ID: 1104579784

View in Genome Browser
Species Human (GRCh38)
Location 12:130002754-130002776
Sequence CCTCATGTCAGGTACATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104579784_1104579787 -8 Left 1104579784 12:130002754-130002776 CCATGGATGTACCTGACATGAGG No data
Right 1104579787 12:130002769-130002791 ACATGAGGCTGATAGATCAGAGG No data
1104579784_1104579788 6 Left 1104579784 12:130002754-130002776 CCATGGATGTACCTGACATGAGG No data
Right 1104579788 12:130002783-130002805 GATCAGAGGAAAAAGAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104579784 Original CRISPR CCTCATGTCAGGTACATCCA TGG (reversed) Intergenic