ID: 1104569082

View in Genome Browser
Species Human (GRCh38)
Location 12:129909383-129909405
Sequence GCCCCTGTTCTGCTTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104569073_1104569082 1 Left 1104569073 12:129909359-129909381 CCAGACTCCCATCCCTTCCACGG No data
Right 1104569082 12:129909383-129909405 GCCCCTGTTCTGCTTCCCACTGG No data
1104569077_1104569082 -6 Left 1104569077 12:129909366-129909388 CCCATCCCTTCCACGGGGCCCCT No data
Right 1104569082 12:129909383-129909405 GCCCCTGTTCTGCTTCCCACTGG No data
1104569078_1104569082 -7 Left 1104569078 12:129909367-129909389 CCATCCCTTCCACGGGGCCCCTG No data
Right 1104569082 12:129909383-129909405 GCCCCTGTTCTGCTTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104569082 Original CRISPR GCCCCTGTTCTGCTTCCCAC TGG Intergenic
No off target data available for this crispr