ID: 1104579783 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:130002753-130002775 |
| Sequence | CTCATGTCAGGTACATCCAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1104579783_1104579788 | 7 | Left | 1104579783 | 12:130002753-130002775 | CCCATGGATGTACCTGACATGAG | No data | ||
| Right | 1104579788 | 12:130002783-130002805 | GATCAGAGGAAAAAGAGATTAGG | No data | ||||
| 1104579783_1104579787 | -7 | Left | 1104579783 | 12:130002753-130002775 | CCCATGGATGTACCTGACATGAG | No data | ||
| Right | 1104579787 | 12:130002769-130002791 | ACATGAGGCTGATAGATCAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1104579783 | Original CRISPR | CTCATGTCAGGTACATCCAT GGG (reversed) | Intergenic | ||