ID: 1104572594

View in Genome Browser
Species Human (GRCh38)
Location 12:129938215-129938237
Sequence TCCAGCTGGCTCACCAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104572591_1104572594 12 Left 1104572591 12:129938180-129938202 CCTGCATCTTAGGGGAATGGCAT No data
Right 1104572594 12:129938215-129938237 TCCAGCTGGCTCACCAGAGCTGG No data
1104572590_1104572594 13 Left 1104572590 12:129938179-129938201 CCCTGCATCTTAGGGGAATGGCA No data
Right 1104572594 12:129938215-129938237 TCCAGCTGGCTCACCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104572594 Original CRISPR TCCAGCTGGCTCACCAGAGC TGG Intergenic
No off target data available for this crispr