ID: 1104574370

View in Genome Browser
Species Human (GRCh38)
Location 12:129953383-129953405
Sequence ATAGGCCAACTGGCCAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104574365_1104574370 -2 Left 1104574365 12:129953362-129953384 CCCAATAATCCAGGGTGCAGAAT No data
Right 1104574370 12:129953383-129953405 ATAGGCCAACTGGCCAAGTCTGG No data
1104574364_1104574370 3 Left 1104574364 12:129953357-129953379 CCATGCCCAATAATCCAGGGTGC No data
Right 1104574370 12:129953383-129953405 ATAGGCCAACTGGCCAAGTCTGG No data
1104574366_1104574370 -3 Left 1104574366 12:129953363-129953385 CCAATAATCCAGGGTGCAGAATA No data
Right 1104574370 12:129953383-129953405 ATAGGCCAACTGGCCAAGTCTGG No data
1104574361_1104574370 30 Left 1104574361 12:129953330-129953352 CCTTTTGCAAGCTGGTGAGCAGC No data
Right 1104574370 12:129953383-129953405 ATAGGCCAACTGGCCAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104574370 Original CRISPR ATAGGCCAACTGGCCAAGTC TGG Intergenic
No off target data available for this crispr