ID: 1104579787

View in Genome Browser
Species Human (GRCh38)
Location 12:130002769-130002791
Sequence ACATGAGGCTGATAGATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104579781_1104579787 22 Left 1104579781 12:130002724-130002746 CCAGGAAGCTGCATTCAATGGAA No data
Right 1104579787 12:130002769-130002791 ACATGAGGCTGATAGATCAGAGG No data
1104579780_1104579787 23 Left 1104579780 12:130002723-130002745 CCCAGGAAGCTGCATTCAATGGA No data
Right 1104579787 12:130002769-130002791 ACATGAGGCTGATAGATCAGAGG No data
1104579783_1104579787 -7 Left 1104579783 12:130002753-130002775 CCCATGGATGTACCTGACATGAG No data
Right 1104579787 12:130002769-130002791 ACATGAGGCTGATAGATCAGAGG No data
1104579784_1104579787 -8 Left 1104579784 12:130002754-130002776 CCATGGATGTACCTGACATGAGG No data
Right 1104579787 12:130002769-130002791 ACATGAGGCTGATAGATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104579787 Original CRISPR ACATGAGGCTGATAGATCAG AGG Intergenic