ID: 1104569349

View in Genome Browser
Species Human (GRCh38)
Location 12:129911354-129911376
Sequence CTGGAAATAAACGCAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104569344_1104569349 23 Left 1104569344 12:129911308-129911330 CCAGTCTCAAAAAAAGTGACTGA No data
Right 1104569349 12:129911354-129911376 CTGGAAATAAACGCAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104569349 Original CRISPR CTGGAAATAAACGCAGCAGC AGG Intergenic
No off target data available for this crispr