ID: 1104563396

View in Genome Browser
Species Human (GRCh38)
Location 12:129859012-129859034
Sequence TGCCCTAGTAACGGAGTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 35, 2: 45, 3: 31, 4: 20}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104563387_1104563396 5 Left 1104563387 12:129858984-129859006 CCCTTGGAGTCCGGGGGAACGGG 0: 2
1: 0
2: 0
3: 3
4: 54
Right 1104563396 12:129859012-129859034 TGCCCTAGTAACGGAGTCCGGGG 0: 1
1: 35
2: 45
3: 31
4: 20
1104563389_1104563396 4 Left 1104563389 12:129858985-129859007 CCTTGGAGTCCGGGGGAACGGGA 0: 2
1: 0
2: 0
3: 5
4: 100
Right 1104563396 12:129859012-129859034 TGCCCTAGTAACGGAGTCCGGGG 0: 1
1: 35
2: 45
3: 31
4: 20
1104563392_1104563396 -5 Left 1104563392 12:129858994-129859016 CCGGGGGAACGGGATGGGTGCCC 0: 91
1: 20
2: 1
3: 14
4: 145
Right 1104563396 12:129859012-129859034 TGCCCTAGTAACGGAGTCCGGGG 0: 1
1: 35
2: 45
3: 31
4: 20
1104563380_1104563396 25 Left 1104563380 12:129858964-129858986 CCGGGGGAACGGGATGGGTGCCC 0: 91
1: 20
2: 1
3: 14
4: 145
Right 1104563396 12:129859012-129859034 TGCCCTAGTAACGGAGTCCGGGG 0: 1
1: 35
2: 45
3: 31
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104563396 Original CRISPR TGCCCTAGTAACGGAGTCCG GGG Intronic
900881107 1:5381959-5381981 TGCCCTGGTAACAGACCCCGCGG + Intergenic
915557736 1:156669717-156669739 TGCCCTGGAAACGGAGTCCCAGG - Exonic
1065603408 10:27392461-27392483 TGCCCTATTAACTGACTCTGTGG - Intergenic
1104562146 12:129855086-129855108 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562156 12:129855121-129855143 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562167 12:129855156-129855178 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562177 12:129855191-129855213 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562188 12:129855226-129855248 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562200 12:129855261-129855283 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562211 12:129855296-129855318 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562222 12:129855331-129855353 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562233 12:129855366-129855388 TGCCCTTGTAACGGAGTCCAGGG + Intronic
1104562245 12:129855401-129855423 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562256 12:129855436-129855458 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562267 12:129855471-129855493 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562277 12:129855506-129855528 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562288 12:129855541-129855563 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562300 12:129855576-129855598 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562312 12:129855611-129855633 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562324 12:129855646-129855668 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562334 12:129855681-129855703 TGCCCTTGTAACAGAGTCCAGGG + Intronic
1104562346 12:129855716-129855738 TGCCCTTGTTACGGAGTCCGGGG + Intronic
1104562357 12:129855751-129855773 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562369 12:129855786-129855808 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562380 12:129855821-129855843 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562392 12:129855856-129855878 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562403 12:129855891-129855913 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562414 12:129855926-129855948 TGCCCTTGTAACGGAGTCCAGGG + Intronic
1104562426 12:129855961-129855983 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562437 12:129855996-129856018 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562449 12:129856031-129856053 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562460 12:129856066-129856088 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562471 12:129856101-129856123 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562482 12:129856136-129856158 TGCCCTTGTAACGGAGTCCAGGG + Intronic
1104562494 12:129856171-129856193 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562506 12:129856206-129856228 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562517 12:129856241-129856263 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562529 12:129856276-129856298 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562540 12:129856311-129856333 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562551 12:129856346-129856368 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562562 12:129856381-129856403 TGCCCTTGTAACGGAGTCCAGGG + Intronic
1104562574 12:129856416-129856438 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562586 12:129856451-129856473 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562597 12:129856486-129856508 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562608 12:129856521-129856543 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562619 12:129856556-129856578 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562631 12:129856591-129856613 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562642 12:129856626-129856648 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562653 12:129856661-129856683 TGCCCTTGTAACGGAGTCCAGGG + Intronic
1104562664 12:129856696-129856718 TGCCCTTGTAACGGAGTCCAGGG + Intronic
1104562675 12:129856731-129856753 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562693 12:129856795-129856817 TGCCCTTGTAACAGAGTCCAGGG + Intronic
1104562705 12:129856830-129856852 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562715 12:129856865-129856887 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562726 12:129856900-129856922 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562738 12:129856935-129856957 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562749 12:129856970-129856992 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562760 12:129857005-129857027 TGCCCTTGTAACGGAGTCCAGGG + Intronic
1104562772 12:129857040-129857062 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562783 12:129857075-129857097 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562795 12:129857110-129857132 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562806 12:129857145-129857167 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562817 12:129857180-129857202 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562828 12:129857215-129857237 TGCCCTTGTAACGGAGTCCAGGG + Intronic
1104562840 12:129857250-129857272 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562852 12:129857285-129857307 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562863 12:129857320-129857342 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562874 12:129857355-129857377 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562885 12:129857390-129857412 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562897 12:129857425-129857447 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562908 12:129857460-129857482 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562919 12:129857495-129857517 TGCCCTTGTAACGGAGTCCAGGG + Intronic
1104562930 12:129857530-129857552 TGCCCTTGTAACGGAGTCCAGGG + Intronic
1104562941 12:129857565-129857587 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104562959 12:129857629-129857651 TGCCCTTGTAACAGAGTCCAGGG + Intronic
1104562971 12:129857664-129857686 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104562981 12:129857699-129857721 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104562992 12:129857734-129857756 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104563004 12:129857769-129857791 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104563015 12:129857804-129857826 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104563026 12:129857839-129857861 TGCCCTTGTAACGGAGTCCAGGG + Intronic
1104563037 12:129857874-129857896 TGCCCTTGTAACGGAGTCCAGGG + Intronic
1104563048 12:129857909-129857931 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104563059 12:129857944-129857966 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104563070 12:129857979-129858001 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104563081 12:129858014-129858036 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104563092 12:129858049-129858071 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104563103 12:129858084-129858106 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104563115 12:129858119-129858141 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104563126 12:129858154-129858176 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104563144 12:129858218-129858240 TGCCCTTGTAACAGAGTCCAGGG + Intronic
1104563156 12:129858253-129858275 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104563166 12:129858288-129858310 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104563177 12:129858323-129858345 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104563189 12:129858358-129858380 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104563200 12:129858393-129858415 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104563211 12:129858428-129858450 TGCCCTTGTAACGGAGTCCAGGG + Intronic
1104563222 12:129858463-129858485 TGCCCTTGTAACGGAGTCCAGGG + Intronic
1104563233 12:129858498-129858520 TGCCCTTGTAACGGAGTCCAGGG + Intronic
1104563244 12:129858533-129858555 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104563255 12:129858568-129858590 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104563264 12:129858603-129858625 TGCCCTTGTAACAGAGTCCTGGG + Intronic
1104563274 12:129858638-129858660 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104563284 12:129858673-129858695 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104563294 12:129858708-129858730 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104563305 12:129858743-129858765 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104563316 12:129858778-129858800 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104563327 12:129858813-129858835 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104563338 12:129858848-129858870 TGCCCTTGTAACAGAGTCCGGGG + Intronic
1104563349 12:129858883-129858905 TGCCCTTATAACAGAGTCCGGGG + Intronic
1104563360 12:129858917-129858939 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1104563396 12:129859012-129859034 TGCCCTAGTAACGGAGTCCGGGG + Intronic
1104563408 12:129859047-129859069 TGCCCTTGTAACGGAGTCCGGGG + Intronic
1110758749 13:79207016-79207038 TGCCCTAGTAAAGGAAACCTGGG - Intergenic
1119725468 14:76919490-76919512 TGCCCCAGTAGCAGAGCCCGAGG + Intergenic
1122906185 14:104802629-104802651 TGCCCAAGTTACCGAGTCTGAGG - Exonic
1202854890 14_GL000225v1_random:43962-43984 TTTCCTAGAAACGGAGGCCGCGG + Intergenic
1160903090 19:1438886-1438908 TGTCCTAGTAAGGGCGGCCGCGG + Exonic
947128372 2:226895563-226895585 TGCCCAATTAAGGGAGTCGGGGG + Intronic
947908913 2:233789138-233789160 TGCCCTATTGAGGGAGTCTGTGG - Intronic
975688905 4:76946935-76946957 TGCCATAGTAAGGGAGCCAGGGG + Intergenic
977263740 4:94829726-94829748 TGCTCTAGTAAGGAAGTCCAAGG + Intronic
979403454 4:120280321-120280343 TTCCCTAAAAACGGAGTCTGAGG - Intergenic
994119973 5:96102418-96102440 TCCCCTACTAACTGAGTCTGGGG + Intergenic
1007553406 6:42746767-42746789 TGCCCTAGTAACTGCCTGCGGGG - Intergenic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1037196612 8:16198571-16198593 TGTTCTATTAAAGGAGTCCGGGG - Intronic
1038388767 8:27175138-27175160 TCCCCCAGGAACGGAGTCCTGGG - Intergenic
1057262272 9:93591765-93591787 TTCCCTAGCAAGGGAGTCAGAGG + Intronic
1186122779 X:6381695-6381717 TGCTCTGGTTAAGGAGTCCGTGG + Intergenic
1187669999 X:21658013-21658035 GCCCCTAGTAACGGAGGGCGCGG + Exonic
1189044136 X:37572498-37572520 TGCCCGAGCCACGGAGTCCGGGG - Intronic