ID: 1104579788

View in Genome Browser
Species Human (GRCh38)
Location 12:130002783-130002805
Sequence GATCAGAGGAAAAAGAGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104579786_1104579788 -5 Left 1104579786 12:130002765-130002787 CCTGACATGAGGCTGATAGATCA No data
Right 1104579788 12:130002783-130002805 GATCAGAGGAAAAAGAGATTAGG No data
1104579783_1104579788 7 Left 1104579783 12:130002753-130002775 CCCATGGATGTACCTGACATGAG No data
Right 1104579788 12:130002783-130002805 GATCAGAGGAAAAAGAGATTAGG No data
1104579784_1104579788 6 Left 1104579784 12:130002754-130002776 CCATGGATGTACCTGACATGAGG No data
Right 1104579788 12:130002783-130002805 GATCAGAGGAAAAAGAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104579788 Original CRISPR GATCAGAGGAAAAAGAGATT AGG Intergenic