ID: 1104575659

View in Genome Browser
Species Human (GRCh38)
Location 12:129963764-129963786
Sequence CTCCCCTGCAGGGCCTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104575659_1104575664 -9 Left 1104575659 12:129963764-129963786 CCCATGGAGGCCCTGCAGGGGAG No data
Right 1104575664 12:129963778-129963800 GCAGGGGAGAAGCCAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104575659 Original CRISPR CTCCCCTGCAGGGCCTCCAT GGG (reversed) Intergenic
No off target data available for this crispr