ID: 1104561557

View in Genome Browser
Species Human (GRCh38)
Location 12:129850049-129850071
Sequence TTTCAAATCCACAAATATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 453}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104561557_1104561562 21 Left 1104561557 12:129850049-129850071 CCCATATATTTGTGGATTTGAAA 0: 1
1: 0
2: 1
3: 35
4: 453
Right 1104561562 12:129850093-129850115 TCTTTCTGAAGGTATTTTGTGGG 0: 1
1: 0
2: 1
3: 31
4: 358
1104561557_1104561561 20 Left 1104561557 12:129850049-129850071 CCCATATATTTGTGGATTTGAAA 0: 1
1: 0
2: 1
3: 35
4: 453
Right 1104561561 12:129850092-129850114 TTCTTTCTGAAGGTATTTTGTGG 0: 1
1: 0
2: 3
3: 58
4: 494
1104561557_1104561560 10 Left 1104561557 12:129850049-129850071 CCCATATATTTGTGGATTTGAAA 0: 1
1: 0
2: 1
3: 35
4: 453
Right 1104561560 12:129850082-129850104 TAGACTTAGTTTCTTTCTGAAGG 0: 1
1: 0
2: 0
3: 16
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104561557 Original CRISPR TTTCAAATCCACAAATATAT GGG (reversed) Intronic
901367967 1:8770102-8770124 TTTTAAGTACACTAATATATTGG + Intronic
901552865 1:10009043-10009065 TTTCCCATTCACAAATAAATTGG + Intronic
902393989 1:16122491-16122513 TTGCAAATCCACAAAAATCTGGG - Intergenic
906848452 1:49220711-49220733 TTTTGAAGCCACAAAGATATAGG + Intronic
907179339 1:52555382-52555404 TTTCAACTCGACAACTATGTAGG - Intergenic
907847979 1:58227111-58227133 TTTCAAACGCAGAAATATCTGGG + Intronic
908320700 1:62975432-62975454 TTTTAAACTCATAAATATATGGG + Intergenic
909336108 1:74475874-74475896 TGTAAAAACCACAAATATAAAGG + Intronic
909567758 1:77073989-77074011 TTTTAAATTTCCAAATATATAGG + Intergenic
909967269 1:81930650-81930672 TTTGTAATCAGCAAATATATTGG + Intronic
910033366 1:82759420-82759442 TTTCAAGTCTAGAATTATATAGG - Intergenic
910761276 1:90734178-90734200 CTTCAAATCCACAAAGACATTGG - Intergenic
910882572 1:91935512-91935534 TTCAGAATCCACAAATATAGAGG - Intergenic
911968281 1:104395719-104395741 TTTTAAAAACACAGATATATAGG + Intergenic
912077707 1:105897113-105897135 CTTCATATCAACAAATATACAGG - Intergenic
913659146 1:120991285-120991307 ATTCAAATGCAAAAATGTATTGG + Intergenic
914010510 1:143774410-143774432 ATTCAAATGCAAAAATGTATTGG + Intergenic
914167313 1:145186703-145186725 ATTCAAATGCAAAAATGTATTGG - Intergenic
914649131 1:149683069-149683091 ATTCAAATGCAAAAATGTATTGG + Intergenic
914978301 1:152387763-152387785 ATTCAAATCCAGAACAATATAGG + Intergenic
915185271 1:154099535-154099557 CTTAAAATCCATAAGTATATAGG + Intronic
916289684 1:163151166-163151188 TTTGAAATCAACAAAAATCTGGG + Intronic
917165209 1:172104309-172104331 ATAAAAATCCACAAAAATATTGG - Intronic
917367297 1:174246454-174246476 TGTAGAATCCACAAATATAGTGG - Intronic
918302011 1:183213372-183213394 ATTCAAATCGATAAAGATATCGG - Intronic
919138823 1:193544513-193544535 TTCCAAATCCACAGTTATTTAGG + Intergenic
919346231 1:196382735-196382757 TTTCTAATACACAGAGATATGGG - Intronic
919496717 1:198281601-198281623 TTTAAAATGCAAAGATATATAGG + Intronic
920969576 1:210731695-210731717 GTTCAAATACACAAATGTCTTGG + Intronic
923465505 1:234244728-234244750 TTTCAATTCCACATTTATACTGG + Intronic
923674818 1:236071092-236071114 TTTCTAATTAATAAATATATTGG + Intergenic
923886144 1:238158591-238158613 TTTAAATTCCACAAATAAGTGGG + Intergenic
924957038 1:248939602-248939624 TTTAAAATCTCCAAAAATATTGG - Intergenic
1063571964 10:7223616-7223638 TTTGAAATCAACAAATTTATTGG - Intronic
1064270388 10:13859959-13859981 TCTCATATCCAAAAATAAATGGG + Intronic
1064786750 10:18906187-18906209 TTTGAAGTCCCCAAATATATAGG + Intergenic
1064869033 10:19916726-19916748 TTTCTAATCCACAGATCTATGGG - Intronic
1065256030 10:23868838-23868860 TTTCAAATATTCAAAAATATGGG - Intronic
1066322750 10:34321059-34321081 TTTCAAAAGCTCAAATAAATTGG + Intronic
1066692371 10:38043006-38043028 GTTCAAATCCACAATTATTGTGG - Intronic
1068118839 10:52764143-52764165 TTTAAAATACTCAAATATTTAGG + Intergenic
1068342920 10:55732558-55732580 TTTCATATCCAAAAGCATATGGG - Intergenic
1068389586 10:56377295-56377317 AGACAAATCCACAAATATAGTGG - Intergenic
1068447723 10:57144442-57144464 TTTAAAATTTACAAATGTATAGG - Intergenic
1070266957 10:74912686-74912708 TTTCAAAATCACAAATACAAAGG + Intronic
1071350692 10:84740453-84740475 TTTAAAATCCACAATTTTAGTGG - Intergenic
1071796649 10:89014577-89014599 TTAAAAATCTACAAATATGTTGG - Exonic
1072991577 10:100200547-100200569 TTTCCTTTCCCCAAATATATTGG - Intronic
1073804093 10:107077424-107077446 TTTCAAATTCATAAATGTAAAGG + Intronic
1073982885 10:109175063-109175085 TTTCAAGTCCAAAAATAATTTGG - Intergenic
1074947511 10:118295583-118295605 TTTCAAATAAATAAATATTTAGG - Intergenic
1075581534 10:123622421-123622443 TGTCAAAACCACAGATTTATTGG + Intergenic
1076962944 10:133781445-133781467 TTTAAAATCTCCAAAAATATTGG - Intergenic
1078370808 11:10743383-10743405 TTTCAAATTAAAAAATAGATGGG - Intergenic
1078773989 11:14377263-14377285 TCTCAAATCTACACACATATGGG + Intergenic
1078984994 11:16585071-16585093 CTGCAAATCAACAAATCTATTGG - Intronic
1079990082 11:27237506-27237528 TTTCTAAAGCACAAATATAAAGG + Intergenic
1080149977 11:29040819-29040841 TTTAAAATACACATACATATTGG - Intergenic
1080708450 11:34721781-34721803 TTGCAAAACCACAAATTCATGGG - Intergenic
1081474898 11:43419458-43419480 TTACAAATCTACAAAAATTTAGG - Intronic
1082114213 11:48310169-48310191 TGTCAAGTCCATAAATCTATGGG - Intergenic
1083094882 11:60240625-60240647 TTTTAAAGCCCCAAGTATATTGG + Intronic
1083125469 11:60561216-60561238 TGGCAAATCCTCAAAGATATAGG - Intergenic
1083359284 11:62094676-62094698 TTTCCGATCCACATATATTTTGG - Intergenic
1083360160 11:62101340-62101362 TTTCCAATCCACATATATTTTGG + Intergenic
1084994252 11:72959953-72959975 TTTTAAAAGCACAGATATATAGG + Intronic
1086212941 11:84342715-84342737 TTTAAACTCAACACATATATAGG + Intronic
1086464600 11:87040056-87040078 TTTCAAATACACAGATGTAAGGG - Intronic
1086968779 11:93057744-93057766 TTTCAAAATCAGAAATATGTAGG + Intergenic
1087115119 11:94516272-94516294 TTTTAAACTCACATATATATGGG - Intergenic
1087126453 11:94631265-94631287 TTTTAAATCCACAAGTAAACAGG + Intergenic
1087480620 11:98695238-98695260 TATCAAATTCTCAAATATGTTGG + Intergenic
1088017295 11:105076566-105076588 CTTCTAATCCACAAATATTTTGG - Intronic
1088236197 11:107726146-107726168 TTTCAAATATATAAATATTTTGG + Intergenic
1088393064 11:109336824-109336846 TTTCAAGCACATAAATATATTGG - Intergenic
1089856400 11:121548865-121548887 ATTCAATTCAACAAATATTTAGG - Intronic
1090113069 11:123937363-123937385 TTTAAAATACACAAATAATTGGG - Intergenic
1090257294 11:125294242-125294264 TTTCATTTCCACAAGTATTTAGG + Intronic
1090260775 11:125317828-125317850 CTTCAAATCCACAAAAAAACAGG - Intronic
1093221363 12:16424333-16424355 TTTTCAATTCAAAAATATATTGG + Intronic
1093435212 12:19129258-19129280 TTTTAAAACGATAAATATATTGG + Intergenic
1093816968 12:23560350-23560372 TTACTAATCCACATATTTATTGG + Intronic
1094120100 12:26963783-26963805 TTTTTAATCCACAAATATTTAGG + Intronic
1097439628 12:59593610-59593632 TTTCAAATAGCCTAATATATTGG + Intergenic
1097751322 12:63356925-63356947 TTTAAATTCAAGAAATATATAGG - Intergenic
1099083195 12:78212140-78212162 TTACTTATCCAAAAATATATTGG - Exonic
1099830069 12:87830680-87830702 TTTCTATTTCACAAATAAATTGG - Intergenic
1100478293 12:94953960-94953982 TTTGAATTCTACAAATATCTTGG - Intronic
1100902295 12:99255746-99255768 ATTTAAATTCATAAATATATGGG + Intronic
1101523761 12:105508468-105508490 TTTAAAATACAATAATATATAGG + Intergenic
1101638727 12:106569530-106569552 TTTAAAATGCACAAATAACTGGG - Intronic
1102524198 12:113499669-113499691 TTTCAAAACCACAGACATTTGGG + Intergenic
1102640451 12:114362042-114362064 TTCCAAATCCACAAAGAAGTGGG + Intronic
1104503186 12:129305189-129305211 TTTCAATTCAACCAATATTTAGG - Intronic
1104561557 12:129850049-129850071 TTTCAAATCCACAAATATATGGG - Intronic
1106693132 13:32141075-32141097 TTTCAGATCTACAAAAATAAAGG + Intronic
1108741601 13:53344362-53344384 TTTAAAATCCAAATTTATATTGG - Intergenic
1109552840 13:63927480-63927502 ATGAAACTCCACAAATATATAGG + Intergenic
1109619586 13:64885327-64885349 TTTCAAGTTTACAAATATATTGG + Intergenic
1109706370 13:66098062-66098084 TTTCAATTGCAAGAATATATTGG - Intergenic
1109736199 13:66487278-66487300 TTACAAGTACAAAAATATATAGG + Intronic
1109743994 13:66596475-66596497 TTTGAAATTTACACATATATGGG - Intronic
1109788614 13:67217038-67217060 TTTCAAATACACAGCTACATAGG - Intronic
1110025950 13:70539331-70539353 TATCAAATTGAAAAATATATTGG - Intergenic
1110082944 13:71340399-71340421 TTTGTCATCCACAAATATGTGGG - Intergenic
1110111254 13:71748730-71748752 TTTCAAAAACAAAAACATATGGG + Intronic
1110373046 13:74760679-74760701 TTTCAACTCAACAAATTGATGGG + Intergenic
1111650081 13:91079826-91079848 TTTCAATTCCAAATATCTATAGG + Intergenic
1112140773 13:96639402-96639424 TTTCAAAGACACAAATAGGTTGG - Intronic
1112684838 13:101813004-101813026 TTTGAAATGCACAAAAGTATAGG - Intronic
1114403093 14:22428060-22428082 TTACACATCCACAAACACATAGG + Intergenic
1114670019 14:24405851-24405873 TTTAAAATTAAGAAATATATAGG - Intronic
1115492124 14:33967716-33967738 ATTCAAATCCACAATGATTTGGG - Intronic
1115721884 14:36171019-36171041 TTTCAACTACATAAATAAATTGG + Intergenic
1115848051 14:37559070-37559092 TTTCAAATTCATCAATATGTTGG - Intergenic
1115901901 14:38161020-38161042 TTTTAAAACCACAAATTTAAAGG + Intergenic
1116247996 14:42442369-42442391 TTTCATATCCACAAATTCAAAGG + Intergenic
1116387819 14:44353924-44353946 TTTAATATCCACAAATACCTTGG + Intergenic
1117247741 14:53902465-53902487 TTTCTAATCCATAAACATTTTGG + Intergenic
1118898526 14:69967166-69967188 TTTCAAATCCTCCTAAATATGGG - Intronic
1120165939 14:81200109-81200131 TTTTAAATTCACAAATATCGAGG - Intronic
1120518866 14:85502895-85502917 TTTCAAATCCATTAAAAGATAGG + Intergenic
1120754972 14:88234297-88234319 TTGCAAATCTGCAAATATATTGG - Intronic
1121880621 14:97497326-97497348 TTTCTAATCCTAAAATCTATGGG - Intergenic
1122470567 14:101963494-101963516 TTTTAAATACACATAGATATAGG + Intergenic
1124128832 15:26967187-26967209 TTTCAAACCCAAAAATCCATTGG + Intergenic
1125038626 15:35156995-35157017 TTACAAATCCAAAATTATAGTGG - Intergenic
1126189856 15:45868004-45868026 TTTCAAGTCACCAAGTATATGGG - Intergenic
1126204214 15:46024849-46024871 TTTCAAAGTCACACATATATGGG - Intergenic
1126249177 15:46546433-46546455 TTTTAAATTTTCAAATATATGGG + Intergenic
1126472028 15:49022740-49022762 TATTAAATTCCCAAATATATTGG - Intronic
1126586489 15:50292957-50292979 TTTCAAACCCACAGAAAAATTGG - Intronic
1126863370 15:52909446-52909468 TTAAGAATCTACAAATATATGGG - Intergenic
1126941430 15:53770196-53770218 TTTGAAATCCATAAATATTATGG - Intergenic
1127181446 15:56423363-56423385 TGGAAAATCCACAAATATGTGGG - Intronic
1127375337 15:58379270-58379292 TTTAAAAGACACAAATAAATGGG + Intronic
1128085047 15:64880345-64880367 TCTCAAATAAACAAATAAATAGG + Intronic
1130457949 15:84132818-84132840 TTTCAAATGCACCAATATTATGG - Intergenic
1130622643 15:85479581-85479603 TTCCAAATCCACAAAAAAATAGG - Intronic
1130777197 15:86996912-86996934 TTTTAAATCAAAATATATATTGG - Intronic
1130826648 15:87554367-87554389 TTTCATTTCTACAAATTTATGGG + Intergenic
1132240064 15:100250900-100250922 TTTAAAGTCCATAAATAAATTGG + Intronic
1137374019 16:47936499-47936521 TTTTAAATCTCCAAATATTTTGG + Intergenic
1138020094 16:53471028-53471050 TTTAAAATGCACAACTAAATGGG + Intronic
1138134810 16:54512347-54512369 TTTCAAATCCACATAAATAAAGG - Intergenic
1138252753 16:55516421-55516443 ATTCAAATACACAAATAGGTTGG + Intronic
1138480837 16:57302288-57302310 ATTCAAAGACACACATATATTGG - Intergenic
1139145634 16:64321499-64321521 TTTCTAGACCAGAAATATATTGG + Intergenic
1139271204 16:65684636-65684658 TTTCAACTCCAAAAATAAATAGG - Intergenic
1143229720 17:5342894-5342916 TATCAAATTTACACATATATAGG - Intronic
1143689076 17:8545456-8545478 TTTCAAATCCAGCAATATCCAGG + Exonic
1146496321 17:33325639-33325661 TTTTAAAACCACAAGTATAAGGG - Intronic
1147400191 17:40176358-40176380 TTCCAAATCCACAAACAGATGGG + Intergenic
1148077386 17:44946540-44946562 TTTAATCTTCACAAATATATGGG - Intronic
1148449151 17:47763314-47763336 AGACAAATCCACAATTATATTGG - Intergenic
1149258200 17:54850843-54850865 TTGCAAATCCAGAAACATAAGGG - Intergenic
1149690625 17:58572757-58572779 TTTTTAAACCACAAATATATTGG + Intronic
1150089349 17:62308467-62308489 TTTTAAAACCACATATATTTGGG + Intergenic
1151005561 17:70432250-70432272 TTTCAAAAAAAAAAATATATTGG - Intergenic
1151698973 17:75732420-75732442 TTTGAAATACAGAGATATATGGG + Intronic
1152952087 17:83243674-83243696 TTTAAAATCTCCAAAAATATTGG - Intergenic
1153295235 18:3539638-3539660 TTACAAATCAAAACATATATGGG + Intronic
1153470270 18:5436723-5436745 TTTCAAATCCAGGTATATGTGGG + Intronic
1153558111 18:6339036-6339058 GAACAAACCCACAAATATATTGG + Intronic
1153719016 18:7882503-7882525 TTCTAAATCCACAAATTTAAAGG + Intronic
1153738057 18:8093581-8093603 TTGCAAATGCACAAATAAACTGG - Intronic
1156157220 18:34317250-34317272 TTGCAAATTCTGAAATATATTGG - Intergenic
1157428020 18:47600770-47600792 TTTCTAATCCACACATCTCTAGG - Intergenic
1158115054 18:53986047-53986069 CTCCAAATCCACAAAGAAATAGG + Intergenic
1159912594 18:74160621-74160643 TTGCAAATTCACAAATATGACGG - Intergenic
1163967306 19:20758785-20758807 CTACAAACCCCCAAATATATTGG + Intronic
1164235663 19:23331095-23331117 GTGCAAATACACAAATATTTAGG - Intronic
1166580752 19:43896615-43896637 TTTCAAATACAAAAATTCATTGG + Intronic
1168728075 19:58601892-58601914 TTTAAAATCTCCAAAAATATTGG - Intergenic
925458020 2:4034691-4034713 TTTTAAATATACACATATATAGG + Intergenic
926391419 2:12397632-12397654 TCTCCATTCCACAAAGATATTGG + Intergenic
926941839 2:18145711-18145733 TTTCAAATCCTGATATAGATAGG - Intronic
927378747 2:22452350-22452372 TAGCAAATAAACAAATATATGGG - Intergenic
927447969 2:23182274-23182296 AGACAAATCCACAATTATATTGG + Intergenic
928821761 2:35370068-35370090 TTTCATCTCCATAATTATATGGG + Intergenic
928992945 2:37254980-37255002 TTTCAAATGTACCATTATATAGG - Intronic
929164815 2:38871135-38871157 TTAAAAATCCACATTTATATTGG + Intronic
929930605 2:46252803-46252825 TGTCCATTCTACAAATATATGGG - Intergenic
930601519 2:53449223-53449245 ATTCACATCCACATATGTATTGG - Intergenic
931164283 2:59729680-59729702 TTTCAATTCCACTAAGATTTAGG + Intergenic
931173063 2:59825397-59825419 ATTCAAATAAACAAATATTTTGG - Intergenic
931484082 2:62672541-62672563 TTTTAGATCAACACATATATGGG - Intergenic
931586063 2:63830232-63830254 TTTCAGGACCACAAATATTTAGG - Intergenic
931620241 2:64202900-64202922 TTTCACATTCACAACTATAGTGG + Intergenic
931928912 2:67106714-67106736 TTAAGAATCCTCAAATATATTGG + Intergenic
932617202 2:73240725-73240747 TTTCATATCCATTAATACATTGG + Intronic
933106019 2:78326470-78326492 TTCCAAACACACAAATATGTGGG + Intergenic
934523681 2:95035429-95035451 TCTCAGATCCACAAATCTAGGGG - Intronic
935442657 2:103120088-103120110 TTTTAAATACAAACATATATGGG + Intergenic
935688984 2:105713481-105713503 TTTCACATCCACAAAGACAGAGG + Intergenic
935939648 2:108224792-108224814 TTATAAATTCCCAAATATATAGG + Intergenic
936245015 2:110819176-110819198 TTTCAACTGCACCAATCTATTGG - Intronic
936570478 2:113609113-113609135 TTTAAAATCTCCAAAAATATTGG + Intergenic
936791175 2:116154534-116154556 GTTTAAATCTTCAAATATATTGG + Intergenic
937683962 2:124675328-124675350 ATTCAAACACACAAATATGTTGG - Intronic
937721428 2:125101198-125101220 TGTTAAATACACAAATATTTGGG - Intergenic
938584665 2:132678390-132678412 TTTGAATTTCACAAATAGATTGG - Intronic
939572378 2:143855747-143855769 TTTCAATTCTTCAAAGATATAGG + Intergenic
940182531 2:150951801-150951823 TTTTAAATTGAAAAATATATGGG - Intergenic
940223676 2:151379802-151379824 TTTCAAATGCAAATACATATAGG - Exonic
940338429 2:152553795-152553817 CTTCAAATCCAAAAAAAAATTGG + Intronic
940392325 2:153146693-153146715 TTTCAAATACACAAAGATTCTGG + Intergenic
940614254 2:156030173-156030195 TTTCAAATCAACACAAATACTGG - Intergenic
940626336 2:156179946-156179968 TCTGAAATCCACCAATACATAGG - Intergenic
940714858 2:157209889-157209911 GTACAAATCCACAATTATAGTGG - Intergenic
940762236 2:157750829-157750851 TTAAAAATACACAAATAAATTGG + Intronic
940865402 2:158812873-158812895 TTTCAATTCTTCCAATATATGGG - Intronic
941021972 2:160417198-160417220 TTTCAAAACCATGAATATCTGGG + Intronic
941207486 2:162592084-162592106 TTTCAATTTAACAAAAATATAGG + Intronic
942856252 2:180552855-180552877 TTTTAAGTCCACAAAAATCTGGG + Intergenic
943138032 2:183940445-183940467 TTGAAAATGCACAAATACATGGG + Intergenic
943923608 2:193742172-193742194 TTGCAAATGCAAAAAAATATAGG + Intergenic
943924349 2:193753097-193753119 TGTCATATTCACAAATATAGTGG - Intergenic
944382300 2:199125484-199125506 TTTCAAAGCTAACAATATATTGG - Intergenic
944968642 2:204965971-204965993 TTGAAAATCCACTAATATCTTGG + Intronic
945016414 2:205522826-205522848 TTTCAATTTTACAAATATTTAGG + Intronic
945077735 2:206056945-206056967 TTTAAAATACACACATACATGGG + Intronic
945290513 2:208122561-208122583 TTTAAAATACAGAAATATAAGGG + Intronic
945310292 2:208304625-208304647 TTTAAAATGAAGAAATATATTGG - Intronic
946908310 2:224436809-224436831 TTTGAAATCCACTAAGTTATGGG + Intergenic
947245039 2:228037401-228037423 TTTCCAATACAAAAATATGTAGG - Intronic
947925387 2:233917053-233917075 TTTAAAAACCACAAATAAAATGG - Intergenic
949088338 2:242177537-242177559 TTTAAAATCTCCAAAAATATTGG - Intergenic
1170020511 20:11832249-11832271 TTTCACATTAACAAATATAGTGG - Intergenic
1170769644 20:19321051-19321073 TTTGGAATCCACAGATATAGAGG + Intronic
1170773610 20:19356160-19356182 TTTCAGATACAAAAACATATAGG + Intronic
1173095510 20:40024144-40024166 TTTCAAATCTTTAAATATCTGGG - Intergenic
1173130883 20:40392137-40392159 TTTCAGATCCATAAATACAGTGG + Intergenic
1173399895 20:42715926-42715948 GTGCAAATCCAGAGATATATGGG + Intronic
1174750941 20:53111001-53111023 TTTGAAAACCACAGATAGATAGG - Intronic
1175683298 20:61006906-61006928 TATTCAATCCAGAAATATATTGG - Intergenic
1176884893 21:14243809-14243831 TTTCAAATCCAACAATCTCTGGG - Intergenic
1177335071 21:19713350-19713372 TTTTTAATCCACAAAAATAATGG - Intergenic
1177738778 21:25127273-25127295 TTTCAATTCCACAAGATTATAGG + Intergenic
1177945510 21:27464676-27464698 TTTCAGATACAAAAATAAATTGG - Intergenic
1178165772 21:29974966-29974988 TTTAAAAGCCAGAAATATTTTGG + Intergenic
1178449533 21:32683624-32683646 TTTCATATGTACAATTATATAGG - Intronic
1180263500 21:46693498-46693520 TTTAAAATCTCCAAAAATATTGG - Intergenic
1181450897 22:23019886-23019908 TTTAAAAAACCCAAATATATAGG - Intergenic
1182639641 22:31756470-31756492 ATTCCACTCCACAAATATTTAGG - Intronic
1182964250 22:34506524-34506546 ATTCAAATGCAAAAATATACTGG - Intergenic
1183639226 22:39083170-39083192 TTACAAAACCACAATTATAAAGG - Intronic
1184056849 22:42058398-42058420 TTTCAAATACAAAAATAAAATGG - Exonic
1185429730 22:50801859-50801881 TTTAAAATCTCCAAAAATATTGG - Intergenic
949633281 3:5953049-5953071 TTTCAAAATGACAAATATAAAGG + Intergenic
951127224 3:18997877-18997899 TTTGAATTCAACAAATATTTAGG - Intergenic
951423744 3:22518309-22518331 TTTGAAATCCTCATATATTTGGG - Intergenic
952362431 3:32644265-32644287 TTTAACATCTAGAAATATATGGG - Intergenic
952776270 3:37049508-37049530 TTTCAAATCAACATATATTTTGG + Intronic
953349567 3:42205062-42205084 TTTCACAACCACAACTAAATAGG - Intronic
953631526 3:44622154-44622176 TTTAAAATCCCCAAATGTACTGG - Intronic
953808005 3:46088475-46088497 TTTTAAATCTAAAAATAAATAGG - Intergenic
954281279 3:49580240-49580262 TATCAAAACCACACATAAATTGG - Intronic
955011581 3:55021806-55021828 TTTAAAATGTCCAAATATATGGG + Intronic
955896906 3:63710082-63710104 TTTCAAATCCCCAAACATTGAGG + Intergenic
956294643 3:67698620-67698642 TTTTAGATACACATATATATAGG - Intergenic
957034638 3:75282385-75282407 TTTCAAGTCCACAAAATAATGGG + Intergenic
957272191 3:78045323-78045345 TTTCATAAACTCAAATATATCGG - Intergenic
957482120 3:80811774-80811796 TTGCAAATACACAGCTATATAGG - Intergenic
957494516 3:80974494-80974516 TTTCAAGTACACAAATACAATGG - Intergenic
957768773 3:84660461-84660483 TTTCATATGCACAAATCTTTTGG + Intergenic
958024097 3:88029572-88029594 TTTAAAATCTCCAAACATATGGG - Intergenic
958115495 3:89211404-89211426 TTTTAAATAAATAAATATATAGG + Intronic
958498895 3:94880209-94880231 TTTCAAATCCAGAGAGATATAGG - Intergenic
958999294 3:100943102-100943124 TTTTAAATCTCTAAATATATTGG - Intronic
959016871 3:101144576-101144598 ATTTAAATCCACAAAAATGTTGG + Intergenic
959339138 3:105106045-105106067 TATCAAATCCACAAACATGACGG - Intergenic
959340725 3:105126585-105126607 TTTTAAATTCAAAAATCTATAGG + Intergenic
959709082 3:109366972-109366994 TTTTAAATATAAAAATATATTGG - Intergenic
960819565 3:121714182-121714204 TTCCAAACTCACAAACATATTGG - Intronic
961304969 3:125952477-125952499 TTTCAAATCCACAAAATGATGGG - Intergenic
962884871 3:139615011-139615033 TTTAAAACCAATAAATATATTGG - Intronic
963383103 3:144557009-144557031 TATCTAATCCACAGATATTTGGG - Intergenic
963459000 3:145582551-145582573 TTACAAATCAACAAAAAAATGGG + Intergenic
963825329 3:149947049-149947071 AGGCAAATCCACAAATGTATAGG - Intronic
964181087 3:153887288-153887310 TTTTAAATCCTCGAATTTATGGG - Intergenic
964903048 3:161683276-161683298 TTACAAATGCACAAGTATTTTGG + Intergenic
965852200 3:173041602-173041624 TTTGATATGAACAAATATATAGG - Intronic
966305035 3:178522025-178522047 TTTTACATGCCCAAATATATAGG + Intronic
966937603 3:184722759-184722781 TTTCAAATGTCCAATTATATGGG - Intergenic
969271133 4:6103385-6103407 TATCAAATCCAGCAATACATAGG - Intronic
970630678 4:17940377-17940399 TTTTAAATGCATGAATATATAGG + Intronic
971692303 4:29852505-29852527 TTTCTAAAACACATATATATGGG + Intergenic
972078244 4:35114836-35114858 TTTCAAATTTACATATATATTGG - Intergenic
972357425 4:38293456-38293478 TTTCAAATCCAGAAATTCCTGGG - Intergenic
972982138 4:44717897-44717919 TTTCAAATCAAAAGCTATATTGG - Intronic
973198102 4:47468237-47468259 TTCCAGTTCCAGAAATATATAGG + Intergenic
974391792 4:61279957-61279979 TATCAAATGTACAAATACATAGG + Intronic
974698250 4:65402543-65402565 TTTCAAAAACACAGATTTATTGG + Intronic
974729787 4:65847275-65847297 TTACAAATGAACAAAAATATAGG + Intergenic
974978304 4:68919973-68919995 TTTCAACTCCACACATTTAATGG - Intergenic
975216135 4:71757628-71757650 TTTCAAATGCACAATGGTATTGG - Intronic
975231816 4:71944532-71944554 TTTCAAAGCCCCAAAGATATCGG + Intergenic
975732616 4:77352642-77352664 TTACTAATCCACAAACATCTTGG + Intronic
976030616 4:80749037-80749059 TTTCACATTCACTATTATATAGG + Intronic
976452032 4:85200864-85200886 TTTAAAATACACAAAAATAGAGG - Intergenic
976572529 4:86629611-86629633 TTTCATATCTACAAAAACATTGG + Intronic
976702059 4:87980909-87980931 TTTCAAATTGACAAATATATTGG - Intronic
977357551 4:95966630-95966652 GGTCAAATCCAGAAAGATATTGG - Intergenic
978538449 4:109788275-109788297 TTTAATATCCAGAAAGATATTGG + Intronic
978691204 4:111513243-111513265 TTTTAAATTCATCAATATATTGG - Intergenic
979111812 4:116767661-116767683 TTTGATATCCAAAAATATTTTGG + Intergenic
979496367 4:121387914-121387936 TTAAAAATACACAAATAAATGGG + Intergenic
980178165 4:129372154-129372176 TTTATAAACCAGAAATATATTGG - Intergenic
980428148 4:132654185-132654207 TATCAAATCCAGAAGTTTATTGG + Intergenic
980878741 4:138687935-138687957 CTTCAAATCTACAAATAGTTAGG + Intergenic
980888752 4:138791674-138791696 TTAAAAATTGACAAATATATAGG - Intergenic
980905576 4:138945379-138945401 TTTGGGATCCACAAACATATTGG - Intergenic
981267922 4:142808894-142808916 TAACAAATCCACAATTATTTAGG - Intronic
981877042 4:149559244-149559266 TTTCAAAAATACAAATCTATTGG + Intergenic
982534481 4:156592577-156592599 TTTCAATTCTACATATAAATGGG + Intergenic
983308570 4:166025718-166025740 TTTTAAATCTTAAAATATATGGG - Intronic
983411992 4:167411814-167411836 TTTCTAAATCACAAATATAAAGG - Intergenic
983453551 4:167935042-167935064 TTTCATATCCACAAATAATGTGG - Intergenic
984151474 4:176138305-176138327 TTTTAAAACCCCAAATATATAGG - Intronic
984265244 4:177490515-177490537 TTACATATCCAAAAATATTTAGG - Intergenic
984318734 4:178163167-178163189 TATTAAATACACAAATATTTGGG - Intergenic
985466165 4:190198740-190198762 TTTAAAATCTCCAAAAATATTGG - Intergenic
985705511 5:1399190-1399212 TTTTAAATTGCCAAATATATGGG - Intronic
986286958 5:6366257-6366279 TTTCAAAGCCACACACATACTGG - Intergenic
986660457 5:10055128-10055150 ATTCAAATTGACAATTATATGGG + Intergenic
987001307 5:13663144-13663166 CTTAAAATCGACAAGTATATAGG - Intergenic
987536542 5:19196547-19196569 TTTAAAAACCAACAATATATGGG + Intergenic
987658859 5:20846178-20846200 TTTCCAACCCAGAAATATACAGG - Intergenic
988123345 5:26996393-26996415 TTCCAAAACCACAAAATTATTGG - Intronic
988764822 5:34359790-34359812 TTTCCAACCCAGAAATATACAGG + Intergenic
988971577 5:36473677-36473699 TTTCAAATACATGAATATACTGG + Intergenic
989487138 5:42004307-42004329 TTTAAAATCAACAAATTTAATGG - Intergenic
989769354 5:45125032-45125054 TTTTAAATAGACAAATATATGGG + Intergenic
990126313 5:52522502-52522524 TTCCAAAATCACAAATATATGGG - Intergenic
990273450 5:54170760-54170782 GTTCATATCCAGAAATAGATGGG - Intronic
990735170 5:58852572-58852594 TTTCAATTTCAGAAATATTTAGG + Exonic
990926011 5:61023643-61023665 TTTAAAACCCTCACATATATAGG + Intronic
990927560 5:61044971-61044993 TTTAAAATACACAAATAAATGGG - Intronic
991378575 5:65992992-65993014 ATTCAACCACACAAATATATTGG - Intronic
991382917 5:66051026-66051048 TAACAAATACATAAATATATAGG + Intronic
992315143 5:75544685-75544707 TGACAAACCCAGAAATATATGGG + Intronic
993501235 5:88669686-88669708 TTGCAAATTCACACAGATATGGG - Intergenic
993548654 5:89245560-89245582 TTTCAAATCAACAAATTACTTGG - Intergenic
993583577 5:89695213-89695235 TATTCAATCCACAAATATTTAGG + Intergenic
993705896 5:91169932-91169954 TTTCAGCTCAACAAATTTATTGG - Intergenic
994325760 5:98442979-98443001 TTAAAAATCCACAAATCTCTAGG + Intergenic
994554406 5:101279842-101279864 TTTCCAGTCCACAAAGTTATTGG + Intergenic
995509813 5:112897259-112897281 TTTAAAATGTGCAAATATATTGG - Intronic
995718591 5:115105445-115105467 TTTGAACTACACCAATATATTGG - Intergenic
995980624 5:118098693-118098715 TTTCAAATCTAAAAATTCATAGG + Intergenic
996076847 5:119205210-119205232 TCCCAAATACCCAAATATATCGG - Intronic
996148224 5:120001335-120001357 TTTCAAATTAGCAAATATGTTGG - Intergenic
996290662 5:121848526-121848548 TTTAAAATGTCCAAATATATTGG - Intergenic
997172650 5:131739127-131739149 TTTCCACTCCACAGATATATAGG + Intronic
997322300 5:132988530-132988552 TTTCAAATAAATAAATAGATAGG - Intergenic
997502958 5:134392728-134392750 TTTCAAATTCACAAATACGGTGG + Intergenic
997799080 5:136841809-136841831 TTACAAATACACAAATTTTTAGG + Intergenic
998339250 5:141402314-141402336 TTTTACATTTACAAATATATAGG + Intronic
999184583 5:149697196-149697218 ATTCAAAACCACAAAAATGTAGG + Intergenic
999574290 5:152957550-152957572 TTTCAAAACTATAAAAATATAGG + Intergenic
999894245 5:156011952-156011974 TTTCATATCCACAAACAGAATGG - Intronic
1002746117 5:181475075-181475097 TTTAAAATCTCCAAAAATATTGG - Intergenic
1003711181 6:8592076-8592098 TTTGAAAGCCACAAATTTAGTGG - Intergenic
1003986960 6:11444939-11444961 TTGAAAATCCACAAATATTTGGG - Intergenic
1004012164 6:11700490-11700512 TATAAAATACACACATATATAGG + Intergenic
1005126175 6:22449128-22449150 TTTCAAATCTGCAAATAGGTAGG - Intergenic
1007557760 6:42781710-42781732 TTTCAACTTCAGAAATGTATTGG - Intronic
1007966460 6:46007935-46007957 TTTCATTTGCACAAATTTATGGG + Intronic
1008015184 6:46510739-46510761 TATCAATTCCACAAATATTGAGG + Intergenic
1009349089 6:62652302-62652324 TTTCTTTTCCACTAATATATGGG + Intergenic
1009499873 6:64397989-64398011 TGTCAAATTCACAAATACACAGG + Intronic
1009652699 6:66496588-66496610 GCTGAAATCCTCAAATATATTGG - Intergenic
1009678893 6:66864871-66864893 TTTTAAAGACACAAATAAATGGG + Intergenic
1009728407 6:67564512-67564534 TTTAAAATCCAAAAACATAATGG + Intergenic
1009841299 6:69078497-69078519 TTTAAATTCAACAAATATCTTGG + Intronic
1009988976 6:70817684-70817706 TTTAAAATCAACAAAGAGATGGG - Intronic
1010064542 6:71666486-71666508 CCTCAAATCCTCAAATACATAGG - Intergenic
1010684394 6:78835571-78835593 TATCAAATCCAATAATATGTAGG + Intergenic
1011249399 6:85354738-85354760 TTTCAAATACATAATTACATTGG - Intergenic
1011273834 6:85607999-85608021 GCTAAAACCCACAAATATATTGG + Intronic
1011316083 6:86032834-86032856 TTTTAAATTAACAAATATGTGGG + Intergenic
1011961011 6:93090074-93090096 TTTCAAATCCAAACAAAAATTGG - Intergenic
1011978194 6:93334743-93334765 ACTCAAATCCACAAATATCAAGG + Intronic
1012153751 6:95790485-95790507 TTTCAAAACCAAAAATCCATAGG + Intergenic
1012658014 6:101850210-101850232 TTTCAAATTCACCACTAGATTGG + Intronic
1013865060 6:114686554-114686576 TTTGGTATCCACAAATATGTGGG + Intergenic
1013889358 6:115007655-115007677 TTTAAAATCTAGAAACATATGGG - Intergenic
1014731027 6:125031530-125031552 TTTCAGTTCCACAAATCTCTAGG + Intronic
1016955469 6:149622600-149622622 TTGCAATTCAACAAATATTTTGG - Intronic
1017612514 6:156204622-156204644 TTTTAAATTAACAAATAAATAGG + Intergenic
1019031099 6:169013083-169013105 TTTCAAAAGAACATATATATGGG - Intergenic
1021274872 7:18638016-18638038 TTTCATAGCAACAAATATTTTGG + Intronic
1021480725 7:21113147-21113169 AATCAAATCCCTAAATATATGGG + Intergenic
1022043468 7:26602766-26602788 AGCCAAATCCACAAATAAATAGG - Intergenic
1022149628 7:27588071-27588093 TTTCTAATGCACAAATCTTTAGG + Intronic
1022625291 7:32029821-32029843 TTTAAAATGCACAAATGTATTGG - Intronic
1022627011 7:32047399-32047421 TTTTAAATCCACATATTTAAGGG - Intronic
1023114195 7:36844934-36844956 TTTTAAATCCACATTTATTTTGG + Intergenic
1023352276 7:39332708-39332730 TTTAAAATCCAAAAAGATTTTGG - Intronic
1023648774 7:42346943-42346965 TTTTAAAACCACATTTATATTGG + Intergenic
1024142141 7:46472324-46472346 CTTCAAATCTAAACATATATGGG + Intergenic
1024588014 7:50857803-50857825 TTTCAAATTTTCAAATATTTTGG + Intergenic
1025065421 7:55850741-55850763 TTTTATATACACAAATATAGAGG + Intronic
1025224600 7:57146028-57146050 TTTAAAACTCACAAATATGTGGG - Intergenic
1025959528 7:66207668-66207690 TTTGAAAACCATAAATATATAGG - Intronic
1026219361 7:68379480-68379502 TTTCAAATGCACATAAATATAGG + Intergenic
1027703926 7:81505486-81505508 TTCCCAATCCACAAATAGAAGGG + Intergenic
1027930504 7:84527967-84527989 TTTTTAATCTACAAGTATATAGG - Intergenic
1027931721 7:84545527-84545549 TTTCAAATAAATAAATAGATGGG + Intergenic
1028886063 7:95934494-95934516 TTACATATCCACAAATAAAATGG + Intronic
1029167770 7:98606370-98606392 TTACTTATCCACACATATATTGG + Intergenic
1029826032 7:103195761-103195783 TTCTAAAGCAACAAATATATTGG + Intergenic
1030004191 7:105099149-105099171 CTTAAAATACACAAATATTTTGG - Intronic
1030688842 7:112512283-112512305 TTTTAAATCCACAGATAGAAAGG - Intergenic
1031458635 7:122016779-122016801 TTTCAAAGCAACATGTATATGGG - Intronic
1031833509 7:126654540-126654562 TTTCAAGTCCACATAAATACTGG - Intronic
1031885761 7:127244599-127244621 TTTCAAACCCATATATAAATAGG - Intronic
1033406792 7:141077334-141077356 TTTAAAATCCGTTAATATATAGG + Intronic
1033594548 7:142848021-142848043 TTTAAATTCAACAAAAATATAGG - Intergenic
1033680591 7:143591321-143591343 TTTTAAATTTACAAATATTTAGG - Intergenic
1033704303 7:143870491-143870513 TTTTAAATTTACAAATATTTAGG + Intronic
1033774585 7:144593451-144593473 TTTGAAATTCACAGAGATATCGG + Intronic
1034150522 7:148911512-148911534 TTCTAAATCCACTAATATTTTGG + Intergenic
1034615492 7:152412907-152412929 TTCCAAATCTACAATGATATAGG + Intronic
1035817264 8:2554484-2554506 TTTAAAATGCAAAATTATATTGG - Intergenic
1036067104 8:5393332-5393354 ATTCAAATCCACATAAATAAAGG + Intergenic
1037087793 8:14874499-14874521 TATCAAACCCACATAAATATTGG + Intronic
1038088424 8:24226392-24226414 TTTGAAATCCAGAAATATTCAGG + Intergenic
1038891307 8:31727556-31727578 TTTCAATTCTTCAAATGTATAGG + Intronic
1039744829 8:40415216-40415238 TTTCATATACATATATATATTGG - Intergenic
1040364017 8:46695518-46695540 TTTTATATACACAAATATAGAGG - Intergenic
1041626374 8:60033282-60033304 TCTCAAGTTCACAAATACATAGG - Intergenic
1041798889 8:61776412-61776434 GTTTAAATGCACAAATCTATCGG + Intergenic
1041925871 8:63235771-63235793 TATTAATTCAACAAATATATAGG + Intergenic
1042081924 8:65063050-65063072 TTTCAAGTCCTAAAATAAATGGG + Intergenic
1042520370 8:69705071-69705093 TTTCACATCCAACAATAAATAGG + Exonic
1042977403 8:74485229-74485251 TTCCAAATCCAAAGATTTATAGG + Intronic
1043209872 8:77498937-77498959 TGTCAAAACCACACATATTTTGG + Intergenic
1043641526 8:82457173-82457195 TATCAAAGACACAAATAGATTGG + Intergenic
1044476762 8:92635899-92635921 GGTCACATTCACAAATATATTGG + Intergenic
1044551163 8:93514048-93514070 TTTTAAATCAATAAATATATTGG + Intergenic
1045531389 8:102988455-102988477 TTTCAAATACATGAATATACTGG - Intergenic
1046444616 8:114301533-114301555 TTGTGAATACACAAATATATGGG - Intergenic
1046504101 8:115115001-115115023 TTTTAAATCAATAAATAAATAGG - Intergenic
1047261535 8:123265443-123265465 TTACAAATCCACAAAAATCACGG + Intronic
1047389652 8:124439861-124439883 TCTCAAAACCACAAAAATAAAGG + Intergenic
1047792238 8:128215935-128215957 TCTCAAAGTCATAAATATATTGG - Intergenic
1050492125 9:6199047-6199069 TTTGAAAACCACCAATCTATAGG - Intergenic
1051190906 9:14511296-14511318 TGTAAAATCCTCAAAAATATGGG - Intergenic
1051346898 9:16159938-16159960 TTTTAAATACACATATAAATTGG + Intergenic
1052066484 9:24027715-24027737 TTTCAAAACCACAGAAATGTTGG - Intergenic
1052454030 9:28671084-28671106 TTTCCCATACACAAATATGTAGG + Intergenic
1052540008 9:29798833-29798855 TTTCAAAAACACAAATACTTGGG - Intergenic
1052620793 9:30906769-30906791 TTTCAATATGACAAATATATAGG + Intergenic
1052797319 9:32935034-32935056 TTGCAAATAAACAATTATATTGG + Intergenic
1053049613 9:34949051-34949073 AGTCAAATCCACAAGTATACTGG + Intergenic
1054961131 9:70970865-70970887 TTTCAAATGAAAAAATGTATAGG - Intronic
1055016356 9:71622648-71622670 TCTCAAGTCAACAAATCTATTGG + Intergenic
1056346654 9:85703214-85703236 TTTCAAATCCTCAAAAAACTAGG - Intronic
1056575708 9:87854871-87854893 TTGCAGATCAACAAATATAGGGG - Intergenic
1056653053 9:88485227-88485249 TTACAGATACACATATATATGGG + Intergenic
1056827460 9:89886478-89886500 TTTCAAATCCACAAATTCTTTGG + Intergenic
1056874797 9:90317715-90317737 TGTGAAATGCACAAATATAAAGG - Intergenic
1057719254 9:97518894-97518916 GGACAAATCCACAAATATCTGGG + Intronic
1059020240 9:110568680-110568702 TTACAAATGCACAAGTTTATGGG + Intronic
1059088368 9:111329445-111329467 TTACAAACTCACAAAGATATGGG - Intergenic
1060203285 9:121665667-121665689 CTTGAAAACCACAAAAATATAGG - Intronic
1060366651 9:123022779-123022801 TTTTAAATTCACAAATATTATGG - Intronic
1060837610 9:126768595-126768617 TTTAAAATCCTCAAATATTTTGG + Intergenic
1203580586 Un_KI270745v1:41129-41151 TTTAAAATCTCCAAAAATATTGG - Intergenic
1185877927 X:3714653-3714675 TTTCAAATCCACACGGATATGGG - Intergenic
1185914060 X:4015437-4015459 TTTCAAAACTATAAAAATATTGG - Intergenic
1186080888 X:5930578-5930600 TTTCAAAGCCACCAATTAATTGG + Intronic
1186102536 X:6172198-6172220 TTTCAGAAGAACAAATATATAGG - Intronic
1186484122 X:9920288-9920310 TTTCACCTCCACAACTCTATCGG - Intronic
1187808980 X:23154683-23154705 TTTCTAAGCACCAAATATATAGG - Intergenic
1187912538 X:24124084-24124106 TTTCATATACACAAATGTCTAGG - Intergenic
1189656211 X:43247435-43247457 TTTCAAAATTACAAATATCTAGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1191186224 X:57615213-57615235 TTTCAAGTCCCAAAATATATTGG - Intergenic
1192134454 X:68583717-68583739 TTCCAAATCCATGAATATGTGGG + Intergenic
1193515702 X:82459851-82459873 TTTCAATTCAAATAATATATTGG + Intergenic
1194717265 X:97301617-97301639 TTTCAAATCCAGAGATTTGTGGG + Intronic
1196849462 X:119923989-119924011 TTTCAATTCAACAAATCTGTGGG + Intergenic
1196894464 X:120321434-120321456 CTTCAAATCCACATATGTAGGGG + Intergenic
1197547633 X:127845119-127845141 TTACAAATTAACTAATATATAGG - Intergenic
1198027574 X:132722826-132722848 TTTCAAATATTCAAACATATAGG + Intronic
1198200185 X:134408712-134408734 TTTCAAATAAATAAATAAATTGG - Intronic
1201651483 Y:16293428-16293450 TTTCTAAACCACAAAAACATTGG + Intergenic