ID: 1104579786

View in Genome Browser
Species Human (GRCh38)
Location 12:130002765-130002787
Sequence TGATCTATCAGCCTCATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104579786_1104579788 -5 Left 1104579786 12:130002765-130002787 CCTGACATGAGGCTGATAGATCA No data
Right 1104579788 12:130002783-130002805 GATCAGAGGAAAAAGAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104579786 Original CRISPR TGATCTATCAGCCTCATGTC AGG (reversed) Intergenic