronic
900113854 1:1020460-1020482 TCGCTCCGCAGCCCCCGCTCCGG + Intronic
900126791 1:1072306-1072328 AGGCTGAGCAGCCGCCAGCCGGG + Exonic
900193302 1:1360469-1360491 AGGCTCCACAGTCCCAGCCCAGG - Intronic
900605629 1:3522413-3522435 AGGCTGTGCAGGCCCTGCCCAGG + Intronic
902169383 1:14598424-14598446 CGGTGGGGCAGCCCCCGCCCTGG - Intergenic
902769268 1:18636387-18636409 GGGCTGCGAGGCCCCAGCCCGGG + Intronic
902896884 1:19485409-19485431 AGGCCGCACGGCCCCCTCCCCGG - Intronic
904782932 1:32964389-32964411 AGGCTCCGCCGCCGCCGCCGCGG + Exonic
905198981 1:36303837-36303859 AGGCTCCTCGGCCCCGGCCCCGG - Exonic
905448945 1:38045183-38045205 AGGCTGCGTCGCCCGAGCCCCGG - Exonic
905670848 1:39789043-39789065 AGGCTGCGAGCCCCTCGCCCGGG - Intergenic
906169012 1:43707894-43707916 AGGCTCGGCGGCCCCCACCCAGG - Intronic
908501225 1:64745242-64745264 TGCCCGCGCAGCCCCGGCCCCGG - Exonic
908768226 1:67572892-67572914 ACCCTGCACAGCCCCGGCCCTGG + Intergenic
910679086 1:89843973-89843995 CGGCTCCGCAGCGCACGCCCAGG - Intronic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
913186428 1:116373772-116373794 GGGGCGCGCAGCCCCCGCCCAGG - Intronic
915302441 1:154959290-154959312 AGGCTGGGGAGCCCCTGACCAGG + Exonic
915354932 1:155250432-155250454 CGGCTGGGCGGCCCCCTCCCCGG + Exonic
915740937 1:158117977-158117999 GGGCTGCGCTGCCCCGGCACGGG - Intergenic
918314840 1:183314564-183314586 AGGCTGCTCTGCCCCTGACCTGG - Intronic
918423519 1:184386889-184386911 GGCCTCCGCAGGCCCCGCCCCGG + Intergenic
919855636 1:201704284-201704306 AGGCTCGGGAGCCACCGCCCAGG - Intronic
920306466 1:205021215-205021237 AGCCTGCACAGCCCAAGCCCAGG + Exonic
922722525 1:227906116-227906138 AGGCTTGGCAGCCCATGCCCAGG - Intergenic
923505321 1:234600299-234600321 AGACTGCGCTGCTCCAGCCCGGG + Intergenic
924567684 1:245211958-245211980 AGGCTTTTCAGCCCCCTCCCAGG - Intronic
1065188862 10:23192930-23192952 AGGCCGCGCAGCCGCGCCCCGGG - Exonic
1065687661 10:28302643-28302665 AGGCGGCCCCGCCCCTGCCCCGG + Intronic
1070158807 10:73853091-73853113 AGGCTCTCCAGCCTCCGCCCAGG - Intronic
1070670571 10:78374606-78374628 AGGCTTCCCTGCCCCAGCCCCGG - Intergenic
1071509880 10:86254840-86254862 CGGCTGCACAGCCCCAGCCAGGG + Intronic
1072003620 10:91220984-91221006 CAGCTCCGAAGCCCCCGCCCGGG - Intronic
1072294203 10:93993887-93993909 CGGCAGCGGGGCCCCCGCCCTGG - Intergenic
1072421106 10:95291067-95291089 GGGCGGAGCCGCCCCCGCCCTGG - Intergenic
1072628744 10:97131393-97131415 AGGCTGCGCCCACCCAGCCCTGG + Intronic
1072784003 10:98268269-98268291 AGGCCCCGCAGGCCCCGCCCCGG + Intergenic
1073207424 10:101776285-101776307 CGGCCGCCCCGCCCCCGCCCCGG - Intronic
1074826759 10:117220368-117220390 AGTCTAGGCAGCCCCCACCCAGG + Intergenic
1075020547 10:118948945-118948967 AGGATTCGCAGCCCCCTGCCAGG + Intergenic
1075144711 10:119873015-119873037 AGGCTGCGCAGCGCGGGGCCCGG + Intronic
1075724171 10:124603236-124603258 GGGCTGGGCAGGCCCAGCCCGGG + Intronic
1076328828 10:129650215-129650237 AGGCTGCTCAAGCCCCTCCCAGG - Intronic
1076366817 10:129926598-129926620 AGTCTGCCCAGCCCCCTCCCTGG - Intronic
1076756924 10:132577444-132577466 GGGCTGCGCATGCCCGGCCCCGG + Intronic
1076821808 10:132943319-132943341 GGGGCGCGCAGCCCCCGCGCGGG + Intergenic
1076882469 10:133246209-133246231 AAGCTGCGGGGCCCCCGCCCAGG + Intergenic
1077112305 11:867164-867186 AGGCTGCCCTGCCCCAGGCCTGG - Intergenic
1077152090 11:1077074-1077096 AGGCTGCCCAGCCCCCTTCCAGG - Intergenic
1077360415 11:2138177-2138199 AGCCCGCGCCGCCCCAGCCCCGG + Intronic
1077911603 11:6576874-6576896 AGGCTTCGCAGCCCCAGGTCAGG - Intronic
1081738697 11:45423208-45423230 ATGCTGCCCAGCCCCCACCAAGG - Intergenic
1082787268 11:57324121-57324143 GGGCTGGGCAGCTCCAGCCCCGG + Intronic
1084310296 11:68312783-68312805 CGGCTGCCCGGCCCCCGCCGCGG + Exonic
1084556675 11:69879874-69879896 AGGCTGGGCTGCCCCAGGCCTGG + Intergenic
1084562953 11:69914410-69914432 AAGATGCCCAGCCCCCTCCCTGG - Intergenic
1084610986 11:70203004-70203026 GGGCTGCGCCCTCCCCGCCCCGG + Intergenic
1085076647 11:73597825-73597847 AGGCTGCGGAGCCCCCGTGCAGG - Intronic
1087761819 11:102110676-102110698 CGGCCCCGCATCCCCCGCCCCGG - Exonic
1089207035 11:116772784-116772806 AGACGTCGCAGGCCCCGCCCCGG + Intronic
1089511125 11:118998033-118998055 CGGCTGCGCAGACTCCTCCCGGG - Intergenic
1089792501 11:120954945-120954967 AGGCTGGGCAGCCAGAGCCCTGG + Intronic
1089842123 11:121427379-121427401 GAGCTGCGCAGCCGCCGCGCCGG + Intergenic
1090439417 11:126713534-126713556 AGGCAGCGCAGCCCTGTCCCAGG - Intronic
1091178081 11:133579539-133579561 CTGCTGCGCAGCCCCCACCCTGG - Intergenic
1092820583 12:12350194-12350216 ATGCTCCGCAGCTCCCGCACCGG + Exonic
1094460845 12:30695651-30695673 GGGCCGCGGAGCCCCCACCCGGG - Exonic
1098288544 12:68933279-68933301 AGGCGGCTGAGGCCCCGCCCGGG - Intronic
1099848358 12:88058531-88058553 AAGCTGAGCAGCCTCAGCCCAGG + Intronic
1102480798 12:113221793-113221815 AGGGTGCAAAGCCCCGGCCCGGG - Intronic
1103505512 12:121440334-121440356 ATGCTGCGCAGCCTCTGCACTGG - Intronic
1103922646 12:124407086-124407108 AGGCTGTGAACCCCCAGCCCAGG - Intronic
1103930067 12:124445327-124445349 CGGCTGCCCCGGCCCCGCCCCGG + Intronic
1104012385 12:124940852-124940874 AGGAGGTGCAGCCACCGCCCAGG + Intergenic
1104560622 12:129840614-129840636 AGGCTGCGCAGCCCCCGCCCTGG - Intronic
1104828218 12:131730209-131730231 AGCCTGTGAAGCTCCCGCCCTGG + Intronic
1104947712 12:132424006-132424028 TGGATGCGTAGCTCCCGCCCTGG - Intergenic
1105004224 12:132711013-132711035 CGGCCGCGCGCCCCCCGCCCAGG - Exonic
1107434669 13:40371914-40371936 TGGCTGCACAGCCCCTGCTCTGG - Intergenic
1113484878 13:110646442-110646464 AGGCTGGGGAGGCCCAGCCCGGG + Intronic
1113661358 13:112108244-112108266 AGGCTGCCCAGGCCCAGCCAGGG - Intergenic
1113731007 13:112641552-112641574 AGGCTACGCAGCCCAGGCCCTGG + Intergenic
1113743903 13:112729514-112729536 AGGCAGCGCAGTCCCCACCTTGG + Intronic
1118748944 14:68792990-68793012 AGGCTGCGCCTTCCCCGCACCGG - Exonic
1119775068 14:77243139-77243161 GGGCTCCACAGCCCCCTCCCAGG - Intronic
1119835755 14:77747704-77747726 GTGCGGGGCAGCCCCCGCCCCGG + Intronic
1122128395 14:99591409-99591431 AGCCTCCGCAGCCCCAGGCCAGG - Intronic
1122871913 14:104642605-104642627 GGGCTGCCCAGCCCCAGGCCAGG - Intergenic
1123067431 14:105625678-105625700 CGGCTGTGCAGCCCCAGCCCAGG - Intergenic
1123071448 14:105644402-105644424 CGGCTGTGCAGCCCCAGCCCAGG - Intergenic
1123076405 14:105669457-105669479 CGGCTGTGCAGCCCCAGTCCAGG - Intergenic
1123096878 14:105771018-105771040 CGGCTGTGCAGTCCCAGCCCAGG - Intergenic
1123450809 15:20357971-20357993 GTGCTGCGCAGCCCCTTCCCTGG - Intergenic
1124689334 15:31808865-31808887 AGGCTGCGCAGGCCCCACACAGG + Intronic
1124983383 15:34583729-34583751 CGGCTGCCGAGCCCGCGCCCCGG + Intronic
1125594249 15:40874095-40874117 AGGCCGAGCCGCCCCCGCTCCGG - Exonic
1128331340 15:66757557-66757579 AGGCAGACCAGCCCCCGGCCTGG - Intronic
1129288679 15:74546352-74546374 CGGCTGGGCTGCCCCCGCCTTGG + Intronic
1129668649 15:77594171-77594193 ATCCTGCGCAGGCCCTGCCCAGG - Intergenic
1131290179 15:91100304-91100326 AGGCAGAGCAGCGTCCGCCCCGG - Exonic
1131833142 15:96366816-96366838 AGGCTGGGCAGCCGTGGCCCAGG + Intergenic
1132314433 15:100879825-100879847 ACACTGCGCAGCCCGCTCCCGGG - Exonic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132663835 16:1072903-1072925 TGTGTGCGCAGCCCCGGCCCGGG + Intergenic
1132671196 16:1102890-1102912 AGTCTCCGCACCCCCCCCCCCGG + Intergenic
1133784438 16:8963611-8963633 CGGCCCCGCAGCCCCGGCCCCGG - Intronic
1134441550 16:14302173-14302195 GGCCGGCCCAGCCCCCGCCCCGG + Intergenic
1136189397 16:28606671-28606693 AGGCCACCCAGCCCCCTCCCTGG - Intronic
1136267585 16:29130513-29130535 AGGAAGGGCAGCGCCCGCCCAGG + Intergenic
1136581011 16:31150605-31150627 AGCCTGCCCAGCCCCCTCCCAGG - Intergenic
1136775180 16:32867982-32868004 ACCCTGCTCAGCCCCAGCCCAGG - Intergenic
1136895437 16:33993530-33993552 ACCCTGCTCAGCCCCAGCCCAGG + Intergenic
1137505309 16:49049386-49049408 AGGCTGGGCAGCGCCCCCTCTGG + Intergenic
1139403026 16:66696908-66696930 CGGCTCCTCAGGCCCCGCCCTGG + Intergenic
1139576769 16:67847007-67847029 CTGCGGCCCAGCCCCCGCCCCGG - Intronic
1140310408 16:73842743-73842765 TGGTTGCGCAGCCCCTACCCTGG - Intergenic
1141262551 16:82467161-82467183 AGACTGCGGAGCCTCAGCCCAGG + Intergenic
1141419968 16:83908122-83908144 AGGATGCACAGCCTCAGCCCTGG - Exonic
1141423094 16:83929944-83929966 AGGCTGAGCTGCCTCCTCCCTGG + Intronic
1141608997 16:85170728-85170750 TGGCTGCACAGCCCGCCCCCAGG + Intergenic
1141629228 16:85277640-85277662 AGGCTGCCCAGCTGCAGCCCAGG - Intergenic
1141658515 16:85429195-85429217 AGGACACACAGCCCCCGCCCAGG + Intergenic
1142112653 16:88340585-88340607 GGGCTGGGCAGCACCCTCCCTGG - Intergenic
1142236897 16:88926694-88926716 AGGCTCAGCAGGCCCCACCCTGG - Intronic
1142284008 16:89164316-89164338 AGGCTGAGCAGCCACACCCCGGG - Intergenic
1203077598 16_KI270728v1_random:1130091-1130113 ACCCTGCTCAGCCCCAGCCCAGG - Intergenic
1142471951 17:169716-169738 AGGGTGTCCAGCCCCCACCCTGG + Intronic
1142474600 17:181482-181504 AGGCAGCGCCGCCCCGCCCCGGG + Exonic
1142586717 17:979038-979060 GTGCTGCGCTGCGCCCGCCCTGG - Intronic
1143148307 17:4790336-4790358 GGGCTGCGCGGCCCCACCCCGGG - Exonic
1143528268 17:7484698-7484720 AGCCTGCGCCGCCTCCGCCTAGG - Exonic
1143609717 17:8011025-8011047 AAGCAGAGCAGCCCCCGGCCAGG + Intronic
1144606096 17:16666900-16666922 AGGGAGCGATGCCCCCGCCCGGG + Intergenic
1144655448 17:17032350-17032372 AGGCTGGGCTGTCCCTGCCCTGG - Intergenic
1145954136 17:28842851-28842873 CGCCTGCGCAGCCCCTGCCGGGG + Intronic
1145976443 17:28986762-28986784 TGAGTGGGCAGCCCCCGCCCAGG - Intronic
1146947645 17:36884813-36884835 AGACGGGGCAGCCCCCGCCCAGG + Intergenic
1146956262 17:36937941-36937963 AGGCGGCGCCGCTCCAGCCCGGG + Exonic
1147171206 17:38620126-38620148 CAGCTGCCCAGCCCCCGTCCAGG + Intergenic
1147663265 17:42129003-42129025 AGGCTTTGCAGACCCAGCCCAGG + Intronic
1147879803 17:43646238-43646260 AGGACGCGCAGCCCCGGGCCGGG + Intronic
1148090266 17:45019112-45019134 ATGCCACGCTGCCCCCGCCCGGG - Intergenic
1149001104 17:51758566-51758588 AGGCTGCCCAGCCTCTGACCAGG + Intronic
1149685417 17:58531972-58531994 AGGCGGAGCCGGCCCCGCCCGGG - Intronic
1151572827 17:74935815-74935837 GGACTGCGCAGCCGCCGCTCGGG - Exonic
1151729801 17:75904577-75904599 AGGAGGCGCAGGCCCCGCACTGG - Exonic
1151767172 17:76138535-76138557 CGGCTGCCCAGCCCCCTCCCTGG - Intronic
1151797050 17:76353491-76353513 AGGCGCCGCCGCCCCCGGCCCGG + Intronic
1152007496 17:77691725-77691747 GGTCTGGGCAGCCCCAGCCCTGG - Intergenic
1152094279 17:78263927-78263949 TGGCTGCCCAGCCCCTGCCAAGG + Intergenic
1152337633 17:79707364-79707386 GTGCTGCGCAGCCCCTTCCCTGG + Intergenic
1152526155 17:80889382-80889404 AGGCTGCTCAGCCCCAGCCAGGG + Intronic
1152568435 17:81110745-81110767 AGGCTCCGCAGGCGCCGTCCAGG + Intronic
1152661753 17:81545637-81545659 AGGCTGCCAGGCCCCCACCCAGG + Intronic
1154196610 18:12271726-12271748 CGGCTGCGCAACCACCTCCCTGG + Intronic
1157581336 18:48775884-48775906 CGGCTGGGCAGCCTCAGCCCTGG - Intronic
1157794249 18:50560040-50560062 AGCCTGCGCCGCCGCCGCCTCGG - Intergenic
1160967616 19:1753535-1753557 AGGCTGCGCGGCGCACGGCCCGG - Exonic
1161103237 19:2431723-2431745 AGGGTGCCCAGACCCTGCCCAGG + Intronic
1161333750 19:3700202-3700224 CGACCGTGCAGCCCCCGCCCCGG + Intronic
1161616532 19:5274049-5274071 TGGCTGCGCAGCCTCCAGCCAGG - Intronic
1162778335 19:12993739-12993761 TGCGTGCGCACCCCCCGCCCTGG + Intergenic
1162926185 19:13931608-13931630 AGGCAGAGCAGGCCCAGCCCTGG + Intronic
1163124340 19:15236671-15236693 AGTCTGCGTGGCTCCCGCCCAGG + Exonic
1163125537 19:15242432-15242454 AGGCAGCTCAGAGCCCGCCCAGG - Intronic
1163587041 19:18169683-18169705 GGGCTGCGCGGCCCCAGCCTGGG + Exonic
1165075289 19:33276908-33276930 AGGCAGGGCAGCCCCTGCCTGGG + Intergenic
1165782151 19:38441103-38441125 TGGATCAGCAGCCCCCGCCCTGG - Intronic
1165922429 19:39307484-39307506 AGGCTGCCCCGCCCCCTCCCGGG + Exonic
1167424587 19:49423485-49423507 CGCCTCCGCAGCCCCCGCACCGG + Intergenic
1168101074 19:54141271-54141293 AGCCGCAGCAGCCCCCGCCCAGG - Intronic
925075864 2:1014980-1015002 ATGCAGCCCAGCCCCCTCCCGGG - Intronic
927357060 2:22186412-22186434 GGGCTGGGCAGGCCCCGCACAGG + Intergenic
927492094 2:23527333-23527355 ATGCTGCCCAGCCCCCACCCTGG - Intronic
927650803 2:24912517-24912539 AGGCTGGGCAGACCAAGCCCAGG + Intronic
927757343 2:25719635-25719657 AGACTGCCCAGACCCCACCCAGG - Intergenic
928015364 2:27651305-27651327 AGACTGCTCAGCCCACCCCCAGG - Exonic
928322960 2:30297821-30297843 AGGCCACGCAGCCCAGGCCCCGG + Intronic
929532484 2:42761737-42761759 AGGCTGAGGTGGCCCCGCCCAGG + Intergenic
929808405 2:45168995-45169017 GGGCTGGGCTGCCCCCGGCCGGG + Intergenic
929919910 2:46164584-46164606 AGGCAGGGCACCCCCCGCCCCGG - Intronic
929993892 2:46812905-46812927 AGGCTGTGGAGCCCCAGGCCAGG - Intergenic
930851573 2:55966642-55966664 AGGCTGCGCCGCCCCATCCCGGG + Intergenic
933707691 2:85304108-85304130 AGGCCTCCCTGCCCCCGCCCAGG + Intronic
933751177 2:85602763-85602785 AGTCCGCGCAGCCCCGGCCTCGG + Intronic
933829418 2:86195057-86195079 GGGCCGCGCTGCCCCCGTCCAGG - Intronic
934737227 2:96695672-96695694 GGGCTGCCCAGCCCCTGCCCTGG - Intergenic
934756517 2:96828225-96828247 AGGCTCTGCAGCCTCCACCCTGG - Intronic
934778924 2:96956745-96956767 AGGCTGAGCAGGGCCCGGCCTGG - Intronic
935692679 2:105745062-105745084 TGGCCGCGCTGCGCCCGCCCAGG - Exonic
938100386 2:128493993-128494015 AGGCTTCGCTGCGCCCACCCTGG + Intergenic
945988190 2:216371525-216371547 AGCCGGAGCAGCCCCCGCCCCGG - Exonic
946354860 2:219178291-219178313 GGGCTGCGCGGCCGCCGCCGGGG - Exonic
947025908 2:225737824-225737846 AGGCTAGGCAGCACCTGCCCTGG - Intergenic
948208920 2:236178277-236178299 AGGCAGCGCCTCTCCCGCCCCGG - Intergenic
948464068 2:238143812-238143834 CGGCTGGGCAACCCCCACCCTGG + Intronic
948566386 2:238889949-238889971 AGGCTGGGCAGCCTCCACCCAGG - Intronic
948566393 2:238889974-238889996 AGGCTGGGCAGCCTCCGCACAGG - Intronic
949000477 2:241610263-241610285 AGCCTCCGCCGGCCCCGCCCCGG + Intronic
1168970391 20:1926848-1926870 AGGCTGGGCAGACCCCTCCAGGG - Intronic
1169209258 20:3756519-3756541 GGGCTGGGCAGCCCCATCCCTGG + Intronic
1170591625 20:17776054-17776076 AGGCTGCCCTGCCCATGCCCAGG + Intergenic
1172310717 20:33916119-33916141 AGGCTGCGCAGGCCTGGCCTTGG + Intergenic
1172528565 20:35616004-35616026 ATGCGGCGAAGCTCCCGCCCGGG + Exonic
1172614667 20:36275311-36275333 AGGGTGTGCAGCCCCCACCAGGG + Intergenic
1173800475 20:45891643-45891665 AGGCGAGGCAGCCCCCGACCAGG + Exonic
1174395254 20:50243191-50243213 AAGGTGCGCAGCCCTGGCCCTGG - Intergenic
1174436459 20:50510499-50510521 AGGAGGCGCAGCAGCCGCCCTGG + Exonic
1175561325 20:59933354-59933376 ACTCTGCACAGCCCACGCCCTGG + Intronic
1175767028 20:61598885-61598907 AGGCTGCGCAGTGTCAGCCCTGG - Intronic
1175776892 20:61659412-61659434 GGGCTGCGCTGCCCCCCACCTGG + Intronic
1175902074 20:62363880-62363902 AGGCTCCCAAGACCCCGCCCTGG + Intronic
1175975144 20:62707351-62707373 AGGCTGAGGAACCCCCTCCCGGG - Intergenic
1175985005 20:62760325-62760347 AGACAGAGCAGCCCCCACCCGGG + Exonic
1176207196 20:63895440-63895462 CGCCCGCGCAGCCCCGGCCCGGG - Intronic
1178467285 21:32859529-32859551 TGACTGTGCAGCCCCCACCCTGG - Intergenic
1178485871 21:33020004-33020026 GGGCTGCGCAGCGCGCGCCCGGG - Intergenic
1179209507 21:39313410-39313432 AGGCCGTGCCACCCCCGCCCTGG - Intronic
1179255389 21:39711345-39711367 AGTCTGGGCAGCCCCCACCCTGG - Intergenic
1179591534 21:42412374-42412396 AGCCTGCACAGCCCCTGGCCCGG - Intronic
1179968396 21:44819388-44819410 TGGTTGCGGAGCCCCCTCCCAGG - Intergenic
1180027573 21:45176552-45176574 AGACTGCGCAGCCCGGGCCTTGG - Exonic
1180191722 21:46168518-46168540 GGGCTGTGCAGCCCCCTCCCAGG - Exonic
1180763109 22:18223714-18223736 AGGCTGGGCAGGCCCCGGGCGGG - Intergenic
1180772536 22:18400833-18400855 AGGCTGGGCAGGCCCCGGGCGGG + Intergenic
1180803916 22:18650449-18650471 AGGCTGGGCAGGCCCCGGGCGGG + Intergenic
1180806847 22:18719000-18719022 AGGCTGGGCAGGCCCCGGGCGGG - Intergenic
1180967345 22:19797601-19797623 AGCCAGCGCAGCCCTCACCCTGG + Intronic
1181061406 22:20283777-20283799 AGGCTGGGCAGCACAGGCCCCGG - Intergenic
1181309760 22:21938260-21938282 AGGGGGCGCCGCCACCGCCCAGG - Intronic
1181407338 22:22694382-22694404 AGGCTGGGCAGGCTCCTCCCAGG - Intergenic
1181415338 22:22755149-22755171 AGGCTGGGCAGGCTCCTCCCAGG - Intronic
1181631947 22:24156125-24156147 CGGTTGCGCAGCCCCAGCCCCGG - Intronic
1181936621 22:26443240-26443262 AGTCTGCCCAGGCCCCGCCTCGG - Exonic
1183162480 22:36124116-36124138 GCGCTGCGCAGCCGCAGCCCGGG - Intergenic
1184037633 22:41926240-41926262 AGGCGGCGCTGCCCCTGCCCGGG - Exonic
1185333947 22:50263291-50263313 ACCCTGCCCAGCCCCCACCCAGG + Intergenic
1185392416 22:50569836-50569858 ATGCTGCCCAGACCCCGCCAAGG + Intronic
1203234374 22_KI270731v1_random:141821-141843 AGGCTGGGCAGGCCCCGGGCGGG + Intergenic
953026505 3:39148235-39148257 AGGCTTGGCACCCCCCTCCCAGG + Intronic
954144970 3:48630022-48630044 GGGCTGCCCAGTCCCTGCCCTGG + Intronic
954367499 3:50154496-50154518 TGGCTGGGCTGCCCCCGACCTGG + Intergenic
954469004 3:50675402-50675424 AGGCTGCGCGGCCTCGGCGCGGG + Intronic
954632830 3:52056383-52056405 GGGCTGCCCGGCCCCGGCCCCGG - Exonic
954645827 3:52130989-52131011 TGGGTGAGCAGCCCCTGCCCTGG - Intronic
954652975 3:52176439-52176461 AGGCTGAGCAGCCAGAGCCCTGG - Intergenic
954677825 3:52325385-52325407 AGGCTGCCCAGAGCCCACCCAGG + Intronic
954696214 3:52428380-52428402 AGGCTGAGCACCCCAGGCCCGGG - Intergenic
955514976 3:59717457-59717479 TGGCTGAGCAGCCCCAGACCAGG + Intergenic
958779312 3:98522634-98522656 CGGCTGCCCCGCCCCAGCCCTGG - Intronic
960048847 3:113221930-113221952 TGGCTGGGCAGCCTCCTCCCAGG + Intronic
961873308 3:130003210-130003232 GGGCGGCGCAGGCCCCGGCCCGG - Intergenic
962240350 3:133746540-133746562 AGGCTGCGCGGTGGCCGCCCGGG - Intronic
966816721 3:183895922-183895944 CGCCTGAGCAGCCCCAGCCCTGG - Intergenic
967839961 3:193997288-193997310 TGGCTGCCCGGCCCCCACCCTGG - Intergenic
968435802 4:588348-588370 AGACTGCCCAGACCACGCCCAGG - Intergenic
968450456 4:673869-673891 AAGCCGAGCAGACCCCGCCCCGG + Intronic
968582435 4:1401351-1401373 AGGCTGCCCTGCCCCCGGGCTGG + Intergenic
968614523 4:1571367-1571389 AGGCTGGGCAGCCAGCGGCCTGG - Intergenic
968633677 4:1666546-1666568 ATGCTGCGTAGCCACCTCCCTGG + Intronic
969209009 4:5672107-5672129 AGGCTCCCCAGCCTCAGCCCAGG - Intronic
969519916 4:7670729-7670751 AGGCTTCCCATCCCCCACCCCGG + Intronic
969633543 4:8352405-8352427 AGGCTGTCCAGCAGCCGCCCAGG - Intergenic
971877701 4:32326345-32326367 AAGCTGGGCAGCCCCCACTCGGG + Intergenic
972686753 4:41360241-41360263 AGGCGGGGCAGCCCCTGGCCCGG - Intronic
982745879 4:159103651-159103673 GGCTTGCGCAGCCGCCGCCCAGG - Intergenic
985694760 5:1333896-1333918 AGGCTGCCCAGCTCCGCCCCTGG + Intronic
985718436 5:1475877-1475899 GGGCTGCACAGGCCCCGCCCAGG + Intronic
986307799 5:6528661-6528683 CGGCTGGGCATCCCCCACCCTGG + Intergenic
989379282 5:40797936-40797958 GGGCTGGGCAGCCCCTGTCCCGG - Intronic
989732383 5:44664356-44664378 CAGCTGCGCAGCCACCGCTCGGG + Intergenic
995224751 5:109689951-109689973 TAGCTGCGCGGCCCCGGCCCGGG + Exonic
995594233 5:113731124-113731146 ATGCTGCCCTTCCCCCGCCCAGG + Intergenic
997228941 5:132228837-132228859 AGGCTGGGCATCTCCCGCTCTGG - Intronic
997979164 5:138458448-138458470 AAGCTGAGCAGCCCCGGCGCTGG + Intergenic
1001412536 5:171521055-171521077 AGGCAGGGCAGCCTCTGCCCAGG + Intergenic
1001664344 5:173420343-173420365 AAGCTGAGCAGCCCTCGCTCAGG + Intergenic
1001766080 5:174248188-174248210 AGGCTGGTCACCCCACGCCCAGG - Intergenic
1002530396 5:179841090-179841112 AGGGTGTCCAGCCACCGCCCAGG + Intronic
1003116517 6:3287130-3287152 AGGCAGCGCAGCCCCTGGCATGG - Intronic
1003152999 6:3568568-3568590 AGGCTTGGCAGCCCCTCCCCTGG - Intergenic
1003545013 6:7051855-7051877 GCGCCGCGCAGCCCCCGGCCCGG + Intergenic
1003963293 6:11229357-11229379 GGGCCGCTGAGCCCCCGCCCGGG + Intronic
1004203898 6:13574324-13574346 AGGCCGCGGAGACCCCGGCCCGG - Intergenic
1004241416 6:13925259-13925281 CGGCTGCGGAGCGCCCGCGCGGG + Intronic
1007451140 6:41941081-41941103 GGGCTCGGCCGCCCCCGCCCGGG - Intronic
1012063027 6:94511711-94511733 AGGCAGCGCAGCTGCGGCCCTGG - Intergenic
1013381219 6:109573242-109573264 AGGCTGCTCTGCCCCAGCACTGG - Intronic
1013793710 6:113860504-113860526 AGCCTGCGCAGCCCCCTCACAGG + Exonic
1014925686 6:127267237-127267259 GGGCGCCGCAGCCCCTGCCCTGG + Intronic
1017811631 6:157988103-157988125 AGCCTGCTCAGCCCCCTCCCAGG + Intronic
1018033993 6:159866486-159866508 AGGCTCCTCAGCCCCCCCACTGG - Intergenic
1018856561 6:167679087-167679109 AGCCAGCGCAGCCCCCGGCCAGG - Intergenic
1019475266 7:1241356-1241378 AGGCTGACCCACCCCCGCCCCGG - Intergenic
1019475793 7:1243754-1243776 AGGTTGGGCGGCCCCCGCCCCGG + Intergenic
1019686306 7:2384023-2384045 GGGCTCCCCAGCCCCCTCCCTGG + Intergenic
1020201179 7:6081380-6081402 GGGCGGCGCAGCCACAGCCCCGG + Intergenic
1020224996 7:6272722-6272744 AGGCCGCGCAGCCCCGCCCTCGG + Intergenic
1022519442 7:30996486-30996508 AGGCTGCACAGCCCCAGCCCTGG + Intergenic
1024521124 7:50304727-50304749 TGACTGCGCGGCCCGCGCCCGGG + Intronic
1026911196 7:74092916-74092938 AGGCTCCTCAGCCTCGGCCCTGG - Intronic
1032027633 7:128456099-128456121 CGGCGGCGCACCCCCAGCCCTGG - Intronic
1032109820 7:129066459-129066481 AGCCTGAGCAGCCGCCGCCATGG - Intergenic
1033288591 7:140062661-140062683 GGGCGGCGCAGCCGCGGCCCCGG - Exonic
1034088255 7:148339693-148339715 AGGGTGCGCTGCTCCAGCCCGGG + Intronic
1034272292 7:149809112-149809134 AGGCTGCGCAGCTGCTGCCTCGG - Intergenic
1034346200 7:150386781-150386803 AGGCTGCACAGCTCCTGGCCAGG + Intronic
1034996121 7:155578225-155578247 AGGATGCTCAGCCCCCAGCCTGG + Intergenic
1035459259 7:159029261-159029283 AAGCTGCCCAGCCCTGGCCCAGG - Exonic
1037547698 8:19939968-19939990 CTGCGGCTCAGCCCCCGCCCGGG + Intronic
1037769465 8:21789924-21789946 CGGCTGCGGAGCCCCGGCCCGGG - Intronic
1037849733 8:22317144-22317166 AGGCAGCACAGCCCCAGCCTTGG - Intronic
1037882623 8:22580331-22580353 AGCCTGGGCAGCCCCCTCCTGGG + Intronic
1041269142 8:56093817-56093839 AGGCTGGGCAGCCCCCGGGAAGG - Intergenic
1044734432 8:95265064-95265086 AGGCTGAGAAACCCCCGCCTAGG - Intronic
1049487655 8:142874908-142874930 ATGCTGCCCAGACCCCGCCCAGG + Intronic
1053188329 9:36037402-36037424 AGGGTGCGATGCCCCCGCCCAGG + Intronic
1056732610 9:89178651-89178673 CGGCCGCGCAGCCCCGGCCCGGG + Exonic
1056755187 9:89377197-89377219 AGGCTGCACAGCCTCCGCTAAGG + Exonic
1057220664 9:93256221-93256243 AGGCTACCCTGCCCCTGCCCAGG + Intronic
1057436877 9:95048623-95048645 AGTCCGCGCTGCCGCCGCCCAGG + Intronic
1057883063 9:98807826-98807848 CGGCTCGGCAGCCCCGGCCCCGG - Exonic
1060152515 9:121298043-121298065 AGGCTGGGCAGGCCCAGGCCTGG + Intronic
1060316991 9:122521041-122521063 AGGCCACGCAGCCACCACCCTGG - Intergenic
1060970027 9:127732534-127732556 TGGCTCAGCAGCCCCCTCCCGGG - Intronic
1061163132 9:128907374-128907396 GGGCTGGGCAGCCCCTGGCCCGG + Exonic
1061591110 9:131598166-131598188 AGGCTGCAAAGCCCCAGCCCGGG + Intronic
1061892878 9:133631979-133632001 AGGCCTGGCAGCCCCAGCCCTGG + Intergenic
1062133754 9:134913947-134913969 AGCCTGCCCTGCCTCCGCCCTGG + Intronic
1062232172 9:135487706-135487728 AGGCTGGGCAGGCCCCGGGCGGG - Exonic
1062278543 9:135741924-135741946 ACCCTGCCCAGCCCCCGACCAGG + Intronic
1062467740 9:136688513-136688535 GGGCTCAGCAGCCCCTGCCCAGG + Intergenic
1185761238 X:2691192-2691214 CGGCTGCGCCCGCCCCGCCCCGG - Exonic
1189391648 X:40581296-40581318 ACGCAGCCCAGCCCCGGCCCCGG - Intronic
1190108214 X:47573802-47573824 AGGCTCCGCACCCCCACCCCAGG - Intronic
1190758638 X:53422267-53422289 TTCCTGCGCGGCCCCCGCCCCGG - Intronic
1192709339 X:73563484-73563506 AGGAAGCGCCGCCCCCGCCTCGG + Exonic
1195726933 X:107927440-107927462 AGGCTGACCACCCCCCGCTCTGG - Intergenic
1200093615 X:153647237-153647259 AGCCCGCGCAGCCCGCGCACCGG - Exonic
1202195608 Y:22296281-22296303 AGGCCTCTCAGCCCCAGCCCTGG - Intergenic